Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Transcription

1 SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well of growth factorreduced Matrigel (BD Biosciences) and incubated at 37 C for 30 min to allow the Matrigel to solidify. Afterwards, 4,000 MiaPaCa-2 cells in culture medium contain 2% Matrigel were added into wells in triplicate. Medium containing 2% Matrigel was changed every 4 days. The number of cells was counted every 4 days after trypsinization. Soft agar colony formation assay- Growth and survival of MiaPaCa-2 cells in soft agar was determined as described (2). Briefly, 48 h after infection or treatment with Ac-5SGlcNAc or vehicle, MiaPaCa-2 cells and BxPC-3 cells were dispensed in 2ml of 0.3% agarose-containing DMEM with 10% FBS. Cell suspensions were then added to 6-well plates in triplicate coated with a 0.6% agar layer. Fresh medium was provided every 4 days. Inhibitor Ac-5SGlcNAc or vehicle was included in top agar and feeding media. Colonies were stained with 1ml of 0.005% crystal violet and photographed. The number of colonies (> 50 µm) was counted in 5 random fields at 10x magnification. Lentiviral shrna production and infection- Lentiviral plko.1-puro vectors encoding shrna specific for OGT or control scramble were purchased from Addgene, Cambridge, MA and Sigma TRC shrna library. Control scramble shrna sequence used was: CCTAAGGTTAAGTCGCCCTCGCTCTAGCGAGGGCGACTTAACCTT. OGT shrna sequences used were: for OGT-1 (TRCN ), GCCCTAAGTTTGAGTCCAAATCTCGAGATTTGGACTCAAACTTAGGGC and for OGT-2 (TRCN ), GCTGAGCAGTATTCCGAGAAACTCGAGTTTCTCGGAATACTGCTCAGC. For lentiviral production, 293T cells were transfected with 10 µg plko vectors together with packaging plasmids encoding Gag/Pol, Rev, and VSV-G using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer s instructions. Culture growth media containing lentiviral particles were collected 48 and 72 h post-transfection and filtered through 0.45 µm filters. Viral supernatants were pooled and stored at -80 C. Target cells were infected with viruses in media containing polybrene (8 µg/ml). Luciferase Assay- MiaPaCa-2 cells were seeded into 6-well plates at the concentration of /well. After 24 h, cells were infected with scramble or OGT shrna viruses. After 16h, cells were then co-transfected with 1µg of NF-κB luciferase reporter pnf-κb-luc WT and 50 ng of Renilla luciferase plasmid phrl-tk (Promega) using Lipofectamine 2000 transfection reagent (Invitrogen). For BxPC-3 cells, cells were seeded into 6-well plates. After 24h, cells were co-transfected with above plasmids. Six hours later, cells were treated with 50 µm NButGT. Cell lysates were prepared 24 hours after transfection or drug treatment. Reporter activities were analyzed using the Promega dual luciferase assay kit (Promega) according to the manufacturer s protocol. The luciferase activity was normalized to the Renilla luciferase activity and results were reported as fold relative to the activity of scramble infected or vehicle treated. Data are the average of three independent experiments performed in duplicate. Nuclear extract preparation- MiaPaCa-2 cells unstimulated or stimulated with 10 ng/ml TNFα for 10 min were then rinsed twice with PBS and lysed in hypotonic buffer (10 mm HEPES, 1.5 mm MgCl 2, 10 mm KCl, 1 mm dithiothritol, protease inhibitors) on ice for 30 min and homogenized to disrupt cell membrane. Nuclei pellets were collected by centrifugation at 11,000 g for 20 min and washed three times with hypotonic lysis buffer. Pellets were subsequently resuspended in hypertonic buffer (20 mm HEPES, 1.5 mm MgCl 2, 420 mm NaCl, 0.2 mm EDTA, 1 mm dithiothritol, 25% (v/v) Glycerol, protease inhibitors) and incubated for 30 min at 4 C on rotating wheels. After centrifugation at 16,000 g for 20 min, supernatants were harvested as nuclear extracts for immunoblotting. Anoikis Assay- Anoikis resistance was induced as previously described (3). In brief, tissue culture plates were treated with PolyHEMA (7 mg/ml, in 95% ethanol), left to dry at 37 C, and washed twice with PBS prior to use. BxPC-3 cells were pre-treated with 50 µm NButGT for 6 h. Cells were then suspended in culture medium at a density of 200,000 cells/ml and incubated in the PolyHEMA-coated plates for additional 24 h in the presence of NButGT. Cell suspensions were collected, washed twice with PBS, and then processed for immunoblotting and apoptotic assay. 1

2 Immunohistochemistry- Pancreatic tissue slides were a kind gift from Dr. Anil K. Rustgi (University of Pennsylvania, Philadelphia, PA). Slides were stained and analyzed by Pathology Diagnostic Laboratory at Drexel University College of Medicine. Tissue slides were stained with O-GlcNAc (CTD 110.6) at 1:100 dilution, visualized using the chromogenic visualization 3,3 -diaminobenzidine kit (Vector Laboratories), and counterstained with hematoxylin. 1. Gutierrez-Barrera, A. M., Menter, D. G., Abbruzzese, J. L., and Reddy, S. A. (2007) Establishment of three-dimensional cultures of human pancreatic duct epithelial cells. Biochemical and biophysical research communications 358, Caldwell, S. A., Jackson, S. R., Shahriari, K. S., Lynch, T. P., Sethi, G., Walker, S., Vosseller, K., and Reginato, M. J. (2010) Nutrient sensor O-GlcNAc transferase regulates breast cancer tumorigenesis through targeting of the oncogenic transcription factor FoxM1. Oncogene 29, Duxbury, M. S., Ito, H., Zinner, M. J., Ashley, S. W., and Whang, E. E. (2004) CEACAM6 gene silencing impairs anoikis resistance and in vivo metastatic ability of pancreatic adenocarcinoma cells. Oncogene 23,

