Emergence of pathogenicity in the Sporothrix schenckii complex

Transcription

1 Medical Mycology May 2013, 51, Emergence of pathogenicity in the Sporothrix schenckii complex ANDERSON MESSIAS RODRIGUES *, SYBREN DE HOOG & ZOILO PIRES DE CAMARGO * * Department of Microbiology, Immunology and Parasitology, Cellular Biology Division, Federal University of S ã o Paulo, S ã o Paulo, Brazil, and CBS-KNAW Fungal Biodiversity Center, Utrecht, The Netherlands Sporothrix schenckii sensu lato is a complex of thermally dimorphic species whose natural habitats are soil and plant materials. However, the traumatic implantation of the species into human skin is traditionally thought to be the route leading to the fungal disease sporotrichosis. The complex contains Sporotrhix mexicana, S. globosa, S. brasiliensis, S. luriei, in addition to S. schenckii sensu stricto. In this study we evaluated the differences among these species relative to their frequency in the environment and in human hosts, as well as discuss their remarkable diverse pathogenicity. Today, S. brasiliensis is epidemic in and geographically restricted to Brazil. In contrast, S. mexicana and S. globosa have rarely been reported over the decades. We discovered that the species have been present in collections from clinical cases since 1955 and were able to re-identify six isolates originally classified as S. schenckii as Sporothrix mexicana (three isolates) and Sporothrix globosa (three isolates). Despite their long presence as potential human pathogens they have not shown any increase in frequency as etiologic agents of human infections. Keywords Sporothrix mexicana, Sporothrix globosa, Sporothrix schenckii complex, sporotrichosis, calmodulin, first isolation, Brazil Introduction Sporotrichosis, a mycosis that affects humans and animals, is caused by different species of the hyphomycete genus Sporothrix. While the disease is classically characterized by lesions of cutaneous and subcutaneous tissues with regional lymphocutaneous dissemination, pulmonary and systemic infections may also occur [1 3]. The primary infection is caused by traumatic inoculation of environmental material carrying fungal propagules of the etiologic agents [1 3]. Although the relatives of Sporothrix in the fungal order Ophiostomatales are mainly associates of bark beetles on woody plants [4,5], the natural ecology of pathogenic species of the genus are Received 25 May 2012 ; Received in final revised form 11 July 2012 ; Accepted 6 August Correspondence: Zoilo Pires De Camargo, Department of Microbiology, Immunology and Parasitology, Cellular Biology Division, Federal University of S ã o Paulo, Rua Botucatu 862/8, S ã o Paulo, SP, Brazil. Tel.: ; Fax: ; zpcamargo@unifesp.br poorly understood. Over the last decade, the incidence of sporotrichosis has been on the rise in tropical and subtropical areas [6 8], including Brazil [9 15]. More severe or atypical clinical forms of the disease have also been reported [16]. Recent studies revealed high genetic variability among isolates that were morphologically identified as S. schenckii [17 21], which has led to the introduction of new species. Medically relevant Sporothrix species now include S. brasiliensis, S. schenckii, S. globosa, S. mexicana and S. luriei, and the main phenotypic and physiological characteristics of these species have been well described by Marimon et al. [18,19]. Sporothrix mexicana is the most uncommon of the species, with only four strains identified with certainty, i.e., CBS and CBS recovered from plant debris in Mexico [18], FMR 9109, isolated from a soil sample in Sydney, Australia (Madrid H, Cano J, Gen é J, Arthur I, Guarro J. A new putative species in the Sporothrix schenckii complex and new records of Sporothrix species from Australia. XVII Congress of the International Society for Human and Animal Mycology, Tokyo, 2013 ISHAM DOI: /

