DOKTORSKA DISERTACIJA

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "DOKTORSKA DISERTACIJA"

Transcription

1 DOKTORSKA DISERTACIJA MOLEKULARNE SPREMEMBE IN FARMAKOGENOMSKI OZNAČEVALCI ZA ZDRAVLJENJE CROHNOVE BOLEZNI Z MONOKLONSKIMI PROTITELESI ZA INHIBICIJO TNF-α Maj, 2015 Silvo Koder

2 DOKTORSKA DISERTACIJA MOLEKULARNE SPREMEMBE IN FARMAKOGENOMSKI OZNAČEVALCI ZA ZDRAVLJENJE CROHNOVE BOLEZNI Z MONOKLONSKIMI PROTITELESI ZA INHIBICIJO TNF-α Maj, 2015 Silvo Koder Mentor: red. prof. dr. Uroš Potočnik dipl. inž. kem Somentorja: prof. dr. Ivan Ferkolj dr. med. in red. prof. dr. Pavel Skok dr. med.

3 ZAHVALA Mentorju prof. dr. Urošu Potočniku se zahvaljujem za spodbudo, nasvete, pomoč pri zasnovi in izdelavi doktorske disertacije. Zahvaljujem se somentorjema prof. dr. Ivanu Ferkolju in ostalemu osebju Gastroenterološke klinike Ljubljana, prof. dr. Pavlu Skoku, Cvetki Pernat in ostalemu osebju oddelka za gastroenterologijo in endoskopijo interne klinike UKC Maribor, osebju oddelka za laboratorijsko diagnostiko UKC Maribor in dr. Katji Repnik in ostalim sodelavcem iz Centra za humano molekularno genetiko in farmakogenomiko Medicinske fakultete v Maribor.

4 KAZALO VSEBINE 1. UVOD Kronična vnetna črevesna bolezen Crohnova bolezen Klinična slika Diagnostika Zdravljenje Crohnove bolezni Klinične študije in uspešnost zdravljenja Crohnove bolezni z adalimumabom Genetika KVČB Farmakogenetika adalimumaba NAMEN RAZISKAVE IN HIPOTEZE PREISKOVANCI IN METODE DELA Preiskovanci Odmerjanje ADA Odziv na terapijo Odvzem krvnih vzorcev in vzorcev tkiv za izolacijo DNA/RNA/proteinov Genotipizacija izbranih polimorfizmov SNP Merjenje izražanje izbranih genov z verižno reakcijo s polimerazo v realnem času (qpcr) Statistična analiza REZULTATI Učinkovitost zdravljenja z ADA Vzporedna terapija Neželeni učinki Klinične značilnosti bolnikov s CB in povezava teh značilnosti z genotipi izbranih polimorfizmov SNP ter odzivom na zdravljenjem z ADA Povezava kliničnih značilnosti z genotipi izbranih polimorfizmov SNP - opis statistično signifikantnih povezav Povezava kliničnih značilnosti z biološkim in kliničnim odgovorom na zdravljenje z ADA - opis statistično signifikantnih povezav... 51

5 4.4. Povezava med izbranimi polimorfizmi SNP in biološkim ter kliničnim odzivom na zdravljenje Povezava med polimorfizmom SNP rs (ATG16L1) in odgovorom na zdravljenje Povezava med polimorfizmom SNP rs (blizu gena PTGER4) in odgovorom na zdravljenje Povezave med ostalimi polimorfizmi SNP in biološkim ter kliničnim odgovorom na zdravljenje Povezave med izražanjem izbranih genov in biološkim ter kliničnim odgovorom na zdravljenje Povezave med biokemijskimi parametri in biološkim ter kliničnim odgovorom na zdravljenje RAZPRAVA ZAKLJUČEK LITERATURA ČLANEK, VEZAN NA TEMO DOKTORSKE DISERTACIJE PRILOGE ŽIVLJENJEPIS

6 POVZETEK Kronična vnetna črevesna bolezen (KVČB) je kompleksna bolezen in se pojavlja v dveh podtipih, kot Crohnova bolezen (CB) in ulcerozni kolitis (UK). CB lahko prizadene celoten prebavni trakt, medtem ko UC prizadene skoraj izključno danko in debelo črevo. Na potek in razvoj bolezni pomembno vplivajo tako okoljski dejavniki kot tudi genetska zasnova posameznika. Asociacijske študije na celotnem genomu (GWA študije) so do danes identificirale 163 lokusov na človeškem genomu, ki so povezani z nastankom KVČB. Zdravljenje KVČB poteka v več stopnjah. Navadno začnemo z aminosalicilati, nadaljujemo s kortikosteroidi in imunosupresivi. Če zdravljenje s standardno terapijo ni uspešno, pa si v zadnjem času pomagamo z biološkimi zdravili in sicer zaviralci provnetnega citokina TNF-α, katerih prva predstavnika sta infliksimab (IFX) in adalimumab (ADA). Terapija z zaviralci TNF-α je naredila izjemen napredek v zdravljenju ne samo CB, ampak tudi ostalih oblik KVČB. V naši študiji smo se osredotočili na zdravljenje bolnikov s CB z adalimumabom (ADA). ADA je humano monoklonsko protitelo. Z odmerjanjem vsaki drugi teden dosegamo zelo dober odziv, v indukcijski kot tudi vzdrževalni terapiji, z zelo solidnim procentom bolnikov v remisiji, vendar se kljub temu približno tretjina bolnikov ne odziva na terapijo z zaviralci TNF-α. Cilj naloge je bil izvesti prospektivno farmakogenetsko raziskavo, pri čemer bi odkrili genetske biooznačevalce, s katerimi bi lahko vnaprej napovedali, kakšen bo izid zdravljenja z ADA pri posameznem bolniku. Dodatno smo želeli ugotoviti ali obstaja povezava med odzivom na terapijo z ADA in izražanjem genov pri bolnikih s CB, pri čemer smo ugotovili, da prav tako izstopa gen ATG16L1, pri katerem se je izražanje statistično značilno spreminjalo skozi celotno obdobje zdravljenja. Prav tako smo v nalogi analizirali potencialne povezave med imunološkimi, biokemijskimi in hematološkimi parametri. V študijo smo zajeli 102 bolnika s CB. Bolnike smo spremljali tako, da smo jim pred terapijo ter po 4., 12., 20., in 30. tednu odvzeli kri, izmerili vrednost C-reaktivnega proteina (CRP) kot pokazatelja vnetja ter ovrednotili uspešnost zdravljenja z IBDQ vprašalnikom, ki poleg vprašanj kliničnega značaja zelo dobro odraža psihološko stanje in počutje bolnika. Glede na število točk IBDQ vprašalnika smo ovrednotili uspešnost terapije, tako da je število nad 170 ali relativni dvig IBDQ za 22 točk pomenilo remisijo. Uspešnost terapije smo ovrednotili tudi z vrednostjo CRP in sicer smo menili, da je terapija uspešna, v kolikor se je CRP zmanjšal za 25% glede na začetno stanje pred zdravljenjem oz. je CRP dosegel normalne vrednosti. DNA polimorfizme posameznega nukleotida (SNP) in kandidatne gene smo izbrali po sledečih kriterijih: SNP-ji, močno povezani s KVČB v posameznih kandidatnih študijah, SNP-ji, ki so jih potrdile GWA študije za KVČB, ter SNP-ji, ki so bili v predhodnih študijah povezani z odzivom na IFX. Skupno smo genotipizirali 33 izbranih SNP-jev in izmerili izražanje 5 genov, predhodno povezanih s KVČB ter primerjali genotipe izbranih SNP-jev in nivo izražanja genov z

7 odzivom na zdravljenje z ADA. Gensko tipizacijo polimorfizmov SNP v izbranih genih/lokusih smo izvajali z metodo analize talilnih krivulj visoke ločljivosti (HRM, ang. high resolution melting) in tehniko polimorfizmov dolžin restrikcijskih fragmentov (RFLP, ang. restriction fragment length polymorphism). Ugotovili smo, da je bil pozitivni odziv na zdravljenje z ADA merjen z IBDQ po 4 tednih pri 62.9% bolnikov, po 12 tednih 68%, po 20 tednih 66% in po 30 tednih 71%. V primeru merjenja odziva z CRP pa je imelo po 4 tednih pozitivni odziv 82,6% bolnikov, po 12 tednih 71,9%, po 20 tednih 72,7% in po 30 tednih 72,5% bolnikov. Najmočnejšo povezavo smo našli med polimorfizmom SNP rs v genu ATG16L1 in biološkim odgovorom na terapijo z ADA, merjenim s CRP, pri čemer so imeli bolniki z genotipom TT boljši odgovor po 12, 20 in 30 tednih zdravljenja v primerjavi z bolniki z genotipom CC (p=8.11e-04, p (po korekciji za multiplo testiranje = 0,027)). Nadalje smo močno povezavo odkrili med polimorfizmom SNP rs , ki je lociran v genski puščavi na kromosomu 5p13.1 in za katerega je bilo dokazano, da vpliva na izražanje gena PTGER4 ter odgovorom na ADA, pri čemer so imeli bolniki z genotipom GG boljši odgovor v primerjavi z bolniki z genotipom AA po 12 tednih zdravljenja (p=4.62e-03). Ostale statistično najbolj značilne povezave smo ugotovili med SNP-ji v genih CASP9, IL27, CCNY, C11orf30, NR1I2 in IL13 ter odzivom na zdravljenje z ADA. V skladu s predhodnimi kliničnimi študijami smo tudi v naši študiji potrdili povezavo med nekaterimi kliničnimi značilnostmi bolnikov in odzivom na zdravljenje. Bolniki, ki predhodno še niso bili zdravljeni z IFX, so se signifikantno boljše odzvali na terapijo. Glede vzporedne terapije s standardnimi zdravili nismo našli značilnih povezav z odzivom na zdravljenje. Boljši odziv na zdravljenje smo opazili pri bolnikih, ki so bili predhodno kirurško zdravljeni. In boljši odziv na terapijo je bil opažen tudi pri nekadilcih. Bolniki, ki so bili ob postavitvi diagnoze mlajši, so se na terapijo boljše odzivali. Rezultati naše študije kažejo, da je odziv na zdravljenje z ADA deloma genetsko pogojen s polimorfizmi SNP, povezanimi z nastankom CB, pri čemer se je kot najbolj obetaven kandidatni gen za odgovor na zdravljenje z ADA izkazal gen ATG16L1. Glede na to, da smo našli številne povezave z drugimi polimorfizmi SNP ter odgovorom na ADA, bodo v prihodnje potrebne nadaljnje farmakogenetske študije, ki bi te povezave potrdile na večjem številu bolnikov s CB s ciljem razviti molekularne biološke označevalce in napovedne modele, s katerimi bi lahko načrtovali individualizirano zdravljenje bolnikov. Ključne besede: kronična vnetna črevesna bolezen, Crohnova bolezen, polimorfizem posameznega nukleotida, adalimumab, farmakogenomika, biooznačevalci

8 MOLECULAR CHANGES AND PHARMACOGENOMIC BIOMARKERS FOR CROHN DISEASE TREATMENT USING MONOCLONAL ANTIBODIES AGAINST TNFα ABSTRACT The inflammatory bowel disease (IBD) is a complex disease which occurs in two subtypes - Crohn's disease (CD) and ulcerative colitis (UC). CD may affect any part of the gastrointestinal tract and UC, in contrast, is almost exclusively restricted to the colon and the rectum. The disease course and development are caused by a combination of environmental and genetic factors. Until now genome wide association studies (GWAS) discovered 163 IBD risk loci. The approach to treatment of IBD is stepwise. Initially we introduce aminosalicylates, followed by corticosteroids and immunosuppressants in monotherapy or in combination. If the treatment is not successful, biologics are the next option, e.g. inhibitors of proinflammatory cytokine tumor necrosis factor alpha (TNF-α). The first two representatives of this group of drugs are infliximab (IFX) and adalumumab (ADA). The therapy with TNF-α inhibitors has made an exceptional progress in treatment of not only CD but also other forms of IBD. In our study we focused on ADA therapy in CD patients. ADA is a fully human monoclonal antibody against TNF-α. Induction and maintenance therapy with ADA every other week achieves a very good response and a solid percentage of patients in remission. But still approximately a third of the patients do not respond to therapy with THF-α inhibitors. The aim of this research project was to carry out a prospective pharmacogenetic study, with the attempt to discover genetic biomarkers that could be able to predict treatment outcomes with TNF-α in an individual patient. In the study we enrolled 102 patients with CD. Before and after week 4., 12., 20., and 30. of the treatment we collected blood samples, measured CRP as a marker of inflammation, and evaluated treatment success with the IBDQ questionnaire, which in addition to the clinical status also includes quality of life aspects. Cutoff IBDQ values of >170 points or an increase for 22 points indicated remission. We also considered treatment as successful if the CRP dropped by 25% as compared to baseline value or if it was lowered bellow 3 mg/l. Single nucleotide polymorphisms (SNPs) were chosen based on the following criteria: SNPs strongly correlated with IBD in candidate gene studies; SNPs identified by GWAS in IBD; and SNPs associated with response to IFX. In total, we genotyped 33 SNPs and measured expression of 5 genes, which were correlated with IBD in previous studies, we also compared genotypes of these SNPs with gene expression regarding response to ADA therapy.