3 SUPPLEMENTAL FIGURE LEGENDS Supplemental figure 1. Hyper-O-GlcNAcylation occurs in human pancreatic cancer tissue. Human pancreatic cancer tissue and normal tissue samples were immunostainned using anti-o-glcnac antibody (CTD110.6). Representative stains are shown here. Supplemental figure 2. Reducing hyper-o-glcnacylation inhibits PDAC cell growth. (A) Panc-1 cells were infected with scramble, shogt1, or shogt2 plko.1 lentivirus. The expression of OGT and O- GlcNAc was examined by western blotting. (B) Panc-1 cells infected with lentiviruses as in panel A were seeded into 12-well plates 48h after infection. Cell number was counted using a hemocytometer. (C) Panc-1 cells were infected with lentiviruses as in panel A and placed into soft agar 48h after infection. Colonies were stained 14 days later and quantified. (D) MiaPaCa-2 cells were infected with scramble, shogt1, or shogt2 plko.1 lentivirus and seeded into 3D culture 48h after infection. Cell number was counted using a hemocytometer and imaged at Day 6. (E) BxPC-3 cells stably expressing pbabe or Flagtagged WT p65 were infected with scramble, shogt1, or shogt2 viruses and selected with puromycin at a concentration of 3 µg/ml for 48 h. Cells were placed into soft agar. Colonies were stained 21 days later and quantified. Representative images are shown in insert. Data are presented as the mean ± SD of triplicate samples. ***, p< #, non-specific bands. Supplemental figure 3. Reducing O-GlcNAc does not affect cell proliferation and does not activate caspase-3 in HPDE cells. (A) HPDE cells were infected with scramble, shogt1, or shogt2 viruses and cultured for 2 days or 6 days. Cell lysates were collected and subjected to immunoblotting for O-GlcNAc, OGT and OGA. β-actin served as a loading control. (B) HPDE cells were infected with Scramble, shogt1, or shogt2 viruses and seeded into 12-well plates 48h after infection. Cell number was counted for 5 consecutive days using a hemocytometer. (C) Panc-1 cells were infected with scramble, shogt1, or shogt2 plko.1 lentivirus and cultured for 2 days or 6 days. Cell lysates were collected and subjected to immunoblotting for cleaved caspases-3. β-actin served as a loading control. (D) HPDE cells were infected with scramble, shogt1, or shogt2 viruses. Cell lysates were collected at 2 days and 6 days after infection and probed for cleaved caspase-3. Cell lysates from MiaPaCa-2 cells infected with shogt1 virus served as a positive control for cleaved caspase-3. β-actin served as a loading control. #, nonspecific bands. Supplemental figure 4. The effect of reducing hyper-o-glcnacylation in MiaPaCa-2 cells on tumor growth in vivo. MiaPaCa-2 cells expressing scramble, shogt1, or shogt2 were orthotopically injected into the pancreas of SCID mice. Pictures were taken after the mice were euthanized at 8 weeks. The presence of tumor was confirmed by GFP. Representative images from each group of gross view and microscopy view under dissecting fluorescence microscope are shown. Supplemental figure 5. IKKβ is constitutively O-GlcNAcylated and O-GlcNAc regulates NF-κB signaling. (A) IKKβ immunopricipitates from HPDE, MiaPaCa-2 and BxPC-3 cells were western blotted for O- GlcNAc on IKKβ. (B) MiaPaCa-2 and BxPC-3 cells were infected with scramble, shogt1, or shogt2 lentivirus and IKKβ immunopricipitates were western blotted for IKKβ and O-GlcNAc. (C) MiaPaCa-2 and BxPC-3 cells were treated with or without 50 µm NButGT overnight. The cells were lysed and IKKβ immunopricipitates were western blotted for IKKβ and O-GlcNAc. (D) MiaPaCa-2 and BxPC-3 cells were seeded into 6-well plates and transfected with NF-κB luciferase reporter pnf-κb-luc WT or mutant vector pnf-κb-luc MUT together with Renilla luciferase reporter construct. The relative luciferase activity was measured 24h later and normalized with the Renilla activity. (E) BxPC-3 cells were infected with scramble, shogt1, or shogt2 plko.1 lentivirus. Cell lysates were subjected to immunoblotting for E-cadherin. β-actin served as a loading control. ***, p< Supplemental figure 6. Elevating O-GlcNAcylation increases the nuclear localization of p65. BxPC-3 cells were transfected with plenti4-ha-ogt and then stained with antibodies against O-GlcNAc (green) 3

4 and p65 (red). Nuclei were counterstained with DAPI (blue). Arrowheads indicate increased O-GlcNAc correlates with nuclear localization of p65. 4

5 Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity Supplemental figure 1 5

6 Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity Supplemental figure 2 6

7 Supplemental figure 3 7

8 Supplemental figure 4 8

9 Supplemental figure 5 9

10 Supplemental figure 6 10