2 406 Rodrigues et al. 2009; abstr. PP-04 14), and only a single strain MUM from a case of human infection in Portugal [22]. Sporothrix brasiliensis is a frequent pathogen with a regional distribution in Brazil [18,23]. Sporothrix globosa is widespread globally, having been found in the UK, Spain, Italy, China, Japan, the USA, India, Mexico, Guatemala, and Colombia [18,24]. The first Brazilian case of human sporotrichosis caused by this species was described by Oliveira et al. [25]. In the present study we re-examined, by molecular methods, the identification of members of a large collection of isolates from sporotrichosis patients in Brazil, which were previously classified as S. schenckii sensu lato ( s.l. ) on the basis of phenotypic features. We focus on the occurrence and clinical significance of Sporothrix mexicana and S. globosa. Material and methods Fungal strains Clinical isolates of Sporothrix schenckii s.l. from different regions of Brazil (Table 1) were collected from patients with acute, lymphocutaneous or disseminated forms of sporotrichosis and stored as slants cultures on Sabouraud Dextrose agar (SDA; Difco, Detroit, USA) at room temperature. Isolates identified as S. mexicana and S. globosa were regrown on the same medium to be studied in detail. Sporothrix mexicana CBS and CBS , and S. globosa CBS and FMR 8595 were used as reference [18]. Phenotypic characterization Sporothrix mexicana and S. globosa isolates were grown at various temperatures (30, 35, 37 and 40 C) on Potato Dextrose agar (PDA) medium. Petri dishes (9 cm) were centrally inoculated with portions of the colonies of the fungi, approximately 1 mm in diameter, and incubated upside down. After 21 days the colony diameters (in millimeters) were measured in two orthogonal senses, with experiments being conducted in duplicate. Carbohydrate assimilation tests of four sugars (glucose, sucrose, raffinose, and ribitol) were performed in 96-well microtiter plates using 150 μ l of liquid Yeast Nitrogen Base (YNB) medium (Difco, Becton-Dickinson, Sparks, MD, USA) following a protocol described previously [18]. The isolates were grown on PDA medium for days at room temperature and the conidia collected by adding 2 3 ml sterile saline solution (0.85% NaCl). The suspensions were filtered with sterile gauze and quantified in a spectrophotometer at 520 nm. Each suspension was adjusted to an optical density of 0.21 to 0.29, which corresponded to a final concentration between and CFU/ml. Each of the wells was then inoculated with 50 μ l of the suspension and YNB medium with added sugar (final concentration 0.2%). YNB medium without sugar was used as negative control. Microtiter plates were read after 10 days of incubation at 25 C, with all experiments conducted in triplicate. Macroscopic and microscopic features were studied by culturing isolates on PDA plates and on Corn Meal Agar (CMA, Difco) slants incubated for days 30 C in the dark. The observed morphologies characteristics were applied to the dichotomous key to species of the S. schenckii complex [19]. Molecular characterization DNA was extracted and purified from fungal colonies by following the Fast DNA kit protocol (MP Biomedicals, Vista, CA, USA). The calmodulin (CAL) locus region was amplified directly from the genomic DNA by PCR, as described by O Donnell et al. [26], using the degenerate primers CL1-GARTWCAAGGAGGCCTTCTC and CL2A- TTTTTGCATCATGAGTTGGAC, which amplified an 800-bp amplicon corresponding to exons 3 through 5. For the amplification and sequencing of the CAL locus from the fungus Ophiostoma stenoceras we used the primers CL2F (5 -GACAAGGAYGGYGATGGT-3 ) and CL2R (5 -TTCTGCATCATGAGYTGSAC-3 ) which amplified a region corresponding to the second exon through the last exon of this gene [27]. Amplified products were gel-purified with the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA), following the manufacturer s instructions. DNA samples were sequenced with a MegaBACE 1000 DNA Sequencer (Amersham, Sunnyvale, CA, USA) using the DYEnamic ET Dye Terminator Kit (with Thermo Sequenase II DNA Polymerase). Fragments were sequenced on both strands to increase the quality of sequence data (phred 30). Sequence alignment was performed using the ClustalW algorithm [28] implemented in BioEdit software [29]. Retrieved alignments were manually corrected to avoid mis-paired bases. Sequences were exported as FASTA files for BLAST search at Phylogenetic analysis CAL sequences from reference isolates of S. schenckii ( n 12), S. brasiliensis ( n 7), S. mexicana (n 3), S. globosa ( n 17), S. pallida ( n 5), and S. luriei ( n 1) described by Marimon et al. [17 19], Madrid et al. [24], Dias et al. [22], and Romeo et al. [30] were included in the analysis (Table 1). As an outgroup, we