9 After 30 weeks more than 70% of patients responded to therapy with respect to both criteria (71.1% based on IBDQ and 72.5% based on biologic response - CRP). Regarding CRP 82.6% of patients had a positive response after 4 weeks, and after 30 weeks of therapy the response was positive in 72.5% of patients. The strongest correlation was found between SNP rs (ATG16L1 gene) and biologic response measured with CRP: patients with TT genotype had a better response after weeks 12., 20., and 30. compared to patients with CC genotype (p=8,11e-04). Another strong correlation found was between SNP rs , that is located in a gene dessert on chromosome 5p13.1 and has an impact on PTGER4 expression, and response to therapy with ADA - patients with GG genotype had a better response compared to patients with AA genotype after 12 weeks of treatment (p=4,62e-03). Other statistically the most significant correlations were found between response to therapy with ADA and SNPs in genes CASP9, IL27, CCNY, C11orf30, NR1I2 and IL13. Additionally, we wanted to determine whether there is a correlation between response to treatment with ADA and gene expression in patients with CD, where we found that ATG16L1 gene stands out again. The expression of ATG16L1 significantly changed during the whole treatment time. In the study we also analyzed potential links between immunological, biochemical and hematological parameters, but we did not find statistically significant correlations. The results of our study suggest that the response to treatment with ADA is partly genetically determined by SNPs associated with CD susceptibility and as the most promising candidate gene ATG16L1 was demonstrated. Given that we have found a number of correlations between SNPs and treatment response, further pharmacogenetic studies on a larger number of patients with CD are needed to develop molecular biomarkers and predictive models in order to plan individualized therapy regimes. Key words: inflammatory bowel disease, Crohn s disase, single nucleotide polymorphism, adalimumab, pharmacogenomics, biomarkers UDK klasifikacija: :577.1/.2:615.01/.3(043.3)

10 1. UVOD 1.1. Kronična vnetna črevesna bolezen Značilnost pogostih bolezni je, da so multifaktorske, kar pomeni, da poleg genetskih dejavnikov na njihov nastanek vplivajo tudi okoljski dejavniki. Vzorec večfaktorskega dedovanja predstavlja interakcijo med skupnim vplivov genotipa enega ali bolj verjetno večih lokusov (poligenski ali multigenski vpliv), ki ali povečujejo ali znižujejo dovzetnost na nastanek bolezni, v kombinaciji z izpostavljenostjo različnim okoljskim dejavnikom, ki sprožijo, pospešijo, zaostrujejo ali zaščitijo pred boleznijo. Med takšne bolezni uvrščamo tudi Crohnovo bolezen (CB) kot eno od različic kronične vnetne črevesne bolezni (KVČB), ki je rezultat odgovora na črevesne mikrobe pri genetsko pogojenem posamezniku. 1 Znano je, da imajo genetski dejavniki pomembo vlogo pri nastajanju in poteku številnih pogostih boleznih in da identifikacija genetskih dejavnikov za takšne bolezni daje možnost, da dobimo boljši vpogled odkrivanja in patogeneze bolezni ter diagnosticiranja in zdravljenja bolezni. Razkrijejo se lahko nove strategije in tarče za zdravljenje. Prav takšen farmakogenomski pristop je značilen tudi za našo raziskavo, saj vemo, da je tudi pri KVČB oziroma pri njenih najpogostejših izraznih oblikah, kot sta ulcerozni kolitis (UK) in CB nedvomno, da ima genetika poleg okoljskih dejavnikov zelo pomembno vlogo. Zato poskušamo najti dejavnike oz. biooznačevalce, s katerimi bi olajšali odkrivanje, diagnosticiranje in zdravljenje te bolezni Crohnova bolezen KVČB je kompleksna poligenska avtoimuna bolezen prebavil in lahko prizadene celoten prebavni trakt od ust pa do rektuma. To je vseživljenjska bolezen, z minimalno umrljivostjo, vendar s trajnimi simptomi, ki lahko vodijo do socialne in psihološke obolevnosti (5). Pojavi se največkrat že v mladostni dobi kot posledica vnetnega odgovora na mikroorganizme pri gostitelju, ki je genetsko dovzeten. Najpogosteje se pojavlja v dveh oblikah, kot CB in kot UK % primerov pa ne moremo uvrstiti v ne eno ne drugo skupino, takrat pa govorimo o intermedialnem kolitisu (IK). Navadno se kaže v obliki akutnih zagonov z driskami, bolečega abdomna in krvavitev v prebavnem traktu.

11 Pojavljajo se obdobja vmesnih remisij, ki lahko trajajo več let ali celo desetletij. Za KVČB zboli v Sloveniji vsak petstoti prebivalec, v zadnjih petih letih so registrirali več kot 1000 novih primerov. V Evropi je letna pojavnost UK 5 za CB pa 0,2 promilna. Zastopanost spolov je približno enaka. 2 Za bolnike je značilno, da zelo različno odgovarjajo na zdravila, zato zdravljenje poteka v več stopnjah z enotnim ciljem obvladati zagone bolezni in doseči čim daljšo remisijo. Pri bolnikih se zdravila postopoma uvajajo ter se, če niso učinkovita ali pa se pojavijo resni neželeni učinki, zamenjajo. Večja pojavnost bolezni je v razvitih deželah, kjer tudi vztrajno narašča. CB je poleg UK ena izmed pojavnih oblik KVČB, ki lahko prizadene celoten prebavni trakt. Njeni klinični znaki so odvisni od lokacije vnetja v prebavnem traktu in razširjenosti bolezni. Bolezenski proces lahko zajame vse dele prebavne cevi, vendar je bolezen redka v zgornjih prebavilih, najpogosteje pa sta prizadeta terminalni ileum in/ali debelo črevo, kar se kaže kot terminalni ileitis ali enterokolitis, medtem ko je prizadetost samo zgornjih prebavil zelo redka. Bolezen se najpogosteje pojavi v obdobju starosti od 14 do 30 let, redkeje pa zanjo obolevajo ljudje v kasnejših starostnih obdobjih. Pri polovici bolnikov se pojavijo komplikacije znotraj obdobja 20 let po diagnozi. Prav tako pride pri polovici bolnikov do potrebe po operaciji. Pri teh bolnikih obstoja okrog 50% tveganje, da bo ponovno prišlo do resnih zapletov in morebitne ponovne operacije. 3 Pri večini otrok in mladostnikov (50-70%) je prizadet terminalni del ileuma, kar je med prvimi pred 70 leti raziskoval tudi dr. Crohn, po katerem se bolezen danes tudi imenuje. Razmerje obolevnosti med spoloma je približno enako, le v otroški dobi in pri mladostnikih je pogostejša pri moških. V Sloveniji je približno 5000 bolnikov s CB. Spremembe na sluznici lahko potekajo kontinuirano, večinoma so pa značilni izmenjujoči se bolni in zdravi predeli. Pri približno 20% bolnikov je prizadeto debelo črevo, pri približno 35% je prizadet spodnji del tankega črevesa (ileum), pri približno 45% pa sta poškodovana tako spodnji del tankega črevesa, kot debelo črevo. 4-6 Vnetni proces lahko zajame vse sloje črevesne stene. Bolezen se začenja v globljih slojih črevesja vključno z mezenterijem in regionalnimi bezgavkami. V primeru, ko je zelo prizadeto tanko črevo, prihaja do malabsorpcije, ki ima za posledico ovirano absorpcijo hranilnih snovi in drugih esencialnih vitaminov in elementov. Pogoste so driske, ki jih spremljajo bolečine v trebuhu, posledično prihaja do izgube apetita in hujšanja. Pri osebah, ki zbolijo v otroški dobi, lahko prihaja do zaostanka v rasti in telesnem razvoju. Najpogostejši simptomi so kronična, velikokrat krvava driska, krčevite bolečine v trebuhu, izguba apetita, hujšanje in povišana telesna temperatura. Vnetje lahko vodi tudi do fistul, abscesov in celo do perforacij. Bolezen poteka v časovno zelo različno dolgo trajajočih zagonih in remisijah. V obdobjih remisije je bolnik praktično brez težav. Zaradi vnetja 3

12 mukozne plasti intestinalnega trakta prihaja do ulceracij, edemov, krvavitev in izgube tekočine ter elektrolitov. Napake v prirojenem imunskem sistemu omogočajo bakterijam invazijo na sluznico črevesa, kar povzroči pretiran adaptivni imunski odziv, ki vodi do obsežne poškodbe črevesja. 7 Etiopatogeneza je še predmet raziskav, saj natančen vzrok in potek bolezni še nista znana. Opredeljuje se kot avtoimunska bolezen s prispevkom okoljskih, imunoloških in genetskih faktorjev. Kot vnetni mediator ima TNF-α pomembno vlogo pri iniciaciji in propagaciji bolezni. Ostali dejavniki tveganja so še okoljski dejavniki, kajenje, odstranitev slepiča, prehrambne navade. 8, 9 Okoljski dejavniki imajo močan vpliv na področju severne Evrope in severne Amerike, manjša je v ostalih delih razvijajočega se sveta, vendar tudi tam počasi raste. Težko je razložiti, zakaj je v nerazvitem svetu manjša incidenca CB, vsekakor pa svoj pečat pustijo razlike v prehrani s svojim svojstvenim vplivom na črevesno floro. Prav tako bi naj vplivale na pojavnost tudi higienske navade posamezne populacije. Incidenca CB je najvišja v razvitih državah in najnižja v razvijajočih se državah. Ljudje, ki živijo v hladnejšem podnebju za boleznijo obolevajo pogosteje kot ljudje, ki živijo v toplem podnebju. 10 Kajenje je dodaten rizični faktor tako za nastanek CB, kot za njen potek. Prav tako prihaja pri kadilcih do pogostejših recidivov z potencialnimi zapleti, kar je bolj izraženo pri ženskah. Mehanizem teh povezav ni znan, vsekakor pa so ti vplivi kompleksni, tako poleg kajenja sodelujejo še drugi vplivi okolja in genetike Najbolj izražen vpliv kajenja se je pokazal pri Kavkazijcih. 14 V določenih študijah so ugotavljali vpliv odstranitve slepiča na potek in razvoj CB, 15, 16 vendar so študije pokazale zelo različne rezultate, 16, 17 tako ne moremo zagotovo trditi kakšen vpliv ima, medtem ko so za UK našli 18, 19 določene povezave. Prehrambne navade prav tako prinašajo svoj delež k nastanku CB. Iz raznih študij je razvidno, da je pogostnost bolezni večja v razvitem svetu in pri populacijah, ki na nek način hitro privzemajo nove, ne najbolj primerne načine prehranjevanja ter pri migracijskih populacijah. Vplivi gredo predvsem na račun vsebnosti mikroelementov, prisotnosti mikroorganizmov, raznih prehranskih aditivov, porastu hitro pripravljene in vnaprej pripravljene hrane, povečan vnos ogljikovih hidratov, predvsem sladkarij. Vplivi so pa lahko tudi od raznih zdravil, predvsem so na sumu nesteroidna protivnetna 20, 21 zdravila. Ljudje s CB imajo zanjo genetske predispozicije. Dogodek, ki sproži aktivacijo imunskega sistema še ni znan. Možni faktorji, povezani s tem dogodkom, vključujejo patogeni organizem, imunski odgovor na neki intraluminalni antigen (npr. protein iz kravjega mleka) ali avtoimunski proces. Številni patogeni (npr. Salmonella, Shigella sp., Campylobacter sp.) lahko sprožijo nastanek CB s tem, da izzovejo 4

