on July 8, 2018 by guest

Transcription

1 JCM Accepts, published online ahead of print on 16 January 2013 J. Clin. Microbiol. doi: /jcm Copyright 2013, American Society for Microbiology. All Rights Reserved Rapid and Simultaneous Detection of bla KPC and bla NDM using Multiplex Real-Time PCR Michael Milillo, Yoon I. Kwak, Erik Snesrud, Paige E. Waterman, Emil Lesho, and Patrick McGann* Multidrug-resistant organism Repository and Surveillance Network, Walter Reed Army Institute of Research, Silver Spring, MD, USA Running Title: Bla KPC and bla NDM in Gram-negative bacteria *Corresponding Author Patrick McGann, PhD Multidrug Resistant organism Repository and Surveillance Network Room 2S35 Walter Reed Army Institute of Research, Silver Spring, MD USA Ph: (301) Fax: (301) patrick.mcgann@amedd.army.mil Downloaded from on July 8, 2018 by guest 1

2 Abstract. The increasing incidence of carbapenem non-susceptibility among clinically-important species is of global concern. Identifying the molecular mechanisms underlying carbapenem nonsusceptibility is critical for epidemiological investigations. In this report, we describe a real-time PCR based assay capable of simultaneously detecting bla KPC and bla NDM, two of the most important carbapenemases, directly from culture in less than ninety minutes. The assay was validated with bla KPC - and bla NDM -carrying clinical isolates and demonstrated 100% concordance with the CarbaNP test. Text The potent antimicrobial activity of the carbapenems (ertapenem, doripenem, imipenem, and meropenem) is being increasingly compromised by the emergence and international dissemination of carbapenem-hydrolyzing β-lactamases (carbapenemases) (1-3). Culture-based methods, such as the Modified Hodge test, combined with antibiotic susceptibilities remain the principal method used to detect carbapenemase activity. These methods have limitations, including the inability to differentiate the molecular mechanism involved, extended turnaround times, and inconclusive results, particularly with non-enterobacteriaceae such as Acinetobacter baumannii and Pseudomonas aeruginosa (4-6). Molecular methods for detecting carbapenemase genes provide several advantages over culture-based techniques including high sensitivity and rapid turnaround time. Furthermore, they provide a critical resource for epidemiological investigations. Despite their advantages, implementation of molecular methods has been slow, primarily due to concerns with allelic variation within target genes, primer cross-reactions, and high costs (7). 2

3 Bla KPC and bla NDM, have received global attention due to their widespread distribution (2, 8-9), broad range of activity against β-lactams (3), and association with serious clinical infections (10, 11). As of this writing, the sequences of thirteen bla KPC alleles and six bla NDM alleles have been deposited at Genbank. However, unlike other important carbapenemase genes, such as bla VIM and bla IMP, allelic variation in bla KPC and bla NDM is very low. The Multidrug-resistant organism Repository and Surveillance Network (MRSN) collects and characterizes multidrug-resistant organisms (MDRO) across the United States Military Health System to enhance infection prevention, inform empiric therapy, and influence policy (12). Over 20 military healthcare facilities world-wide, including those in war zones, monthly submit an average of 300 clinical isolates, comprised of methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococci, multi-, extremely, and pan-drug resistant Gram-negative bacteria. Thirty-five to 50 are submitted as carbapenem resistant, the majority of whom are A. baumannii and P.aeruginosa. 137 carbapenem-resistant Enterobacteriaceae (CRE) have been submitted since 2010, with 97 displaying ertapenem resistant but imipenem/meropenem sensitive phenotypes. All carbapenem-resistant isolates are tested for bla KPC, bla IMP, bla OXA-48, bla VIM, and bla NDM using separate, individual real-time PCR assays. In this report we describe a novel triplex assay that simultaneously detects all variants of bla KPC and bla NDM. Primers and probes (Table 1) for bla KPC and bla NDM were designed using Beacon Designer 7.0 (PREMIER Biosoft International, CA, USA) using an alignment of all sequence variants available in GenBank. An internal control, based on 16S rrna, was designed using an alignment of 16S rrna sequences from 45 Enterobacteriaceae (Supplemental Table S1), A. baumannii, A. nosocomialis, A. pitii, and P. aeruginosa. The 16S rrna primer and probe amplified a product from every organism tested, including clinical isolates of Acinetobacter baumannii, Enterobacter 3