3 Emergence of pathogenicity in the Sporothrix schenckii complex 407 Table 1 Sporothrix /Ophiostoma isolates included in the study. Isolate code Species Source Origin CAL GenBank Reference CBS T Sporothrix brasiliensis Clinical, Human Rio de Janeiro, Brazil AM [17,18] FMR 9034 Sporothrix brasiliensis Clinical, Human S ã o Paulo, Brazil AM [17,18] FMR 8337 Sporothrix brasiliensis Environmental (Dust) Rio de Janeiro, Brazil AM [17,18] CBS (Ss54) Sporothrix brasiliensis Clinical, Animal Rio Grande do Sul, Brazil JQ This study IPEC Sporothrix brasiliensis Clinical, Human Rio de Janeiro, Brazil AM [17,18] IPEC Sporothrix brasiliensis Clinical, Human Rio de Janeiro, Brazil AM [17,18] IPEC Sporothrix brasiliensis Clinical, Human Rio de Janeiro, Brazil AM [17,18] IPEC Sporothrix brasiliensis Clinical, Human Rio de Janeiro, Brazil AM [17,18] Ss27 Sporothrix brasiliensis Clinical, Human Paran á, Brazil JX This study Ss43 Sporothrix brasiliensis Clinical, Human Paran á, Brazil JX This study CBS (Ss62) Sporothrix brasiliensis Clinical, Human Esp í rito Santo, Brazil JX This study Ss125 Sporothrix brasiliensis Clinical, Human S ã o Paulo, Brazil JX This study Ss65 Sporothrix brasiliensis Clinical, Human Rio de Janeiro, Brazil JX This study Ss68 Sporothrix brasiliensis Clinical, Human Rio de Janeiro, Brazil JX This study Ss64 Sporothrix schenckii Clinical, Human Rio de Janeiro, Brazil JX This study CBS (Ss63) Sporothrix schenckii Clinical, Human Rio de Janeiro, Brazil JX This study Ss28 Sporothrix schenckii Clinical, Human Paran á, Brazil JX This study Ss21 Sporothrix schenckii Clinical, Human Paran á, Brazil JX This study Ss20 Sporothrix schenckii Clinical, Human Paran á, Brazil JX This study CBS (Ss118) Sporothrix schenckii Clinical, Human S ã o Paulo, Brazil JX This study Ss31 Sporothrix schenckii Clinical, Human Paran á, Brazil JX This study CBS (Ss03) Sporothrix schenckii Clinical, Human Rio Grande do Sul, Brazil JX This study Ss04 Sporothrix schenckii Clinical, Human Rio Grande do Sul, Brazil JX This study CBS (Ss80) Sporothrix schenckii Clinical, Human Rio de Janeiro, Brazil JX This study FMR 8679 Sporothrix schenckii Clinical, Human Argentina AM [17,18] IHEM Sporothrix schenckii Clinical, Human Bolivia AM [17,18] Ss143 Sporothrix schenckii Clinical, Human Par á, Brazil JQ This study IHEM 3774 Sporothrix schenckii Clinical, Human Colombia AM [17,18] CBS Sporothrix schenckii Clinical, Human France AM [18] IHEM Sporothrix schenckii Clinical, Human Peru AM [17,18] FMR 8607 Sporothrix schenckii Clinical, Human Peru AM [17,18] FMR 8608 Sporothrix schenckii Clinical, Human Peru AM [17,18] FMR 8609 Sporothrix schenckii Clinical, Human Peru AM [17,18] IHEM 3787 Sporothrix schenckii NK South Africa AM [17,18] CBS T Sporothrix schenckii Clinical, Human USA AM [17,18] UTHSC Sporothrix schenckii Clinical, Human USA AM [18] UTHSC Sporothrix schenckii Clinical, Human USA AM [18] CBS (Ss06) Sporothrix globosa Clinical, Human Minas Gerais, Brazil JF This study CBS (Ss41) Sporothrix globosa Clinical, Human Cear á, Brazil JF This study CBS (Ss49) Sporothrix globosa Clinical, Human Goi á s, Brazil JF This study KMU 4214 Sporothrix globosa Environmental China AM [18] KMU 4208 Sporothrix globosa Environmental China AM [18] FMR 9617 Sporothrix globosa Clinical, Human Colombia FM [24] FMR 9619 Sporothrix globosa Clinical, Human Colombia FM [24] FMR 9624 Sporothrix globosa Clinical, Human Guatemala FM [24] MCCL Sporothrix globosa Clinical, Human India AM [18] MCCL Sporothrix globosa Clinical, Human India AM [18] MCCL Sporothrix globosa Clinical, Human India AM [18] IHEM 4178 Sporothrix globosa Clinical, Human Italy AM [18] FMR 9020 Sporothrix globosa Clinical, Human Japan AM [18] FMR 9556 Sporothrix globosa Clinical, Human Mexico FM [24] FMR 8601 Sporothrix globosa Clinical, Human Spain AM [17,18] FMR 8596 Sporothrix globosa Clinical, Human Spain AM [17,18] FMR 8595 Sporothrix globosa Clinical, Human Spain AM [17,18] CBS T Sporothrix globosa Clinical, Human Spain AM [17,18] CBS Sporothrix globosa Clinical, Human United Kingdom AM [18] UTHSC Sporothrix globosa Clinical, Human USA AM [18] CBS T Sporothrix luriei Clinical, Human South Africa AM [19] CBS Ophiostoma stenoceras Clinical, Human France JX This study CBS Ophiostoma stenoceras Environmental NK JX This study CBS Ophiostoma stenoceras Environmental Germany JX This study CBS T Sporothrix mexicana Environmental Mexico AM [18] (Continued)