13 vnetni odgovor, ki ga imunski sistem ne more obvladati. Vnetje lahko izzovejo tudi anaerobni mikroorganizmi, še posebej bakterije iz vrste Bacteroides, čeprav pa na drugi strani probiotiki (Lactobacillus sp.) zavirajo vnetje. 22 K poslabšanju simptomov lahko prispevajo tudi psihosocialni faktorji. Nepredvideni življenjski dogodki kot so bolezen ali smrt v družini, ločitev, medosebni konflikti, ipd. so povezani s poslabšanjem simptomov CB. Prihaja tudi do širšega socialnega problema, saj prihaja do utrujenosti, izčrpanosti in zaradi tega do odsotnosti z dela oziroma zmanjšane storilnosti na delovnem mestu Klinična slika Bolezenski simptomi so lahko različni in so odvisni predvsem od anatomske lokalizacije vnetja, njene intenzivnosti, zoževanja črevesne svetline in prehajanja vnetnega procesa na sosednje organe. Bolezen se najpogosteje začne z utrujenostjo (pogosto povezana z bolečino, vnetjem in anemijo), hujšanjem, rahlo povišano telesno temperaturo, driskami s primesjo krvi in sluzi ter z bolečinami v trebuhu, ki so lahko stalne ali v obliki krčev, odvisno od intenzivnosti vnetja in lokalizacije prizadetega predela. Bolečine so lahko kjerkoli v predelu trebuha, čeprav je klasična lokacija v spodnjem delu trebuha ali desnem spodnjem kvadrantu. Praviloma poteka kronično in le poredkoma ima akutni začetek (tedaj lahko pri vnetnih spremembah terminalnega ileuma oponaša akutni apendicitis). Bolezen se lahko začne tudi z lokalnimi zapleti: perianalno v obliki fisur, fistul ali abscesov. Prvi znaki bolezni so lahko tudi samo zunajčrevesni, simptomi s strani prebavil pa se pojavijo šele kasneje. Prav perianalne težave se pojavljajo pri polovici bolnikov. Fistule se pojavijo pri približno 40% bolnikov. Najpogosteje se pojavljajo perianalne fistule, lahko pa nastanejo tudi v tankem črevesu ter kolonu. Lahko jih zdravimo medikamentozno, kirurško ali kombinirano. Zelo uspešno je zapiranje fistul po zdravljenju z biološkimi zdravili Kadar bolezen prizadene končni del tankega črevesa, se poleg sistemskih znakov vnetja in bolečin pogosto pojavi ileocekalno tipen tumor. To je klasična oblika Crohnovega terminalnega ileitisa. Pri aktivni fazi CB v kolonu (Crohnov kolitis) je iztrebljanje pogostejše. V akutnih zagonih je blatu primešana sveža kri in sluz, zlasti kadar je prizadet tudi rektum. Kot posledica anemije lahko prihaja tahikardije. Vnetne spremembe v zgornjih prebavilih so lahko asimptomatske ali pa povzročajo disfagijo ali dispepsijo oz. simptome, ki so podobni sindromu duodenalnega ulkusa. Pri otrocih je lahko včasih edini opazen znak bolezni zaostajanje v rasti. 5

14 Slika 1: Endoskopska slika vnetja pri napredovani CB pseudopolipi, globoki ulkusi, tlakovan videz sluznice. Makroskopske spremembe na površini sluznice so zelo različne in so običajno odsev dogajanj v globljih plasteh stene prebavne cevi. V zgodnji fazi vidimo včasih le rdečkaste lehe in aftam podobne belkaste pege z rdečkastim robom, ki so posledica okvare sluznice nad hiperplastičnimi limfatičnimi folikli. Kasneje se lahko pojavi podoba tlakovane ceste zaradi nodularne hiperplazije sluznice in submukoze. Sluznica postane nepravilno zadebeljena, svetlina pa se zoži. Za bolezen so značilne nepravilne, vzdolžne, včasih zvezdaste in precej globoke srpaste ulceracije, ki lahko prodirajo v submukozo in mišični sloj. Značilno je, da te velike ulceracije zelo malo krvavijo. Patogenetsko so te velike ulceracije ishemične nekroze zaradi destrukcije žilja v globini črevesne srene. Tvorijo se tudi za CB značilne fisure, pogosti so še abscesi v črevesni steni in fistule med samimi črevesnimi vijugami oz. med svetlino vnetnega dela črevesa ter organi v okolici (koža, nožnica, sečni mehur). Med ulceracijami pogosto najdemo hiperplastične regenerate sluznice, ki dajejo sliko psevdolipoze. Za to bolezen so značilne zožitve prebavne cevi. Ker teče proces kroničnega vnetja s progresivno fibrozacijo primarno v mezodermalnem delu črevesa, lahko ta pogosto privede do popolne zapore. Mikroskopske spremembe se kažejo kot aftam podobne ulceracije in žariščni abscesi z rahlimi agregacijami makrofagov, ki tvorijo granulome v vseh plasteh črevesa. Granulome lahko najdemo v limfnih vozlih, mezenteriju, peritoneumu, jetrih in trebušni slinavki. Čeprav so granulomi patognomonična značilnost CB, jih z biopsijo mukoze le redko najdemo. Kirurške resekcije jih odkrijejo v približno 50%. Druge histološke značilnosti so še submukozni ali subserozni limfoidni agregati. Kožne spremembe se pojavljajo bolj poredko in so pretežno povezane s prizadetostjo debelega črevesa. Najpogostejši pojavni obliki sta nodozni eritem (pri 15% bolnikov) in gangrenozna pioderma. 6

15 Pri nodoznem eritemu napadi navadno sovpadajo s črevesno aktivnostjo, kožne lezije pa se razvijejo po začetku črevesnih simptomov. Bolniki imajo pogosto tudi sočasno aktivni periferni artritis. Gangrenozna pioderma se lahko razvije tudi leta pred začetkom črevesnih simptomov in poteka neodvisno od črevesnih simptomov. Lezije so najpogostejše na dorzalni strani stopal in nog, lahko pa se pojavljajo tudi na rokah, prsih, trebuhu in celo po obrazu. Periferni artritis se pojavi pri 15-20% bolnikov s CB in se poslabša skupaj s poslabšanjem črevesne aktivnosti. Je asimetričen, poliartikularen in migratoren, najpogosteje pa prizadene velike sklepe zgornjih in spodnjih okončin. 27 Ankilozirajoči spondilitis se pojavi pri približno desetini bolnikov. Najpogosteje prizadene hrbtenico in medenico. Simptomi zajemajo difuzno bolečino v spodnjem delu hrbta, bolečino v zadnjici in jutranjo okorelost. Incidenca očesnih zapletov je 1-10%. Najpogostejši so konjunktivitis, sprednji uveitis/iritis in episklerozitis. Hepatična steatoza je običajno posledica kroničnosti bolezni, slabe prehranjenosti in zdravljenja s kortikodsteroidi (KSi). Žolčni kamni so posledica malabsorpcije žolčnih kislin, ki vodi v zmanjšanje količine žolčnih soli in izločanja litogenega žolča. Za primarni sklerozni holangitis je značilno vnetje in fibroziranje žolčevodov. Pojavlja se pri 1-5% bolnikov s CB. Najpogostejši genitouretralni zapleti so kamni, obstrukcija sečevoda in fistule. Bolniki imajo povečano tveganje za tromboembolično bolezen, ki se kaže kot venska tromboza, pljučna embolija in arterijska embolija. Pri bolnikih se opaža povečana prevalenca osteoporoze in osteomalacije zaradi pomanjkanja vitamina D, malabsorpcije kalcija, malnutricije, uporabe glukokortikoidov in samega vnetja črevesa. Najpogostejše kardiopulmonalne manifestacije vključujejo endokarditis, miokarditis, pleuroperikarditis in intersticijsko pljučno bolezen. Bolniki z milo obliko CB imajo normalno plodnost. Lahko pride do brazgotinjenja jajcevoda zaradi vnetnega procesa, predvsem desnega, saj leži blizu terminalnega ileuma. Perirektalni, perianalni in rektovaginalni abscesi in fistule lahko vodijo do dispareunije. Do začasne neplodnosti lahko pride pri moških med uporabo sulfasalazina, ki pa izgine ob prenehanju uporabe zdravila. Klinična aktivnost Crohnove bolezni je neodvisna od anatomske lokacije in stopnje bolezni. Bolniki z remisijo imajo 42% verjetnost, da do relapsa ne bo prišlo v naslednjih 2 letih in samo 12% verjetnost, da do relapsa ne bo prišlo v naslednjih 10 letih. Pričakovana življenjska doba je v primerjavi z zdravimi ljudmi sicer krajša, vendar se večina bolnikov zelo dobro in uspešno spopada z boleznijo, z uvajanjem bioloških zdravil pa je to še uspešneje. 9 7

16 Diagnostika Najpomembnejšo vlogo ob klinični sliki igrajo še laboratorijske, slikovne in endoskopske preiskave. Najbolj zanesljive rezultate dobimo z endoskopskimi preiskavami, kjer imamo tudi možnost točne histološke opredelitve bolezni. Med laboratorijskimi preiskavami zelo pogosto zasledimo pospešeno sedimentacija eritrocitov (SR), posebej v obdobjih poslabšanj. Zaradi kroničnega izgubljanja krvi prihaja do anemij, levkocitoze in trombocitoze. Anemija je posledica krvavitev, pomanjkanja železa zaradi krvavitev in kroničnega vnetja, pri bolezni tankega črevesa pa tudi zaradi malabsorpcije železa, vitamina B12 in folatov. Podobno je z vrednostmi C-reaktivnega protein (CRP), ki so praviloma povišane, še posebej v času zagonov bolezni. Prav tako je pomembno določanje proteinov in mikroelementov v krvi in dokazovanju prisotnosti antinevtrofilnih citoplazemskih protiteles s perinuklearno razporeditvijo (p- ANCA) ter protiteles proti Saccharomyces cerevisiae (ASCA). Protitelesa p-anca so sorazmerno pogosto zvišana pri UK (80%) in manj pri bolnikih z CB (20%). Protitelesa ASCA pa so prisotna pri 70% bolnikov s CB, redkeje pa pri UK (manj kot 10%). Preiskave blata so prav tako pomembne, saj z njimi preverimo morebitno prisotnost črevesne okužbe z bakterijami ali paraziti. Določa se tudi nivo kalprotektina v blatu, s katerim lahko ocenimo stopnjo vnetnega procesa v črevesju. Opredelitev pomembnih mutacij na NOD2/CARD15 genu nam prav tako nakazuje prisotnost CB, saj se pojavljajo 28, 29 pri približno 30% mladostnikov s CB. Zaradi visoke specifičnosti ter pozitivne napovedne vrednosti so serološki označevalci p-anca, ASCA IgG, ASCA IgA, PAB in GAB tako samostojno kot v kombinaciji pomembni neinvazivni diagnostični testi. V vsakodnevni klinični praksi nam koristijo predvsem v diagnostični razmejitvi med KVČB in funkcionalnimi motnjami ter pri odločitvi za invazivne diagnostične metode. Zaradi prenizke občutljivosti pa niso primerni za uporabo kot presejalni testi za KVČB v pediatrični populaciji. Hipoalbuminemija je posledica kroničnega vnetja, malabsorpcije aminokislin ter obilne izgube proteinov skozi vneto sluznico. Nastopijo tudi motnje elektrolitskega ravnovesja (hipokaliemija, hipomagnezemija in hipokalciemija). 30 Diagnosticiranje in kakršnokoli natančnejše preverjaje stanja pa ne gre brez slikovnih in endoskopskih preiskav. Z ultrazvočnim pregledom lahko ocenimo prizadetost črevesja in stanje drugih trebušnih organov. Lahko uporabimo scintigrafijo označenih granulocitov, ki nam nakažejo lokacijo vnetja in diferenciacijo med CB in UC. Od ostalih slikovnih preiskav pride v poštev še jejunoileografija, 8