4 aerogenes, Enterobacter cloacae, Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa. Amplification was also achieved from American Type Culture Collection strains (n=32) (ATCC, Manassas, VA) and clinical isolates (n= 18) representing fifty different bacterial species (14), including Achromobacter, Aeromonas, Alicaligenes, Burkholderia, Citrobacter, Hafnia, Kluyvera, Moraxella, Morganella, Proteus, Serratia, Salmonella, Shigella and Stenotrophomonas (Supplemental Figure 1). Primers and probes were validated and optimized individually and in a triplex reaction using minimum information for publication of quantitative real-time PCR experiments (MIQE) guidelines (13). The optimized triplex assay was tested against 26 bla KPC2 (Escherichia coli n =4, Enterobacter cloacae n=2, Klebsiella pneumoniae n= 20), 1 bla KPC3 (Klebsiella pneumoniae n= 20) and 3 bla NDM1 (Acinetobacter baumannii n=1, A. schindleri n=1, Providencia stuartii n=1) clinical isolates cultured from urine (30%), respiratory (20%), wound (17%), blood (10%), sterile tissue (7%), sterile fluid (3.3%), and surveillance (Groin 10%, Rectal 3.3%) samples collected between 2010 and 2012 (Supplemental Table 2). All genes were previously detected using the uniplex assays and confirmed by sequencing. Rapid DNA extraction (23 minute protocol) was performed using Lyse-and-go (Thermo Scientific, Waltham, MA) as described (14). Real-time PCR was performed on a CFX96 cycler (Bio-Rad Laboratories, Hercules, CA) using iq Multiplex Powermix (BioRad) in 20 µl volumes. Cycling parameters were 95 o C for 5 m, 40 cycles of 95 o C for 10 s and 56 o C for 40 s. Appropriate positive (K. pneumoniae ATCC1705, bla KPC-2 +; K. pneumoniae NCTC13443, bla NDM-1 +, A. baumannii NDM2, bla NDM-2 +), negative (ATCC 1706), and no template controls (water) were incorporated onto every plate. In parallel, all isolates were tested for carbapenemase production using the Carba NP test as described (15). The total time for the entire procedure was 88 minutes. 4

5 Bla KPC and bla NDM carrying isolates were recovered from a variety of clinical sites (Supplemental Table 2). All isolates were classified as non-susceptible to ertapenem ( 2 µg/ml) (16) (Supplemental Table 2). Two isolates, MRSN and 11906, were intermediate to imipenem (2 µg/ml) but non-susceptible to meropenem ( 4 µg/ml). Conversely, MRSN was susceptible to meropenem ( 1 µg/ml) but non-susceptible to imipenem ( 4 µg/ml). These data support previous studies that have shown varying susceptibilities to carbapenems by producers of KPC and NDM (17-19). In our surveillance network, non-susceptibility to ertapenem in the Enterobacteriaceae is used as the main criterion for selecting isolates for gene screening. However, this criterion is not suitable for P. aeruginosa and Acinetobacter species and in our experience has led to unnecessary screening of Enterobacteriaceae with altered outer-membrane porins or AmpC enzyme producers (18, 20). By using the CarbaNP test, the number of isolates selected for real-time PCR can be greatly reduced. The triplex assay was capable of detecting <100 genome copies of bla KPC and bla NDM, and amplified the expected product from all bla KPC and bla NDM -carrying isolates. In contrast, only the 16S primer and probe amplified a product from 97 ertapenem resistant but imipenem/meropenem sensitive Enterobacteriaceae, and 45 imipenem-resistant clinical isolates of A. baumannii and Pseudomonas aeruginosa that were previously determined to be bla KPC and bla NDM -negative by uniplex real-time PCR. All bla KPC and bla NDM carrying Enterobacteriaceae in this study were positive for carbapenemase production using the CarbaNP test (15). The test was unable to detect NDM-1 carbapenemase production in Acinetobacter species, most likely due to weak enzyme production in Acinetobacter species. In Acinetobacter, the bla NDM gene is disproportionally carried as a single copy on the chromosome, rather than on plasmids like many Enterobacteriaceae which may be present in higher copy numbers (21). 5