4 408 Rodrigues et al. Table 1 (Continued). Isolate code Species Source Origin CAL GenBank Reference CBS Sporothrix mexicana Environmental Mexico AM [18] CBS (Ss131) Sporothrix mexicana Clinical, Human Pernambuco, Brazil JF This study CBS (Ss132) Sporothrix mexicana Clinical, Human S ã o Paulo Brazil JF This study CBS (Ss133) Sporothrix mexicana Clinical, Human Pernambuco, Brazil JF This study MUM Sporothrix mexicana Clinical, Human Portugal JF [22] CBS Sporothrix pallida Environmental Germany AM [18] ( Zootermopsis nevadensis ) CBS T Sporothrix pallida Environmental (soil) United Kingdom AM [18] HOL3 Sporothrix pallida Environmental (soil) Holland HQ [30] BG6 Sporothrix pallida Environmental (soil) Spain HQ [30] SPA8 Sporothrix pallida Environmental (soil) Spain HQ [30] CBS T Grosmannia serpens Environmental (wood) Italy JN [27] IPEC, Instituto de Pesquisa Cl í nica Evandro Chagas, Fiocruz, Brazil; FMR, Facultat de Medicina i Ci è ncies de la Salut, Reus, Spain; IHEM, BCCM/ IHEM Biomedical Fungi and Yeasts Collection, Belgium; CBS, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands; KMU, Kanazawa Medical University, Ishikawa, Japan; MCCL, Mycology Culture Collection Laboratory, Postgraduate Institute of Medical Education and Research, Chandigarh, India; UTHSC, Fungus Testing Laboratory, University of Texas Health Science Center; MUM, Micoteca da Universidade do Minho, Braga, Portugal. NK, not known; T, type strain. used the saprophytic fungus Grosmannia serpens (Ophiostomataceae) [27]. We also generated CAL sequences from the fungus Ophiostoma stenoceras CBS , CBS and CBS in order to evaluate its relatedness to the pathogenic and environmental species of the S. schenckii complex. Evolutionary analyses were conducted in MEGA5 [31] with Maximum Likelihood method. Evolutionary distances were computed using the Kimura 2-parameter method [32] with 1,000 bootstrap replicates. Results Fragments of 800 bp and 700 bp of the CAL locus were amplified and sequenced with primers CL1 and CL2A or CL2F and CL2R, respectively. The complete alignment included 73 sequences, 27 generated in this study and 46 retrieved from previous investigation, respectively [17 19,22,24,30]. Aligned sequences of CAL were 682 bp long, including 356 invariable characters, 240 variable parsimony-informative (35.1%), and 72 singletons. Positions containing gaps and missing data were eliminated. The 73 sequences were distributed into seven main groups, six of which were detected in previous studies [17 19,24,30]. The first four clades included the pathogenic species S. brasiliensis (Clade I), S. schenckii (Clade II), S. globosa (Clade III) and S. luriei (Clade VI). The environmental clade comprised the saprophytic species S. mexicana (Clade IV) and S. pallida (Clade V). The species O. stenoceras represented a separate clade, statistically supported (99% bootstrap), distinct from clades of the pathogenic (clades I III and VI) and saprophytic (clades IV and V) species of Sporothrix evaluated in this study (Fig. 1). Using the phenotypic key features for Sporothrix species differentiation [18,19] and the partial CAL sequences, we identified three Brazilian isolates of S. mexicana (Ss131, Ss132, Ss133) and three isolates of S. globosa (Ss06, Ss41, Ss49) among the strains analyzed. Isolates Ss06, Ss41, and Ss49 clustered with S. globosa reference strains in clade III, whereas isolates Ss131, Ss132, and Ss133 clustered with S. mexicana reference strains from clade IV, with both clades supported by high bootstrap values. A GenBank search using the CAL sequence as a query revealed that our three S. globosa isolates showed a % identity with the CAL sequences of the type strain of S. globosa (AM ). Carbohydrate assimilation tests revealed that all S. globosa isolates assimilated sucrose, glucose, and ribitol, but not raffinose. Similar macroscopic and microscopic morphologies were observed among our three S. globosa (Fig. 2(A), 2(B)) and the S. globosa reference strains, CBS and FMR BLAST searches of the Brazilian S. mexicana isolates showed a 100% match with the CAL sequence of the type strain of this species (GenBank AM ). Among the six isolates which have been classified as S. mexicana up to now, only two CAL haplotypes (Hd 0.33) were found with low nucleotide diversity (pi 0.001). The first haplotype included the isolates Ss131, Ss132, Ss133, CBS and CBS from South and North America, while the European isolate MUM constituted a second haplotype. Brazilian isolates were obtained from human cases of sporotrichosis, i.e., isolate Ss132, deposited in 1977, from a patient in the southern region of Brazil, and two isolates were obtained from patients who lived in northeastern Brazil (Ss131, deposited in 1958, and Ss133, deposited in 1955). Ss133 showed an atypical carbohydrate assimilation profile as it did not assimilate

5 Emergence of pathogenicity in the Sporothrix schenckii complex 409 Fig. 1 Phylogenetic relationships of Sporothrix schenckii complex isolates inferred from CAL sequences by Maximum Likelihood method based on the Kimura 2-parameter model. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (1000 replicates) is shown next to the branches (Bootstrap support values 80 are indicated in bold). GenBank accessions numbers are indicated next to strain code. raffinose, while the other two isolates showed patterns identical to those of the reference strains. All S. mexicana strains were positive for sucrose and ribitol. Macroscopic and microscopic morphologies of all isolates were in agreement with those of S. mexicana reference strains, CBS and CBS (Fig. 2(C), 2(D)). The main phenotypic features of S. mexicana and S. globosa isolates are described in Table 2. Discussion Recently, Marimon et al. [17 19] demonstrated that clinical isolates of S. schenckii constitute a complex of several cryptic species. Since 2007, three isolates of S. mexicana have been recovered from the environment in Mexico and Australia [18,22], while only one was obtained from samples of a human case in Portugal [22].

6 410 Rodrigues et al. Fig. 2 Macroscopic and microscopic morphologies of two Sporothrix species. (A) Colonies of Sporothrix globosa (CBS / Ss49) and (C) S. mexicana (CBS / Ss132) in PDA medium after 21 days of incubation at 30 C. (B) Microcultures of S. globosa (CBS / Ss49) and (D) S. mexicana (CBS / Ss132) 1000 (Bar 3 μm). Sporothrix globosa has been recovered from clinical specimens in Europe, America, and Asia [18,24,25] and this species demonstrated low virulence in animal models [33]. Sporothrix brasiliensis has been described as an emerging species, highly pathogenic to humans and animals and with a regional distribution in Brazil [16,18,23,33]. A clinical isolate of S. luriei was described in Africa [19] and a second human case was histopathologically diagnosed in India without the recovery of the etiologic agent [34]. A third report of S. luriei involving a case of canine sporotrichosis was described in Brazil [35] and has been found to be pathogenic in a murine model [36]. However, no environmental isolates have been described in the literature. Sporothrix schenckii s. str. has a wide geographical distribution being identified with certainty in the Americas (USA, Brazil, Peru, Argentina, Venezuela, Colombia, Bolivia, Guatemala, Mexico), Europe (France, Italy, UK), Africa (South Africa), and Asia (Japan) [18,23,24,30]. Due to the lack of studies using the new proposed taxonomy it is difficult to establish new areas in which it occurs. S. schenckii s.str. and S. brasiliensis are considered to have a higher Table 2 Phenotypic characteristics, geographical and clinical origins of the Brazilian Sporothrix globosa and S. mexicana isolates. Isolate Sporothrix species Origin and clinical form Brazilian region and year of isolation Mean colony diameter (mm) SD At 21 days Assimilation 30 C 35 C 37 C Raf Rib Sac Sessil conidial morphology (Shape) CBS /Ss06 S. globosa Human, LC Minas Gerais (2002) RG RG globose CBS /Ss41 S. globosa Human, FC Ceará (2002) RG RG globose CBS /Ss49 S. globosa Human, LC Goiás (2004) RG RG globose CBS /Ss131 S. mexicana Human, NK Pernambuco (1958) RG ellipsoidal CBS /Ss132 S. mexicana Human, NK S ã o Paulo (1977) RG RG ellipsoidal CBS /Ss133 S. mexicana Human, NK Pernambuco (1955) RG ellipsoidal Raf, Raffinose; Rib, Ribitol; Sac, Saccharose; NK, not known; LC, Lymphocutaneous; FC, Fixed cutaneous; RG, restricted growth ( 5 mm).