17 irigoskopija, ki nam pokažeta morebitne zožitve in ostale sluznične spremembe, kot so polipi in fistule. Druge diagnostične metode so še rentgensko kontrastna preiskava, računalniška tomografija in magnetna resonanca. Najprej navadno začnemo z rektosigmoidoskopijo. Občutljivejša in zanesljivejša preiskovalna metoda je kolonoileoskopija, s katero lahko pregledamo celotno debelo in tudi končni del tankega črevesa. Z njo lahko zelo natančno ocenimo spremembe na sluznici, možen pa je tudi odvzem vzorca tkiva za histološki pregled. Največkrat gre za aftozne spremembe, ulkuse, zožitve, psevdopolipe in tlakovan videz sluznice. Najbolj pogosto se pojavljajo spremembe v terminalnem ileumu. Ezofagogastroduodenoskopijo pa opravljamo pri bolnikih, ki imajo prizadet zgornji del prebavnega trakta. Najnovejša metoda je kapsularna endoskopija, pri kateri bolnik poje enkapsulirano video kamero, ki posname sluznico in pošilja posnetke na sprejemnik. Pri tej metodi je prisotna nevarnost zatika kamere na mestih zožitve, ki ji sledi obvezna kirurška odstranitev Zdravljenje Crohnove bolezni Osnovni namen zdravljenja CB je prekiniti akutne izbruhe in vzdrževati vmesna obdobja izboljšanja. Uporabljajo se učinkovine s protivnetnim delovanjem, antibiotiki, kortikosteroidi (KSi), imunosupresivi (IS) in biološka zdravila. Delno omiljenje bolezni in zmanjšan vnetni odgovor lahko dosežemo s spremenjeno prehrano, z raznimi dietami, z dodatki prehranskih dopolnil. 32, 33 Prekinitev kajenja lahko omili potek bolezni in zmanjša tveganje za pojav recidivov. 34 Odgovori bolnikov na zdravljenje so navadno zelo različni. Zdravimo v več stopnjah in na različne načine. Predvsem zato, ker nekateri pri določenih zdravilih razvijejo resne neželene učinke in je potrebno temu primerno prilagajati zdravljenje. Zdravljenje KVČB poteka v več linijah. Običajno začnemo zdraviti s 5- aminosalicilati (sulfasalazin, mesalazin), zatem nadaljujemo s KSi in IS (azatioprin-aza, 6- merkaptopurin-6-mp, metotreksat-mtx). Zdravljenje z zdravili je le delno uspešno, zato velikokrat pride do poslabšanj in v skrajnem primeru je potreben operativni poseg z delno odstranitvijo črevesa. 35 CB prizadene tako moške kot ženske in to največkrat v najbolj produktivnem obdobju, zato ima bolezen zelo velik vpliv na njihovo kakovost življenja (QOL), fizično in psihološko. Zaradi tega so se v zadnjem času terapevtski cilji zdravljenja Crohnove bolezni spremenili iz odprave "tradicionalnih" bolezenskih simptomov v čim boljšo zdravljenje bolezni in s tem veliko boljšo kakovost življenja posameznika, posledično pa boljšo zmožnost opravljanja del. Za ocenjevanje učinkovitosti zdravljenja navadno uporabljamo Crohn's Disease Activity Index (CDAI). Le-ta temelji na subjektivnem aspektu bolnika, ki v obdobju sedmih dni oceni: frekvenco tekočih ali zelo mehkih iztrebljanj, abdominalno 9

18 bolečino in splošno počutje, spremljajoče število ekstraintestinalnih simptomov, potrebo po antidiaroikih, telesno maso in hematokrit. Za zaznavanje majhnih sprememb v procesu zdravljenja je primernejši vprašalnik IBDQ, s katerim se da zelo dobro spremljati splošno počutje, psihično stanje in posredno uspešnost zdravljenja. Na razpolago so še razni drugi principi ocenjevanja(npr. HBI Harvey-Bradshow indeks). Vrstni red zdravljenja glede na težavnost bolezni je prikazan na sliki 2. Slika 2: Piramida zdravljenja CB. V letu 2007 je bilo za zdravljenje CB odobreno še eno biološko zdravilo z delovanjem na TNF-α, tj. adalimumab (ADA). Tudi pri tem zdravilu so prve študije pokazale do 30% neodzivnost na terapijo. 10

19 Tabela 1: Učinkovine za zdravljenje KVČB. TERAPEVTSKA SKUPINA GENERIČNO IME (UČINKOVINA) KOMERCIALNO IME 5-AMINOSALICILATI (5-ASA) ANTIBIOTIKI KORTIKOSTEROIDI IMUNOSUPRESIVI INHIBITORJI TNF-alfa mesalazin sulfasalazin balsalazid olsalazin metronidazol ciprofloksacin 6-metil-prednisolon prednisolon budesonid hidrokortizon deksametazon azatioprin 6-mercaptopurin mikofenolna kislina metotreksat ciklosporini infliximab adalimumab PODPORNA TERAPIJA Pentasa, Samezil Sulfasalazin ni reg. v SLO ni reg. v SLO Efloran, Metronidazol Ciprobay, Ciprinol Medrol, Solu Medrol ni reg. v SLO Budenofalk Hydrocortison Dexamethason Imuran Puri-nethol CellCept Methotrexate Sandimmun Remicade Humira MINERALI alfakalcidiol Alpha - D3 kalcijev karbonat Calcii carbonas INHIBITORJI H2 ranitidin Ranital, Ulran ZAVIRALCI PROTONSKE ČRPALKE omeprazol Ultop, Ortanol ANTIDIAROIKI loperamid živalsko oglje Seldiar Carbo medicinalis 11

20 Zgoraj omenjene učinkovine so na voljo pod različnimi komercialnimi imeni. V tabeli 1 je navedenih nekaj njihovih komercialnih imen. Posamezna zdravila iz skupin dajemo po korakih. Najprej posežemo po zdravilih z najmanj neželenimi učinki. Če zdravljenje ni uspešno, začnemo zdraviti z zdravili iz naslednje skupine in tako naprej, vse dokler ne posežemo po bioloških zdravilih. Pri bolnikih, pri katerih zdravljenje ni uspešno, bolezen pogosto privede do nastanka fistul in novotvorb, iz katerih se lahko razvije rak. Tveganje za nastanek raka pri bolnikih s kroničnim črevesnim obolenjem je veliko večje kot pri ostali populaciji. Aminosalicilati in antibiotiki Za zdravljenje se uporabljajo: sulfasalazin, mesalazin, balsalazid in olsalazin. To so derivati 5- aminosalicilne kisline (5-ASA). Razlike med temi učinkovinami so v glavnem v različnih farmakokinetičnih parametrih. Delujejo tako, da blokirajo nastajanje prostaglandinov in levkotrienov, inhibirajo z bakterijskimi peptidi sproženo nevtrofilno kemotakso. Molekulo sulfasalazina kemično sestavljata 5-aminosalicilna kislina (5-ASA) (aktivna komponenta) in sulfonamid sulfapiridin. Absorbcija 5-ASA je zelo slaba. Njen protivnetni učinek je samo lokalen, saj se praktično vsa izloči nespremenjena z blatom. Pogosti neželeni učinki so zvišana telesna temperatura, odvajalno delovanje, artralgije in in alergijske reakcije na koži. Redkejši pa so levkopenija, trombocitopenija in hemolitična anemija. Zmanjšuje aktivnost bolezni in podaljšuje intervale začasnega mirovanja bolezni. Ne deluje pri bolezni, ki se manifestira v ileumu, saj se aktivna učinkovina sprosti šele v kolonu pod vplivom določenih črevesnih bakterij. Mesalazin je čista nevezana 5-ASA. Na tržišču obstaja v različnih farmacevtskih oblikah (tablete, klizme, svečke). Tablete so lahko prevlečene z različnimi filmskimi oblogami (etilceluloza ali akrili) s ciljem, da tableta neraztopljena preide zgornje dele prebavne poti in nato deluje na mestu vnetja, kjer je zaželena čim večja koncentracija kemično nespremenjene učinkovine. Petnajst odstotkov bolnikov je ne prenaša Med antibiotiki najpogosteje uporabljamo metronidazol in ciprofloksacin. Ciljni bolniki so predvsem tisti s perianalno boleznijo, fistulami, vnetnimi masami v trebuhu, pogosto pa poskusimo zdraviti tudi bolnike z ileitisom. Podobne učinke zdravljenja dosežemo tudi v primerih zdravljenja s 39, 40 ciprofloksacinom. Neželeni učinki so predvsem slabost, anoreksija in diareja. 12

21 Kortikosteroidi in imunosupresivi Kortikosterotidi (KSi) se uporabljajo pri bolnikih, kjer z aminosalicilati, antibiotiki in imunosupresivi nismo dosegli želenega učinka ter so na začetku zdravilo izbire pri zelo hudih agresivnih oblikah CB. KSi zavirajo zgodnje znake vnetja z zaviranjem številnih vnetnih procesov na nivoju transkripcije interlevkinov. Zavirajo metabolizem arahidonske kisline in stimulirajo apoptozo limfocitov. S KSi dokaj dobro obvladujemo simptome bolezni, vendar pa z njimi ne moremo doseči remisije. Pri agresivnih oblikah posežemo po intravenski obliki zdravila (metilprednizolon, hidrokortizon), v ostalih primerih pa uporabimo peroralne oblike (prednizolon, prednizon, budezonid, deksametazon). Peroralno najpogosteje uporabljamo 6-metil-prednizolon v odmerku 0,5-0,75 mg/kg telesne mase za tiste s hudo obliko bolezni, pri ostalih pa se odmerki gibljejo okrog 32 mg dnevno 6-8 tednov. Po izboljšanju zdravilo ukinjamo postopoma, nato pa poskušamo vzdrževati takšno začasno umirjeno fazo s sulfalazinom ali mesalazinom. Včasih je še vedno potrebna majhen odmerek KSi. Če je le mogoče, se uporabi KSi izogibamo, saj imajo zelo resne neželene učinke. Med glavnimi so: osteoporoza, aseptična nekroza, peptični ulkusi, katarakta, nevrološka in endokrina disfunkcija, infekcijski zapleti ter psihiatrične težave. Sistemskim neželenim učinkom se lahko izognemo z uporabo posebne tehnološke formulacije budesonida, ki deluje lokalno protivnetno in se uporablja predvsem pri prizadetem termnalnem ileumu ali cekumu. Zdravilo je prirejeno tako, da se učinkovina sprosti šele v končnem delu tankega in začetnem delu debelega črevesa ter deluje lokalno na sluznico, zato se ne absorbira v sistem. Zdravilo praktično nima neželenih učinkov. Običajni odmerek je 9 mg na dan Imunosupresive uporabljamo predvsem v primerih, kadar potrebujemo za obvladovanje simptomov zelo velike odmerke KSi oziroma jih ne moremo ukiniti. Imunosupresivi delujejo tako, da zmanjšajo število limfocitov. Zaradi mehanizma delovanja je začetek učinkovanja počasen (navadno 2-3 mesece). Imunosupresivi zmanjšujejo potrebo po KSi in podaljšujejo remisijo ter so učinkoviti tudi pri zdravljenju fistul. Azatioprin in merkaptopurin sta učinkovini, ki se največ uporabljata. Odmerek azatioprina za vzdrževanje remisije je mg/kg/dan, merkaptopurina pa mg/kg/dan. Neželeni učinki so mrzlica, kožni izpuščaji in razni infekcijski zapleti. V primerih hudih oblik CB pa se lahko uporabi tudi ciklosporin Kirurško zdravljenje Pri bolnikih s CB operativno zdravimo le zaplete bolezni, kot so abscesi, fistule in stenoze. Uporablja se princip minimalne kirurgije, tako da se odstrani le najbolj prizadeti del črevesa. Pri skoraj 40 % bolnikov pride enkrat v celotnem obdobju bolezni do takšnega poslabšanja, da je potreben operativni poseg z delno odstranitvijo črevesa, v posameznih primerih pa celo celotno odstranitvijo črevesa. 13