6 The triplex assay provides a rapid and accurate method for detecting bla KPC and bla NDM. The assay provides considerable advantages over methods that employ melting curve analysis and double stranded DNA binding dyes (22), including the presence of an internal control to reduce false-negatives, the ability to detect both bla KPC and bla NDM in the same target, and removal of the inherent variation in melting curves associated with allelic variation in target genes. After initial capital investments, the average cost per reaction is ~ USD$0.90. The MRSN now initially selects isolates for carbapenemase gene testing based on antibiotic susceptibilities, followed by the Carba NP test where appropriate, and finally real-time PCR. Downloaded from on July 8, 2018 by guest 6

7 Acknowledgements The authors greatly acknowledge U.S. Army Medical Command and the Defense Medical Research and Development Program for providing major funding for this study. The reference strain, Acinetobacter baumannii NDM2, was a kindly provided by Prof. Patrice Nordmann. Material has been reviewed by the Walter Reed Army Institute of Research. There is no objection to its presentation. The opinions or assertions contained herein are the private views of the authors and are not to be construed as official, or reflecting the views of the Department of the Army or the Department of Defense. Downloaded from on July 8, 2018 by guest 7

8 References 1. Nordmann P, Naas T, Poirel L Global spread of Carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 17: Nordmann P, Poirel L, Walsh TR, Livermore DM The emerging NDM carbapenemases. Trends Microbiol. 19: Patel G, Bonomo RA Status report on carbapenemases: challenges and prospects. Expert Rev. Anti Infect. Ther. 9: Girlich D, Poirel L, Nordmann P Value of the modified Hodge test for detection of emerging carbapenemases in Enterobacteriaceae. J. Clin. Microbiol. 50: Noyal MJ, Menezes GA, Harish BN, Sujatha S, Parija SC Simple screening tests for detection of carbapenemases in clinical isolates of nonfermentative Gramnegative bacteria. Indian J. Med. Res. 129: Pasteran F, Veliz O, Rapoport M, Guerriero L, Corso A Sensitive and specific modified Hodge test for KPC and metallo-beta- lactamase detection in Pseudomonas aeruginosa by use of a novel indicator strain, Klebsiella pneumoniae ATCC J. Clin. Microbiol. 49: Sibley CD, Peirano G, Church DL Molecular methods for pathogen and microbial community detection and characterization: current and potential application in diagnostic microbiology. Infect. Genet. Evol. 12: Nordmann P, Dortet L, Poirel L Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends Mol. Med. 18: Walsh TR, Toleman MA The emergence of pan-resistant Gram-negative pathogens merits a rapid global political response. J. Antimicrob. Chemother. 67:1-3. 8

9 Patel G, Huprikar S, Factor SH, Jenkins SG, Calfee DP Outcomes of carbapenem-resistant Klebsiella pneumoniae infection and the impact of antimicrobial and adjunctive therapies. Infect. Control Hosp. Epidemiol. 29: Schwaber MJ, Klarfeld-Lidji S, Navon-Venezia S, Schwartz D, Leavitt A, Carmeli Y Predictors of carbapenem-resistant Klebsiella pneumoniae acquisition among hospitalized adults and effect of acquisition on mortality. Antimicrob. Agents Chemother. 52: Waterman P, Kwak Y, Clifford R, Julius M, Onmus-Leone F, Tsurgeon C, Riley M, Black C, McGann P, Lesho E A multidrug-resistance surveillance network: 1 year on. Lancet Infect. Dis. 12: Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 55: Clifford RJ, Milillo M, Prestwood J, Quintero R, Zurawski DV, Kwak YI, Waterman PE, Lesho EP, Mc Gann P Detection of Bacterial 16S rrna and Identification of Four Clinically Important Bacteria by Real-Time PCR. PloS one 7:e Nordmann P, Poirel L, Dortet L Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerg. Infect. Dis. 18: Clinical and Laboratory Standards Institute Performance standards for antimicrobial susceptibility testing. M100 S22. Wayne (PA) 9