7 Emergence of pathogenicity in the Sporothrix schenckii complex 411 virulence potential for humans [33] than other species in the complex. Thus, frequency, distribution and virulence of Sporothrix species vary dramatically among species (Table 1). The three clinical S. mexicana isolates included in our study were discovered in fungal collections where they had been maintained as S. schenckii since 1955, suggesting that it has been present in Brazil for a long time. Unfortunately, we were unable to retrieve detailed clinical data. According to de Meyer et al. [20] and Marimon et al. [18], S. mexicana is a saprophytic soil-borne species and Arrillaga-Moncrieff et al. [33] reported that it showed low or no virulence in an animal model. The species has been reported to have restricted growth at 37 C [18]. In general, environmental species of the genus Sporothrix tend to grow poorly at temperatures above 30 C [37]. The three S. globosa isolates identified in our collection were more recent in origin having been recovered from human cases of sporotrichosis in 2002 and The first human case of sporotrichosis due to S. globosa in Brazil was recently described by Oliveira et al. [23]. However, Marimon et al. [18] and Madrid et al. [24] reported clinical strains from Spain, UK, Japan, Italy, the USA, India, Colombia, Guatemala and Mexico, but clinical details were lacking. For the most part, the morphological and physiological features of our three S. globosa isolates matched those in the original description of the species [18]. However, we found some phenotypic variations concerning the Brazilian S. mexicana isolates identified in this study. The discrepancies included growth rates on PDA at 30 C and the carbohydrate assimilation profile. Isolate Ss133 presented an atypical physiological profile in that it was unable to assimilate raffinose as the sole source of carbon. Following the dichotomous key proposed by Marimon et al. [19], isolate Ss133 would have been identified as S. schenckii or S. globosa. On the other hand, this isolate did not show a radial growth of more than 50 mm at 21 days of incubation at 30 C, which is considered an important phenotypic characteristic for the differentiation of S. mexicana. These results may indicate a phenotypic variability among isolates of S. mexicana. Given these morphological and physiological divergences, the CAL sequence data are considered to be more reliable for identification of Sporothrix species. We found concordance between the results of our phylogenetic analysis and those of previously published studies [17 19,24,30]. The Maximum Likelihood analysis revealed seven major clades, all statistically supported with high bootstrap values. According to Marimon et al. [18], clades I III are composed of clinical isolates of Sporothrix, whereas clades IV and V represent the environmental isolates. Clade VI consists of S. luriei isolate ATCC [19]. Despite its low incidence, the dimorphic fungus S. mexicana can be considered pathogenic for humans. Marimon et al. [38] demonstrated that this species is resistant to the antifungals itraconazole, posaconazole, voriconazole and amphotericin B, while S. brasiliensis showed the best response to these antifungals. The occurrence of S. mexicana in South America and the global distribution of S. globosa, as well as their differential virulence are of importance in understanding their prevalence and possible routes of infection. In the present study we included in our phylogenetic analysis CAL sequences from the saprophytic fungus O. stenoceras. For a long time, environmental strains of this species were considered to be the sexual stage of S. schenckii [37,39 41]. However, de Beer et al. [42] using internal transcribed spacer (ITS) region sequences reported that this anamorph-teleomorph connection was erroneous. We confirmed, using CAL sequences from a large set of pathogenic and environmental species belonging to the S. schenckii complex, that the fungus O. stenoceras (producing a Sporothrix anamorph in culture) is indeed distinct from S. brasiliensis, S. schenckii, S. globosa, S. mexicana and S. pallida. At the moment, the question of the teleomorph of the pathogenic species of the Sporothrix schenckii complex remains an enigma. Acknowledgements We are grateful to Dr Josep Guarro and Dr Josepa Gen é, from the Universitat Rovira i Virgili (Facultat de Medicina i Ci è ncies de la Salut) in Reus, Spain, for supplying strains. Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper. AMR is a fellow and acknowledges the financial support of the Funda ç ã o de Amparo à Pesquisa do Estado de S ã o Paulo (FAPESP / ) and Coordena ç ã o de Aperfei ç oamento de Pessoal de N í vel Superior (BEX 2325/11-0). This work was supported in part by grants from FAPESP (2009/ ), CNPq, and CAPES. References 1 Mackinnon J, Conti-Diaz I, Gezuele E, et al. Isolation of Sporothrix schenckii from nature and considerations on its pathogenicity and ecology. Sabouraudia 1969 ; 7 : Rippon JW. Medical Mycology : The Pathogenic Fungi and Pathogenic Actinomycetes, 3rd ed. Philadelphia, PA: WB Saunders Company, Kauffman CA. Sporotrichosis. Clin Infect Dis 1999 ; 29 : Zhou X, de Beer ZW, Wingfield MJ. DNA sequence comparisons of Ophiostoma spp., including Ophiostoma aurorae sp. nov., associated

8 412 Rodrigues et al. with pine bark beetles in South Africa. Stud Mycol 2006 ; 55 : Roets F, Wingfield BD, de Beer ZW, Wingfield MJ, Dreyer LL. Two new Ophiostoma species from Protea caffra in Zambia. Persoonia 2010 ; 24 : Pappas PG, Tellez I, Deep AE, et al. Sporotrichosis in Peru: description of an area of hyperendemicity. Clin Infect Dis 2000 ; 30 : Lyon GM, Zurita S, Casquero J, et al. Population-based surveillance and a case-control study of risk factors for endemic lymphocutaneous sporotrichosis in Peru. Clin Infect Dis 2003 ; 36 : Kovarik CL, Neyra E, Bustamante B. Evaluation of cats as the source of endemic sporotrichosis in Peru. Med Mycol 2008 ; 46 : Barros MLB, Schubach AO, Francesconi-do-Valle AC, et al. Cat-transmitted sporotrichosis epidemic in Rio de Janeiro, Brazil: description of a series of cases. Clin Infect Dis 2004 ; 38 : Schubach TMP, Schubach A, Okamoto T, et al. Evaluation of an epidemic of sporotrichosis in cats: 347 cases ( ). J Am Vet Med Assoc 2004 ; 224 : Rosa ACM, Scroferneker ML, Vettorato R, et al. Epidemiology of sporotrichosis: a study of 304 cases in Brazil. J Am Acad Dermatol 2005 ; 52 : Schubach TMP, Schubach A, Okamoto T, et al. Canine sporotrichosis in Rio de Janeiro, Brazil: clinical presentation, laboratory diagnosis and therapeutic response in 44 cases ( ). Med Mycol 2006 ; 44 : Lopes-Bezerra LM, Schubach A, Costa RO. Sporothrix schenckii and sporotrichosis. An Acad Bras Ci ê nc 2006 ; 78 : Barros MBL, Schubach TP, Coll JO, et al. Sporotrichosis: development and challenges of an epidemic. Rev Panam Salud Publica 2010 ; 27 : [in Portuguese]. 15 Madrid IM, Mattei AS, Fernandes CG, Nobre MO, Meireles, MCA. Epidemiological findings and laboratory evaluation of sporotrichosis: a description of 103 cases in cats and dogs in southern Brazil. Mycopathologia 2012 ; 173 : Silva-Vergara, ML, Camargo, ZP, Silva PF, et al. Disseminated Sporothrix brasiliensis infection with endocardial and ocular involvement in an HIV-infected patient. Am J Trop Med Hyg 2012 ; 86 : Marimon R, Gené J, Cano J, et al. Molecular phylogeny of Sporothrix schenckii. J Clin Microbiol 2006 ; 44 : Marimon R, Cano J, Gené J, et al. Sporothrix