22 Biološka zdravila V zadnjem času se pri CB bolnikih, ki ne odgovarjajo na standardno terapijo, uporabljajo biološka zdravila. Vsebujejo rekombinantne proteine in monoklonska protitelesa. Z njimi skušamo zavirati sproščanje in delovanje citokinov ali pa pospešiti delovanje protivnetnih citokinov. Najbolj znani zdravili sta infliksimab (IFX - himerno monoklonsko protitelo - Remicade ) in adalimumab (ADA - 48, 49 humano monoklonsko protitelo - Humira ). TNF alfa TNF-α ima ključno vlogo pri vnetnem procesu z imunskim sistemom povezanih bolezni. TNF-α je vključen v procese sistemskega vnetja in spada med citokine, ki stimulirajo reakcije akutne faze. Povzroča apoptozo, celično proliferacijo in diferenciacijo. Vključen je v stimulacijo produkcije citokinov, poveča ekspresijo adhezijskih molekul in aktivira nevtrofilce. Je kostimulator aktivacije T-celic in nastanka protiteles v B-celicah. TNF-α nastaja v glavnem v aktiviranih monocitih (makrofagih), in sicer kot v membrani zasidran homotrimerni 26 kd velik prekurzorski transmembranski kompleks, ki ga nato cepi TNF-α konvertaza. Učinek se kaže preko vezave na dva specifična transmembranska receptorja (TNFRSF1A in TNFRSF1B). Na površini aktiviranih imunskih celic vezan TNF-α pa učinek na tarčne celice v glavnem izraža preko TNFRSF1B. TNF pospeši vnetni odziv, kar povzroča veliko kliničnih problemov, povezanih z avtoimunimi motnjami, kot so revmatoidni artritis, ankilozirajoči spondilitis, CB in psoriaza. Posledično TNF-α postaja pomembna tarča v novih terapevtskih strategijah. Anti-TNF-α tarčna zdravila, ki se trenutno uporabljajo v vsakodnevni klinični praksi, so etanercept (Enbrel ), IFX (Remicade ) in ADA (Humira ). Etanercept je humani, topni dimerni TNF receptor tipa II, povezan z IgG1 Fc delom, ki se veže NA TNF-α in GA inaktivira. IFX je himerno IgG1 monoklonsko protitelo, ADA pa humano IgG1 monoklonsko protitelo. ADA in IFX se z veliko afiniteto vežeta na TNF-α in ga tako inaktivirata. Terapevtski učinek teh bioloških učinkovin je dosežen z blokado potencialne interakcije TNF-α s TNF receptorji na površini celic. IFX in ADA se ne kombinirata, lahko pa v primeru, da eno izmed njih ni učinkovito, poskusimo z drugim. Pred kratkim so se začela uporabljati še druga biološka zdravila za zdravljenje CB: entanercept (Enbrel ), certolizumab pegol (Cimzia ) in golimumab (Simponi )

23 Anti-TNF Biologics afelimomab infliximab nerelimomab CDP 571 Murine sequences Human sequences certolimumab CDP870 etanercept adalimumab Slika 3: Skupina anti-tnfα zdravil. Adalimumab (HUMIRA ) ADA je rekombinantni humani imunoglobulin G1 (IgG1), je monoklonsko specifično protitelo za humani dejavnik tumorske nekroze (TNF) in je klasificiran kot biološki prikrojevalec odziva. ADA je pridobljen z»phage display«tehnologijo z aminokislinsko sekvenco človeških zarodnih celic. ADA ne vsebuje nečloveških komponent ali umetno sestavljenih človeških proteinskih sekvenc. ADA ima strukturo, ki se ne razlikuje od naravnega človeškega IgG1 in ima razpolovno dobo primerljivo s človeškim IgG1 (približno 2 tedna). Pridobiva se z rekombinantno tehnologijo s sistemom celične ekspresije v celicah sesalcev (ovarijske celice kitajskega hrčka) in je očiščen s procesom virusne inaktivacije. ADA je visoko specifičen z veliko afiniteto za TNF-alfa, ne veže se oz. nima pa afinitete za limfotoksin alfa (TNF-beta). ADA se specifično veže na TNF alfa, preden ta reagira s p55 in p75 receptorji na celični površini. Blokira biološko aktivnost TNF tako da prepreči vezavo TNF na celično površino. Uvrščamo ga v farmakoterapevtsko skupino Pripravki za selektivno zaviranje imunske odzivnosti, z ATC oznako L04AA17. ADA modulira tudi biološke odzive, ki jih sproži ali uravnava TNF, vključno s spremembami koncentracije adhezijskih molekul, odgovornih za migracijo levkocitov. Povzroči apoptozo (programirano celično smrt) aktiviranih imunskih celic. ADA je indiciran 15

24 za zdravljenje hude, aktivne CB pri bolnikih, ki se ne odzovejo na popoln in ustrezen ciklus zdravljenja s KSi in/ali imunosupresivi, ali pa takšnega zdravljenja ne prenesejo oz. imajo zanj medicinske kontraindikacije. Pri bolnikih, ki na KSi dobro odgovarjajo, indukcijsko zdravljenje z ADA navadno začnemo skupaj s KSi, sicer ga pa uporabljamo kot monoterapijo Priporočena shema odmerjanja ADA med indukcijo je pri odraslih bolnikih s hudo CB 160 mg pri prvem odmerjanju (odmerek lahko apliciramo s štirimi injiciranji na en dan ali z dvema injiciranjema na dan, dva dni zapored), nato 80 mg 2. teden in potem nadaljujemo s 40 mg vsak drugi teden. Lahko začnemo tudi z 80 mg in nadaljujemo s 40 mg, vendar je pri hudih oblikah CB bolj priporočljiva shema s 160 mg na začetku zdravljenja. Tveganje za neželene učinke je med indukcijo večje. Včasih se poslužujemo odmerjanja 40 mg vsak teden. 54 Če pri bolniku dosežemo remisijo, lahko zdravilo ukinemo. Pri morebitnih ponovnih težavah lahko zdravilo ponovno uvedemo. Med vzdrževalnim zdravljenjem KSi postopoma znižujemo (po 4 mg tedensko). Nekaterim bolnikom, ki se ne odzovejo do 4. tedna, lahko koristi nadaljnje vzdrževalno zdravljenje do 12. tedna. Pri bolnikih, ki se tudi v tem obdobju ne odzovejo, je treba nadaljevanje 48, 53, 55, 56 zdravljenja skrbno pretehtati. Od kontraindikacij je pomembna preobčutljivost na zdravilno učinkovino ali katerokoli pomožno snov, aktivna tuberkuloza, hude okužbe in zmerno do hudo srčno popuščanje. Podatki o neželenih učinkih pri zdravljenju CB temeljijo na kontroliranih študijah, ki so zajele na tisoče bolnikov. Delež bolnikov, ki so zaradi neželenih učinkov prekinili zdravljenje, se je gibal med 5% in 6%. 55, 57, 58 V kontroliranih stopnjah kliničnih preizkušanj z zaviralci TNF-α so opazili več primerov limfomov pri bolnikih, ki so prejemali zaviralec TNF-α, kot pri kontrolnih bolnikih. Vendar je bilo pojavljanje redko, obdobje sledenja kontrolnih bolnikov pa krajše kot pri bolnikih, ki so prejemali zaviralec TNF-α. Pri uporabi zaviralcev TNF-α so v redkih primerih opisali pancitopenijo, vključno z aplastično anemijo. V kliničnih raziskavah so opažali poslabšanje kongestivnega srčnega popuščanja in večjo umrljivost zaradi te bolezni. Pri bolnikih z blagim srčnim popuščanjem (razred I/II po NYHA) je treba ADA uporabljati previdno. Pri bolnikih z zmernim ali hudim srčnim popuščanjem pa je kontraindiciran. Antagonisti TNF so bili v redkih primerih povezani s pojavom ali poslabšanjem kliničnih simptomov in/ali rentgenoloških znakov demielinizirajoče bolezni. Pri odločanju za uporabo ADA pri bolnikih z že prej obstoječimi ali nedavno nastalimi demielinizirajočimi boleznimi osrednjega živčevja, je potrebna posebna previdnost. V kliničnih raziskavah med subkutano uporabo ni bilo opisanih resnih alergijskih neželenih reakcij, pojavljale so se le občasno. Pokrovček igle na brizgi vsebuje lateks, kar lahko povzroči hude alergijske reakcije pri bolnikih, občutljivih za lateks. Glede imunosupresivnega delovanja niso opazili znakov zavrtja odložene preobčutljivosti, znižanja 16

25 koncentracije imunoglobulinov ali spremembe števila efektorskih celic T in B, naravnih celic ubijalk, monocitov/makrofagov ali nevtrofilcev. Zdravljenje z ADA lahko povzroči nastanek protiteles ter s tem nižjo serumsko koncentracijo in posledično zmanjšano učinkovitost. V dosedanjih študijah se je pojavnost protiteles gibala med 1,5% 57, 59 in 5%. Torej nižja kot je koncentracija učinkovine v plazmi tik pred naslednjo aplikacijo (»trough serum level«), več je protiteles in posledično manjša je učinkovitost terapije. Ta problem se da reševati s krajšanjem odmernega intervala. 60 Če se bolniku po zdravljenju pojavijo simptomi, ki nakazujejo lupusu podobni sindrom, zdravljenja z ADA ne smemo nadaljevati. Občasno lahko pride do zvišanja vrednosti jetrnih encimov, posebno ALT. Zvišanja so večinoma prehodne narave, saj navadno že med samim zdravljenjem padejo na normalno raven Klinične študije in uspešnost zdravljenja Crohnove bolezni z adalimumabom Osnovni namen zdravljenja CB je prekinitev akutnega zagona bolezni in nato vzdrževanje remisije. ADA je dobil uradno dovoljenje za zdravljenje CB in UC leta Na učinkovitost ADA vpliva veliko dejavnikov, ki pa so do sedaj še nepojasnjeni. Dober napovedni dejavnik je CRP oziroma C reaktivni protein. Je protein akutne fazne, katerega koncentracija v plazmi naraste ali pade, v odgovoru na jakost vnetnega procesa. Je ključni parameter za opredeljevanje jakosti vnetja. Pri zdravem človeku je vrednost CRP v krvi manj kot 3 mg/l. Prav padec CRP vrednosti na začetku terapije je znak dobrega odziva na zdravljenje. 61 S kliničnimi študijami odziva bolnikov na zdravila želimo ugotoviti učinkovitost zdravljenja in zabeležiti morebitne neželene učinke. Učinkovitost odziva CB bolnikov na zdravila merimo z raznimi indeksi kot so CDAI, Harvey-Bradshaw indeks, Kaplan-Meier survival analysis in IBDQ. Najpogosteje se uporablja vprašalnik CDAI (Crohn's Disease Activity Index). Uporablja se za merjenje uspešnosti zdravljenja preko kvantifikacije simptomov pri bolnikih s CB. Vrednosti se gibljejo od 0 in 600. Indeks je vsota osmih spremenljivk, pomnoženih z ustreznimi utežnimi faktorji, ki se gibljejo med 1 in 30. Skupno število točk nam okarakterizira stanje bolnika. 17