10 Miriagou V, Cornaglia G, Edelstein M, Galani I, Giske CG, Gniadkowski M, Malamou-Lada E, Martinez-Martinez L, Navarro F, Nordmann P, Peixe L, Pournaras S, Rossolini GM, Tsakris A, Vatopoulos A, Canton R Acquired carbapenemases in Gram-negative bacterial pathogens: detection and surveillance issues. Clin. Microbiol. Infect. 16: Nordmann P, Cuzon G, Naas T The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect. Dis. 9: Thomson KS Extended-spectrum-beta-lactamase, AmpC, and Carbapenemase issues. J. Clin. Microbiol. 48: Munier GK, Johnson CL, Snyder JW, Moland ES, Hanson ND, Thomson KS Positive extended-spectrum-beta-lactamase (ESBL) screening results may be due to AmpC beta-lactamases more often than to ESBLs. J. Clin. Microbiol. 48: Bonnin RA, Naas T, Poirel L, Nordmann P Phenotypic, biochemical, and molecular techniques for detection of metallo-beta-lactamase NDM in Acinetobacter baumannii. J. Clin. Microbiol. 50: Monteiro J, Widen RH, Pignatari AC, Kubasek C, Silbert S Rapid detection of carbapenemase genes by multiplex real-time PCR. J. Antimicrob. Chemother. 67(4):

11 190 Table 1. Primers and probes used in this study Name 1 Sequence (5 3 ) 2 Conc. (nm) 3 Location 4 Eff (%) 5 16SMP-F AAGTCGGAATCGCTAGTAATCG SMP-R ATGGTGTGACGGGCGGT SMP-P 6FAMTGTACAAGG-ZEN CCCGGGAACGTATTCA-IABkFQ KPCMP-F CTGTGCAGCTCATTCAAG KPCMP-R CATGCCTGTTGTCAGATA KPCMP-P HEXTTCTTGCTG-ZEN-CCGCTGTGCTG-IABkFQ NDMMP-F GCCCAATATTATGCACCC NDMMP-R GTCGCCAGTTTCCATTTG NDMMP-P TEX615CGTTGGGATCGACGGCACC-BHQ Abbreviations: 6FAM, 6-Carboxyfluorescein; BHQ_2, Black Hole quencher 2; HEX, Hexachlorofluorescein; IABkFQ, Iowa Black fluorescence quencher; TEX615, Texas Red KPC primers and probe target all 13 variants of bla KPC ; NDM primers and probe target all 6 variants of bla NDM 2 16SMP-Probe and KPCMP-Probe contain a double internal ZEN quencher. 3 Optimal primer and probe concentrations in the triplex assay were determined by titration as described (13). For uniplex reactions, all primer and probe concentrations should be 250 nm and 200 nm, respectively. 11

12 Relative to the first base pair of the coding region of bla KPC-2 and bla NDM-1. 16S rrna location is approximate. 5 Efficiency was calculated from the triplex assay. The 16S rrna primers and probe have an efficiency >100% as the positive control was a combination of DNA from K. pneumoniae ATCC 1705 (bla KPC-2 ) and A. baumannii NDM2 (bla NDM-2 ). All primers have an efficiency 98% when used alone. R 2 98% for all primers and probes. Downloaded from on July 8, 2018 by guest 12

13 AUTHOR CORRECTION Correction for Milillo et al., Rapid and Simultaneous Detection of bla KPC and bla NDM by Use of Multiplex Real-Time PCR Michael Milillo, Yoon I. Kwak, Erik Snesrud, Paige E. Waterman, Emil Lesho, Patrick McGann Multidrug-Resistant Organism Repository and Surveillance Network, Walter Reed Army Institute of Research, Silver Spring, Maryland, USA Volume 51, no. 4, p , Page 1248, Table 1, Sequence column, NDMMP-F row: GCCCAATATTATGCACCC should read GGCCACACCAGTGACAATATC. Page 1248, Table 1, Sequence column, NDMMP-R row: GTCGCCAGTTTCCATTTG should read AGGCAGCCACCAAAAGC. Citation Milillo M, Kwak YI, Snesrud E, Waterman PE, Lesho E, McGann P Correction for Milillo et al., Rapid and simultaneous detection of bla KPC and bla NDM by use of multiplex real-time PCR. J Clin Microbiol 53:1460. doi: /jcm Copyright 2015, American Society for Microbiology. All Rights Reserved. doi: /jcm jcm.asm.org Journal of Clinical Microbiology April 2015 Volume 53 Number 4