brasiliensis, S. globosa, and S. mexicana, three new Sporothrix species of clinical interest. J Clin Microbiol 2007 ; 45 : Marimon R, Gené J, Cano J, Guarro J. Sporothrix luriei : a rare fungus from clinical origin. Med Mycol 2008 ; 46 : de Meyer EM, de Beer ZW, Summerbell RC, et al. Taxonomy and phylogeny of new wood- and soil-inhabiting Sporothrix species in the Ophiostoma stenoceras-sporothrix schenckii complex. Mycologia 2008 ; 100 : Madrid H, Gené J, Cano J, et al. Sporothrix brunneoviolacea and Sporothrix dimorphospora, two new members of the Ophiostoma stenoceras-sporothrix schenckii complex. Mycologia 2010 ; 102 : Dias NM, Oliveira MM, Santos C, et al. Sporotrichosis caused by Sporothrix mexicana, Portugal. Emerg Infect Dis 2011 ; 17 : Oliveira MM, Almeida-Paes R, Muniz MM, et al. Phenotypic and molecular identification of Sporothrix isolates from an epidemic area of sporotrichosis in Brazil. Mycopathologia 2011 ; 172 : Madrid H, Cano J, Gené J, et al Sporothrix globosa, a pathogenic fungus with widespread geographical distribution. Rev Iberoam Micol 2009; 26 : Oliveira MME, Almeida-Paes R, Muniz MM, et al. Sporotrichosis caused by Sporothrix globosa in Rio de Janeiro, Brazil: case report. Mycopathologia 2009 ; 169 : O Donnell K, Niremberg HL, Aoki T, Cigelnik E. A multigene phylogeny of the Gibberella fujikuroi species complex: detection of additional phylogetically distinct species. Mycoscience 2000 ; 41 : Duong TA, de Beer ZW, Wingfield BD, Wingfield MJ. Phylogeny and taxonomy of species in the Grosmannia serpens complex. Mycologia 2012 ; 104 : Thompson, JD, Higgins, DG, Gibson, TJ. Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994 ; 22 : Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 1999 ; 41 : Romeo O, Scordino F, Criseo G. New insight into molecular phylogeny and epidemiology of Sporothrix schenckii species complex based on calmodulin-encoding gene analysis of Italian isolates. Mycopathologia 2011 ; 172 : Tamura K, Peterson D, Peterson N, et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evo 2011 ; 28 : Kimura M. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J Mol Evol 1980 ; 16 : Arrillaga-Moncrieff I, Capilla J, Mayayo E, et al. Different virulence levels of the species of Sporothrix in a murine model. Clin Microbiol Infect 2009 ; 15 : Padhye AA, Kaufman L, Durry E, et al. Fatal pulmonary sporotrichosis caused by Sporothrix schenckii var. luriei in India. J Clin Microbiol 1992 ; 30 : Oliveira CO, Lopes PGM, Spader TB, et al. Susceptibilities to antifungal agents of Sporothrix albicans, S. brasiliensis and S. luriei of the S. schenckii complex identified in Brazil. J Clin Microbiol 2011 ; 49 : Fernández-Silva F, Capilla J, Mayayo E, Guarro J. Virulence of Sporothrix luriei in a murine model of disseminated infection. Mycopathologia 2012 ; 173 : de Hoog GS. The genera Blastobotrys, Sporothrix, Calcarisporium and Calcarisporiella gen. Stud Mycol 1974 ; 7 : Marimon R, Serena C., Gené J, et al. In vitro antifungal susceptibilities of five species of Sporothrix. Antimicrob Agents Chemother 2008 ; 52 : Taylor JJ. A comparison of some Ceratocystis species with Sporothrix schenckii. Mycopath Mycol Appl 1970 ; 42 : Mariat F. Adaptation of Ceratocystis to a parasitic life in animals acquisition of a pathogenicity comparable to Sporothrix schenckii. Sabouraudia 1971 ; 9 : [in French]. 41 Nicot J, Mariat F. Morphological characteristics and systematic position of Sporothrix schenkii, the causative agent of human sporotrichosis. Mycopathol Mycol Appl 1973 ; 49 : [in French]. 42 de Beer ZW, Harrington TC, Vismer HF, et al. Phylogeny of the Ophiostoma stenoceras-sporothrix schenckii complex. Mycologia 2003 ; 95 : This paper was first published online on Early Online on 21 September 2012.