26 Klinična ali laboratorijska spremenljivka Tabela 2: Struktura CDAI vprašalnika. število tekočih oz. mehkih iztrebljanj vsak dan 7 dni zapored x 2 abdominalna bolečina (0-3 glede na stopnjo) vsak dan 7 dni zapored x 5 splošno dobro počutje, subjektivno ocenjeno od 0 (dobro) do 4 (grozno) vsak dan 7 dni zapored prisotnost zapletov* x 20 Uporaba loperamida ali opiatov x 30 napet abdomen ("abdominal mass") (0 brez, 2 negotovo, 5 razločno) x 10 hematokrit <0.47 pri moški in <0.42 pri ženskah x 6 Utežni faktor odstotek odstopanja od normalne telesne mase x 1 *Za vsakega od zapletov prištejemo po eno točko: prisotnost bolečine v sklepih (artralgija ali artritis), vnetje šarenice ali uveitis, prisotnost erythema nodosum, pyoderma gangrenosum ali aphthous ulcers, analne fisure, fistule ali abscesi, druge fistule, povišana telesna temperatura v preteklem tednu. x 7 Remisija CB je definirana kot padec CDAI na manj kot 150. O resni bolezni pa govorimo pri vrednostih višjih od 450. Večina študij pri CB definira odziv na učinkovino kot padec CDAI za več kot 70 točk od izhodiščnega. CDAI je alternativa vprašalniku IBDQ in se navadno izpolnjuje v intervalu od 14 dni do 1 meseca. Pri zdravljenju z ADA je to še posebej primerno, saj poteka odmerjanje ADA na 14 dni in vprašalnik sovpada z vsakim drugim odmerkom. Vedno se vprašalnik izpolni tik pred aplikacijo naslednjega odmerka. Vrednost indeksa IBDQ dobimo na podlagi vprašalnika, ki je sestavljen iz 32 vprašanj, razdeljenih v 4 podskupine: simptomi povezani s črevesjem (odvajanje, abdominalna bolečina), sistemska funkcija (utrujenost, vzorec spanja), socialna funkcija (zmožnost dela in socialnega udejstvovanja) in čustveni status (jeza, depresija, razdraženost, ). 62 Pri vsakem vprašanju lahko posameznik doseže največ sedem oz. najmanj eno točko, kar pomeni, da je celotna vsota točk med Višja kot je vsota doseženih točk z vprašalnikom, boljša je bolnikova kvaliteta življenja bolnika, ki je povezana z zdravljenjem. Za bolnike, pri katerih je vrednost IBDQ med 170 in 190, pravimo, da so v remisiji. Izmenično padanje in rast indeksa kaže na izmenjevanje akutnih vnetnih zagonov bolezni ter obdobij remisije. Če IBDQ poraste vsaj za 22 točk, smatramo, da je odziv bolnika na zdravljenje z ADA pozitiven. Glavna razlika med vprašalnikoma IBDQ in CDAI je ta, da prvi posveča več pozornosti psihosocialnemu statusu bolnika, CDAI pa več kliničnemu. Korelacija med obema je zelo dobra, kar kaže na proporcionalni psihični odziv bolnikov glede na njihovo dejansko klinično stanje

27 Po odobritvi zdravila ADA za zdravljenje CB je bilo opravljeno precejšnje število kliničnih študij. Varnost in učinkovitost ADA so ocenili pri več kot 1400 bolnikih z zmerno do hudo CB (CDAI 220 in 450) v randomiziranih, dvojno slepih, s placebom kontroliranih študijah. Dovoljeno je bilo sočasno zdravljenje s KSi, stalnimi odmerki aminosalicilatov, antibiotikov in/ali imunomodulacijskih zdravil. Eden od pomembnih dejavnikov za zaznavanje odziva na terapijo je CRP, zato so njegove vrednosti spremljali praktično pri vseh študijah. Vrednosti CRP odražajo resnost zagona bolezni (višji je CRP, resnejši je zagon bolezni). 64 Bolniki z nižjo koncentracijo zdravila v serumu pred naslednjim odmerkov (through serum levels) imajo slabši odziv na ADA. Prav tako je odziv na ADA slabši pri bolnikih, ki razvijejo protitelesa proti ADA. 60 Tudi vrednost ASCA (protitelo proti Saccharomyces cerevisiae) je povezana z resno obliko bolezni. 65 Poseben problem so fistule, ki se redko spontano zacelijo. Z uporabo ADA in ostalih bioloških zdravil je nastal znaten premik v smeri boljšega zapiranja fistul, kljub temu pa je velikokrat potreben kirurški poseg. Zdravljenje fistulizirajoče CB je dolgotrajno. 66 Novejši izsledki kažejo na to, da je izid zdravljenja veliko boljši, če začnemo zdraviti z ADA čimprej po resnem zagonu bolezni, tako začetnemu, kot ponovnemu. S tem se izognemo nadaljnjemu zdravljenju s KSi in obenem ohranjamo stanje in funkcionalnost sluznice ter s tem zmanjšamo verjetnost recidivov ter morebitne hospitalizacije ali celo kirurškega posega. 67 Prvi večji študiji sta bili CLASSIC I in CLASSIC II (Clinical assessment of ADA safetly and efficacy studies as induction therapy in Crohn s disease), ki jima je sledila študija GAIN. Classic I in II sta prav tako randomizirani, dvojno slepi in glede na placebo kontrolirani študiji. Študija CLASSIC I je usmerjena v preučevanje velikosti odmerka, ki je potreben za doseganje klinične remisije po 4 tednih (odziv je definiran kot CDAI<150). Vanjo je bilo vključenih 299 bolnikov s srednje hudo in hudo obliko CB, ki so dobili terapijo ADA v 0. tednu in nadaljevali s terapijo vsak drugi teden, pod pogojem, da pred tem še niso bili zdravljeni z zaviralci TNF-alfa. Dovoljena je bila vzporedna terapija z aminosalicilati, imunosupresivi, kortikosteroidi in antibiotiki. Bolniki so bili razdeljeni na štiri skupine. Prva skupina je dobila 40 mg(0. t.)/20 mg (2.t.), druga 80/40, tretja 160/80, četrta pa je dobivala placebo. Najboljši odziv na zdravilo ter dosego remisije po 4. tednih so imeli bolniki, ki so dobivali v 0. tednu 80 mg ADA, v 2. tednu pa 40 mg ADA. Mlajši bolniki so bolje odgovarjali na terapijo. 57 V študiji GAIN so 325 bolnikov, ki se niso več odzivali na IFX ali ga niso prenašali, randomizirali bodisi na 160 mg Humire v 0. tednu, 80 mg v 2. tednu, bodisi na placebo v 0. in 2. tednu. Študija ni 19

28 vključevala primarno neodzivnih bolnikov. V študiji GAIN je bilo za približno 15% manj bolnikov v remisiji, kot v CLASSIC I, saj so bili v to študijo zajeti tudi bolniki, ki niso bili naivni na IFX. 4. teden Tabela 3: Indukcija klinične remisije in odziva pri študiji CLASSIC I in GAIN. CLASSIC I: 299 bol Bolniki, ki še niso dobivali IFXa placebo n = 74 Humira 80/40 mg n = 75 Humira 160/80 mg n = 76 GAIN: Bolniki, ki so že dobivali IFX placebo n= 166 Humira 160/80 mg n = 159 klinična remisija 12% 24% 36% * 7% 21% * klinični odziv (CR-100) 24% 37% 49% ** 25% 38% ** Vse vrednosti p so za parne primerjave deležev med Humiro in placebom. * p < 0,001; ** p < 0,01 Z indukcijskima shemama 160/80 mg in 80/40 mg so do 8. tedna ugotovili podobne deleže remisij, neželeni učinki pa so bili pogostejši v skupini s shemo 160/80. V študiji GAIN se je pokazalo, da je vsekakor smiselno v primeru neodzivnosti na IFX poskusiti še z ADA, kljub temu da sta si zdravili zelo podobni. V isti študiji so ocenjevali kvaliteto življenja bolnikov. Za vrednotenje so uporabili IBDQ vprašalnik. Glede na porast vrednosti IBDQ se je kvaliteta življenja znatno dvignila, kar se je kazalo tako v telesni kot duševni komponenti, ki so jo vrednotili preko samoocenjevalne depresijske lestvice. Zaključili so, da indukcijsko zdravljenje z ADA vodi do hitrega izboljšanja CB in s tem kvalitete življenja Študija CLASSIC II je proučevala učinkovitost terapije z ADA, pri bolnikih, ki so prejemali konstanten odmerek 40 mg od 2. do 56. tedna. Pri tej raziskavi je sodelovalo 276 bolnikov iz predhodne CLASSIC I raziskave. 55 bolnikov, ki so bili v remisji v 0. in 4. tednu je bilo razdeljenih v tri skupine. Prva je dobivala 40 mg vsaki drugi teden, druga 40 mg vsaki teden, tretja pa je dobivala placebo. Učinkovitost terapije so ocenjevali s CDAI indeksom. Rezultati so pokazali, da so nekateri bolniki prešli v remisijo že po enem mesecu pri terapiji 40 mg ADA vsaki teden (83%). Remisijo so dosegli tudi bolniki v prvi skupini terapije (79%) in bolniki, ki so dobivali placebo (44%). Na splošno se je terapija z ADA pokazala kot uspešna, torej da je večina bolnikov, ki je dosegla remisijo po indukcijski terapiji, uspela vzdrževati remisijo tudi po nadaljevalni terapiji. Ugotovili so, da zdravilo ADA učinkovito vzdržuje stanje remisije na daljši rok. Raziskava je pokazala tudi, da je bolj učinkovita 48, 71 terapija z ADA, kjer so bolniki dobivali zdravilo vsaki drugi teden po 40 mg do konca 56. tedna. 20

29 Študija CHARM 53, 55, 72 (Clinical response and remission in patient with Crohn s disease) je bila randomizirana, dvojo slepa in glede na placebo kontrolirana študija. Vključevala je 854 bolnikov. Vključeni so bili tudi bolniki, ki so bili predhodno zdravljeni z IFX. Raziskava je trajala 56 tednov in je proučevala učinkovitost ter varnost ADA ter uspešnost doseganja klinične remisije. Bolniki so kot prvi odmerek prejeli 80 mg ADA ter 40 mg v drugem tednu, v 4. tednu pa so jih razdelili v 3 skupine, kjer je prva dobivala 40 mg vsak drugi teden, druga pa 40 mg vsak teden, tretja pa je prejemala placebo vsak teden. To terapijo so ponavljali 56 tednov. V skupine so bili razdeljeni glede na to, kako so se odzvali na zdravilo. Ključen pokazatelj odziva je bil padec CDAI za več kot 70 točk. 47% bolnikov, ki so prejemali ADA, je pokazalo uspešen odziv in izboljšanje stanja po 26. tednu, medtem ko je bilo izboljšanje opazno pri 17% bolnikov, ki so prejemali placebo. Prav tako kot pri predhodnih študijah je bila tudi tu dovoljena vzporedna terapija s standardnimi zdravili. Ob uspešnem odzivu na terapijo so začeli postopno zniževati odmerek KSi. Klinični odziv se je po četrtem tednu pokazal pri 58% bolnikov ob indukcijskem odmerku 80mg in vzdrževalni 40 mg vsak drugi teden. Po četrtem tednu je zaradi neodzivnosti odpadlo 76 bolnikov. Po četrtem tednu je imelo klinični odziv 499 od preostalih 778 bolnikov, kar je zelo podobno kot v študiji CLASSIC I. 57 V remisiji je po 56 tednih ostalo 48% oz 41%, odvisno ali so prejemali ADA vsak ali vsak drugi teden. Iz študije CLASSIC II je torej razvidno, da večina bolnikov, ki je remisijo dosegla po 4 tednih, le-to ohrani tudi po 56 tednih. 48 Tabela 4: Vzdrževanje klinične remisije in odziva v študiji CHARM (odstotek bolnikov). placebo 40 mg Humire vsak drugi teden 40 mg Humire vsak teden 26. teden n = 170 n = 172 n = 157 klinična remisija 17% 40% * 47% * klinični odziv (CR-100) 27% 52% * 52% * bolniki v remisiji brez steroidov za 90 dni a 3% (2/66) 19% (11/58) ** 15% (11/74) ** 56. teden n = 170 n = 172 n = 157 klinična remisija 12% 36% * 41% * klinični odziv (CR-100) 17% 41% * 48% * bolniki v remisiji brez steroidov za 90 dni a 5% (3/66) 29% (17/58) * 20% (15/74) ** * p < 0.001, ** p < 0,02 21

30 Tabela 5: Vzdrževanje klinične remisije in odziva primerjava študije CLASSIC II in CHARM. 56. teden klinična remisija klinični odziv (CR-100) CLASSIC II: 55 bolnikov v remisiji iz študije CLASSIC I placebo n = 18 Humira 40 mg vsak drugi teden n = 19 Humira 40 mg vsak teden n = 18 CHARM: bolniki, ki so že bili na IFX placebo n = 170 Humira 40 mg vsak drugi teden n = 172 Humira 40 mg Vsak teden n = % 79% 83% 12% 36% 41% 56% 79% 89% 26% 52% 53% EXTEND je podobna študija kot predhodne, le da so tu večjo pozornost usmerili na spremembe na sluznici. Uspešnost zdravljenja so ocenjevali pri 135 bolnikih na osnovi ocene sprememb na sluznici, dobljenih z ileokoloskopijo. Vzdrževalna odmerek je bil 40 mg vsak drugi teden, indukcijski pa 160 mg. Po štirih tednih so bolnike naključno razdelili na tiste s placebom in tiste s 40 mg vsak drugi teden do 56. tedna zdravljenja. Pri bolnikih, ki po osmih tednih niso pokazali odziva, so spremenili odmerni režim na 40 mg tedensko. Po 12. tednih je bil pozitiven odziv pri 27% bolnikov in 13% pri placebu, po 52. tednih pa 24% proti nič. Remisijo so po 12. tednih dosegli bolniki z ADA v 47 %, po 52 tednih 33%. 56 Študiji ACCESS in CARE sta bili usmerjeni na področje fistul in njihovega zapiranja. V študiji ACCESS so spremljali bolnike z zmerno in hudo obliko CB, imeli pa naj bi vsaj eno fistulo na začetku zdravljenja. Bolniki so bili razdeljen na naivne in take, ki so pred tem že dobivali IFX. Izkazalo se je, da so se fistule signifikantno bolje zapirale pri naivnih bolnikih (60%), kot pri ostalih (20%). 73 Naslednja je panevropska multicentričnaštudija CARE, v kateri so prav tako ugotavljali uspešnost zapiranja fistul po zdravljenju z ADA. Zajela je 945 bolnikov z zmerno in hudo obliko CB. 171 bolnikov je imelo fistule. Opazovali so zapiranje fistul po 20. tednih zdravljenja in ugotovili uspešno zapiranje pri 20% bolnikov. Pri bolnikih, predhodno zdravljenih z IFX, pa niso zaznali razlik v uspešnosti zapiranja fistul. 74 Skupno vsem študijam je neizpodbitno dejstvo, da je ADA učinkovitejši od placeba in da gre v primeru uvedbe ADA v zdravljenje CB za znaten napredek v pristopu zdravljenja. Generalno gledano je bila odzivnost na terapijo 60 do 80%, remisija pa je bila dosežena pri 30 40% bolnikov. Ne gre samo za 22

31 izboljšanje sprememb na sluznici, ob tem je pomembno, da je posledično manj zapletov in s tem manj ho*/spitalizacij, veliko pa bolniki pridobijo tudi na kvaliteti življenja Genetika KVČB Natančna etiologija KVČB še vedno ni znana. Trenutna hipoteza je, da nastane zaradi nepravilnega in ponavljajočega se vnetnega odgovora na dobre (komenzalne) mikrobe v genetsko pogojenem gostitelju. 75 Relativno tveganje med sorodniki (λs) je za CB ocenjeno na 25-42, za UK pa Genetski dejavniki torej poleg okoljskih dejavnikov povečajo tveganje za razvoj bolezni. Ni še natančno znano ali gre za prekomerni odziv T-celic na normalne antigene mikrobov ali je vzrok v nenormalni črevesni mikroflori in reakcije med njimi in imunskim sistemom v črevesni sluznici. Napake v prirojenem imunskem sistemu omogočajo, da bakterije pridejo na sluznico črevesja, kar povzroči prekomerni imunski odziv in kasneje poškodbe črevesja. Za iskanje kandidatnih genov v zvezi z nastankom kompleksnih bolezni največkrat uporabimo študije genetske povezave in asociacijske študije. V prvih gre za proučevanje zaporednega dedovanja določenih polimorfnih delov, pri asociacijskih pa odkrivanje povezave določenih genov (polimorfizmov) z boleznijo, kar pa izvedemo s primerjavo frekvenc alelov pri bolni in zdravi (kontrolni) populaciji. Prve študije, ki so analizirale kandidatne gene pri KVČB, vključno s poglavitnim histokompatibilnostnim kompleksom (MHC) 77, niso dale ponovljivih rezultatov, prav tako niso prinesle novih spoznanj o patogenezi KVČB. K napredku je prispevala tehnika raziskovanja genoma z mikrosatelitnimi DNK markerji. Tako je analiza DNK članov plemen s številnimi obolelimi člani identificirala področje navidezne vezave na kromosomu 16 med člani s CB, medtem ko pri članih z UK te povezave niso ugotovili. Te študije so ugotovile, da je so s KVČB povezani tudi številni drugi lokusi. Podrobnejša analiza kromosoma 16 je v letu 2001 identificirala gen iz regije, odgovoren za to povezavo. To je gen, ki kodira citoplazemski protein NOD2 (CARD15), ki ga izražajo makrofagi in lahko služi kot prepoznavni receptor za bakterijske lipopolisaharide. Izkazalo se je, da je za evropske in severno ameriške bolnike s CB bolj verjetno, da imajo variante v NOD2 kot pa osebe brez CB. Variante na NOD2 povzročijo zmanjšano makrofagno aktivacijo jedrnega faktorja kb kot odgovor na lipopolisaharide. Osebe, ki so homozigoti za NOD2 variante, imajo več kot 20-krat povečano možnost za nastanek CB, z nagnjenjem k ilealni bolezni. 9 Nekaj mesecev po odkritju gena NOD2, so znotraj velike vezavne regije na kromosomu 5q31 odkrili bolezenski haplotip (IBD5). 78 Z boleznijo povezani polimorfizmi SNP se raztezajo na regiji, ki vključuje gene P4HA2, IRF1 ter SLC22A4 (OCTN1) in 23

32 SLC22A5 (OCTN2). Po odkritju teh dveh regij precej časa ni bilo novo odkritih bolezenskih genov. Vzrok za to je predvsem v tem, ker so bile asociacijske študije v tem času omejene na manjše število bolnikov z omejenim številom genetskih variant v genih, domnevno vpletenih v patogenezo KVČB. Novo obdobje raziskav je prinesel razvoj tehnologije mikromrež in s tem tehnike asociacijskih študij na celotnem genomu (GWA študije za genome wide association). GWA študije hkrati genotipizirajo tisoče polimorfizmov SNP v celotnem genomu na veliki skupini bolnikov in zdravih posameznikov kontrol. Te študije so prinesle velik napredek pri razumevanju KVČB. Prva GWA študija pri KVČB v letu 2005 je analizirala okoli polimorfizmov SNP pri okoli 480 japonskih bolnikih s CB in 350 kontrolah ter najmočnejšo povezavo odkrila med polimorfizmi SNP in haplotipi znotraj gena TNFSF15 (TNF superdružina), 79 kar so kasneje potrdili tudi pri evropskih bolnikih s KVČB. 80 Zadnja GWA študija je bila narejena na skupini bolnikov s KVČB in zdravih posameznikov in je opisala skupno 163 s KVČB povezanih lokusov. 22 Kljub različnim kliničnim značilnostim je približno 30% s KVČB povezanih lokusov skupnih med UK in CB, kar nakazuje na to, da imata bolezni podobno pot in sta del istega mehanizma. Analize genov in genetskih področjih vpletenih v KVČB kažejo na številne poti, ki so ključne pri vzdrževanju črevesne homeostaze, vključno z obrambo pred mikrobi, prirojenim imunskim odgovorom, avtofagijo, regulacijo pridobljene imunosti in metabolnimi potmi. Identifikacija polimorfizmov SNP v GWA študijah, povezanih s KVČB, je zelo veliko prispevala k razlagi teh poti. Na sliki 4 je prikazan model KVČB poti, ki temelji na spoznanjih GWA študij. Črevesna homeostaza vključuje usklajeno delovanje epitelnih, prirojenih in pridobljenih imunskih celic. Prepustnost mej med njimi omogoča vdor mikrobom, kar zazna prirojen imunski sistem, ki nato določi primeren tolerogenski, vnetni in popravljalni odgovor z izločanjem zunajceličnih mediatorjev, ki aktivirajo druge celične komponente, vključno s pridobljenimi imunskimi celicami. Genetski dejavniki, mikrobiota in imunski faktorji vplivajo na ravnovesje teh signalov. 75 S primerjavo s podobnimi boleznimi je bilo ugotovljeno, da je več kot 50% s KVČB povezanih lokusov povezanih tudi z drugimi vnetnimi in avtoimunskimi boleznimi. Ti prekrivajoči geni lahko imajo različne vplive v različnih boleznih. Tak primer je npr. kodirajoča variatna na genu PTPN22 (R620W), ki predstavlja velik dejavnik tveganja za nastanek sladkorne bolezni tipa 1 in revmatoidnega artritisa, vendar predstavlja zaščitni dejavnik za nastanek CB. 81 Zato je za raziskovanje biologije bolezni ključno razumevanje funkcije teh skupnih genov. Lokusi tveganja za CB imajo zelo veliko prekrivanje z bolezenskimi regijami za infekcijo z Mycobacterium leprae, vključno z geni kot so NOD2, C13orf31 in LRRK2, prav tako pa so npr. geni CARD9, LTA, ITLN1 in IRGM1 povezani s CB in prav tako vplivajo na odgovor gostitelja na mikobakterijsko infekcijo. 24

33 Slika 4: model KVČB poti, ki temelji na spoznanjih GWA študij. Povzeto po Khor et al. 75 Pri odkrivanju genetskih dejavnikov tveganja so zelo pomembne redke variante. Primer je identifikacija SNP-jev na genu IL10RA, ki so povezani z zgodnjim nastankom KVČB. 82 Prav tako so v GWA študijah ugotovili povezavo z ostalimi signalnimi komponentami IL-10R, vključno s STAT3, TYK2, JAK2 in IL10, skladno z opažanjem, da tako redke kot pogoste variante vplivajo na isto pot. Resekvenciranje je odkrilo že znane in nove variante na genih CARD9, NOD2 in IL23R z neodvisnim vplivom na nastanek bolezni. Variante na genu IL23R so se potrdile kot zaščitne. 83 Geni povezani s KVČB kažejo na vlogo integritete pregrade pri nastanku bolezni in vključujejo gene CDH1, GNA12 in PTPN2. Študije so namreč pokazale, da so skrajšane oblike proteina, ki ga kodira CDH1, povezane s CB, v črevesnih biopsijah bolnikov s CB, ki nosijo mutirane alele, pa je zaznati nepravilno lokalizacijo proteina in akumulacijo v citosolu. 84 Aktivacija G proteina Gα12, ki ga kodira GNA12, vodi do fosforilacije proteinov tesnih stikov (ZO-1 in ZO-2), kar povzroči destabilizacijo celične stikov v epitelnih celičnih linijah. 85 Dodatno so genetske študije ugotovile povezavo med številnimi transkripcijskimi faktorji regeneracije epitelija in KVČB. Te povezave vključujejo gene HNF4A in NKX

34 1.3. Farmakogenetika adalimumaba Farmakogenetika išče vzročne odnose med genotipom in odzivom na zdravilo glede na klinično pomembne fenotipske variacije pri zdravljenju. Cilj farmakogenomike je tako učinkovito in varno zdravljenje tarčnih skupin bolnikov z določenim genotipom. Dejavniki, ki vplivajo na razlike v odgovoru na zdravila, so večplastni in kompleksni. Tabela 5 prikazuje glavne dejavnike, ki vplivajo na odgovor na zdravilo. Tabela 6: Glavni dejavniki, ki vplivajo na odgovor na zdravilo. Dejavnik Genetski dejavniki Drugi dejavniki Terapevtske tarče Encimi presnove zdravil Transporterji zdravil Tarče neželenih učinkov zdravil Dejavniki s posrednim vplivom Okoljski dejavniki Okoljske kemikalije, sočasno jemanje drugih zdravil, kajenje, pitje alkohola, prehrana Fiziološki dejavniki Starost, spol, bolezen, nosečnost, telovadba, cirkadiani ritem, stradanje Vpliv Glavne spremenljivke: stabilne ali podedovane Učinkovitost zdravila (farmakodinamika) Metabolizem zdravila (farmakokinetika) Razporeditev zdravila (farmakokinetika) Toksičnost zdravila (farmakodinamika in farmakokinetika) Učinkovitost zdravila, farmakokinetika in toksičnost Večinoma prehodni Učinkovitost zdravila, farmakokinetika in toksičnost Učinkovitost zdravila, farmakokinetika in toksičnost Genetske variacije, ki vplivajo na odgovor na zdravilo, so lahko polimorfizmi posameznega nukleotida (SNP-ji), insercije, delecije ali duplikacije. Najpogostejše so SNP-ji. Več kot 90% človeških genov vsebuje vsaj 1 SNP. Veliko SNP-jev nima nobenega vpliva na funkcijo gena, medtem ko imajo nekateri SNP-ji zelo močan vpliv na funkcijo z njim povezanega gena. Zadnji pristop predstavlja integracijo večih SNP-jev po celem genomu za identifikacijo genetskih lokusov, ki so v vezavnem neravnovesju. 86 Glavni namen farmakogenomike je tako identifikacija markerjev, ki bi omogočila, da zdravimo samo tiste bolnike, ki bodo na terapijo odgovarjali ter ne bodo imeli stranskih učinkov z namenom optimizacije učinkovitosti terapije in zmanjšanja stroškov. 26

35 Prav tako so razlike med posamezniki s CB pri učinkovitosti in stranskih učinkih uporabe različnih terapij posledica genetskih polimorfizmov. Te genetske variante so predvsem v genih, ki so vključeni v metabolizem ali mehanizem delovanja glukokortikosteroidov, azatioprina/6-merkaptopurina, metrotreksata ali anti-tnf zdravil. Anti-TNF zdravila delujejo tako, da blokirajo interakcije med TNFα in TNF celičnimi površinskimi receptorji. Tako himerno monoklonsko protitelo proti TNFα, infliksimab (IFX), nevtralizira tako topno kot na membrano vezano obliko TNFα. Predpostavljeni so bili tudi drugi mehanizmi, kot npr. s protitelesi vodena celična citotoksičnost, aktivacija komplementa preko Fc dela in apoptoza T limfocitov. Anti-TNF terapija je učinkovita pri vzpostavitvi in vzdrževanju remisije pri luminalni in fistulizirajoči obliki CB, vendar okrog 30% bolnikov ne odgovarja na terapijo, pri okrog 30 % pa odgovor ni popoln. Zaradi visoke cene in posameznih primerov hudih neželenih učinkov, je prišlo do porasta farmakogenetskih študij za anti-tnf zdravila. 87 Farmakogenetskih študij, ki bi preučevale učinkovitost adalimumaba (ADA) v povezavi z genetskimi polimorfizmi, praktično ni. Do danes je objavljeno samo eno poročilo, ki je obravnavalo povezavo med polimorfizmi in odgovorom na ADA pri 24 bolnikih s CB. 88 V tej študiji so analizirali polimorfizme v genih NOD2, CD14 in TLR4, vendar niso našli nobene povezave med polimorfizmi in odzivom na ADA. Večje število študij je na voljo za IFX. Glede na to da sta učinkovini zelo podobni, služijo izsledki študij na IFX kot iztočnice za raziskave na ADA. Prve študije so bile narejene za polimorfizme SNP, ki so pokazali povezavo s KVČB in sicer R702W, G908R in 1007InsC na genu CARD15 (NOD2), vendar ni bila odkrita nobena signifikantna povezava. 89, 90 Prav tako ni bila najdena nobena jasna povezava med SNP-ji v genu TNFα in njegovih receptorjih TNFR1 in TNFR2 ter odgovorom na IFX Povezava med IFX in odgovorom na terapijo je bila najdena v dveh apoptoznih genih FASLG in CASP9 94 ter za polimorfizem G4985T (aminokislina V158F) v genu FCGR3A 95, čeprav te povezave v drugi študiji niso potrdili. 59 Prav tako so opisali potencialno povezavo med genom ADAM17 in odgovorom na IFX. 96 Izvedena je bila tudi GWA študija pri otroških bolnikih s KVČB, ki je identificirala gene BRWD1 z odzivom na IFX

36 2. NAMEN RAZISKAVE IN HIPOTEZE Glavni cilj naše raziskave je bil skozi prospektivno farmakogenetsko raziskavo odkriti najbolj učinkovite farmakogenomske biooznačevalce, ki bi v kasnejši fazi omogočali načrtovanje učinkovitega individualiziranega zdravljenja bolnikov s CB. V študijo smo zajeli bolnike, zdravljene z biološkim zdravilom adalimumab (Humira ) (ADA), ki je monoklonsko protitelo za inhibicijo provnetnega citokina TNFα. Genotipizirali smo polimorfizme posameznega nukleotida (SNP) v kandidatnih genih povezanih s KVČB (ATG16L1, IL23R, SLC22A4, PTGER4 in drugi). Nadalje smo merili gensko ekspresijo izbranih kandidatnih genov ter jih v kombinaciji z nekaterimi biokemijskimi in imunološkimi parametri (CRP, ASCA, panca, PAB) spremljali v poteku zdravljenja ter poiskali statistične povezave z odgovorom na zdravljenje, ki smo ga ugotavljali z indeksom IBDQ in koncentracijo C reaktivnega proteina (CRP) v krvi. Vzorce krvi smo odvzeli pred zdravljenjem, ter po 4., 12., 20., in 30. tednu, ter vsakič določili biokemijske, hematološke in imunološke parametre, vedno pa je bil določen tudi IBDQ indeks. Prav tako smo spremljali fenotipske značilnosti (spol, starost, starost ob diagnozi, trajanje bolezni, status kajenja, spremljajoči bolezenski simptomi, lokacija bolezni v prebavnem traktu) in poiskali morebitne povezave glede na uspešnost zdravljenja. Pred in po zdravljenju (4., in 30. teden) smo iz krvnih limfocitov izolirali DNA in RNA molekule, dodatno smo DNA in RNA izolirali tudi iz črevesnih biopsij. Gensko ekspresijo v poteku zdravljenja smo spremljali s tehniko kvantitativnega PCR v realnem času (qpcr) in primerjali vneti del črevesne sluznice z nevnetim ter gensko ekspresijo v limfocitih periferne krvi. Študijo smo izvedli na skupini 102 bolnikov s CB, zdravljenih z ADA. 28

37 3. PREISKOVANCI IN METODE DELA 3.1. Preiskovanci Gastroenterološka klinika Univerzitetnega kliničnega centra Ljubljana in Gastroenterološka klinika Univerzitetnega kliničnega centra Maribor sta dva velika centra v Sloveniji, kjer se uvaja zdravljenje z ADA. Glede na sorazmerno majhno število bolnikov s Crohnovo boleznijo (CB) smo se odločili, da bo raziskava potekala v obeh centrih, da bi tako dobili čim več bolnikov za raziskavo. Pridobili smo soglasje obeh klinik za izvajanje kliničnega dela raziskave. Laboratorijski del je potekal v Centru za humano molekularno genetiko in farmakogenomiko laboratorijskega centra Medicinske fakultete v Mariboru. V raziskavo smo vključili preko sto bolnikov s CB, ki smo jih zdravili z ADA. V raziskavi smo zajeli bolnike, ki so imeli klinično in histopatološko potrjeno diagnozo CB in so ustrezali posebnim vključitvenim oz. izključitvenim kriterijem. Bolniki so morali izpolnjevati enega od naslednjih kriterijev za zdravljenje z ADA: Bolniki ki kažejo nezadosten odgovor na dva ali več načinov konvencionalne terapije: 5- aminosalicilati (sulfasalazin, mesalazin) 4,5 g/dan v trajanju vsaj zadnja dva meseca, Ksi (prednizon, prednizolone, metilprednizolon) 42 mg/dan oz. 1 mg/kg telesne mase zadnja dva meseca, imunosupresivi (6-merkaptopurin, azatioprin) 2,5 mg/kg telesne teže zadnjih 6 mesecev, metotreksat 25mg s.c. ali peroralno 1x tedensko, azatioprin 2,5 mg/kg/dan zadnjih 6 mesecev, metronidazol 1,2 g/dan in/ali ciprofloksacin 1 g/dan v trajanju zadnjega meseca. Bolniki s srednje hudo in hudo obliko CB, pri kateri so se pri stalnem zdravljenju s KSi ali imunosupresivi pojavili hudi neželeni učinki. Neprenosljivost zaradi neželenih učinkov ali neodzivnost na IFX. Izjemoma po presoji konzilija za odobritev terapije z ADA v primeru zelo akutnega poteka bolezni. Dokončno mnenje glede primernosti bolnikov za zdravljenje z ADA sta dali posebni komisiji, zastopani v obeh kliničnih centrih. Pred začetkom raziskave smo pridobili dovoljenje Komisije Republike Slovenije za medicinsko etiko (KME). KME 80/10/07, 21p/12/07. Soglasje smo dobili, saj je komisija ugotovila, da v raziskavi ni nobenega dodatnega tveganja za bolnike ter da gre za zdravljenje, ki je tudi že sicer uveljavljeno v vsakdanji klinični praksi. Ugodila je skoraj vsem zahtevam raziskave. Omejitev je postavila samo v 29

38 primerih, ko bi se naj za spremljanje in vrednotenje odziva na terapijo z ADA izvajale pogoste kolonoskopije. Mnenje komisije je bilo, da je izvajanje kolonoskopij, samo zaradi ugotavljanja učinka zdravljenja etično sporno, saj naj bi šlo za nepotrebno dodatno obremenitev bolnikov. Odločili so, da je pridobivanje informacij o učinku zdravljenja s kolonoskopijo dovoljena samo v primerih, ko je ta indicirana iz razlogov, ki ne izhajajo iz same študije. KME je zahtevala še odgovorne osebe v obeh centrih, ki bi naj skrbele za varnost oseb tekom raziskave. Za vključitev v študijo so morali bolniki izpolniti enega od naslednjih kriterijev: neodzivnost na standardno terapijo v primeru ukinitve zdravljenja z IFX (neodzivnost, izzven učinka, neprenosljivost) pojav resnih neželenih učinkov pri zdravljenju s standardno terapijo Bolniki, ki so imeli katerega od izključitvenih kriterijev, niso bili vključeni v raziskavo. Ti kriteriji zajemajo resne komplikacije pri CB (stenoze, simptomatke obstruktivne in intestinalne strikture, abscese, totalno kolektomijo), druge operativne posege na črevesju stare manj kot tri tedne, alergije na murinske kmponente po zdravljenju z IFX, resne infekcije v zadnjih treh mesecih, pozitivni test na tuberkulozo oz. aktivna tuberkuloza, malignome, nosečnost in dojenje, listeriozo, HIV, UK, dokazano zlorabo alkohola in drog, diabetes in zmerno do hudo srčno popuščanje. Pri vseh bolnikih smo naredili kvantiferonski test, s katerim smo izključili prisotnost tuberkuloze. 73 Vsakega potencialnega kandidata za zdravljenje z ADA in vključitev v študijo je na začetku vedno pregledal terapevt ob predpostavki, da je imel že narejen kvantiferonski test za ugotavljanje morebitne obolevnosti za tuberkulozo in je izpolnjeval kriterije za zdravljenje z ADA in vključitev v raziskavo. V naslednji fazi je sledil pogovor z bolnikom o terapiji, načinu in pristopu zdravljenja ter predvidenih izidih zdravljenja in podrobnostih raziskave. Po razgovoru se je bolnik odločil glede sodelovanja v raziskavi. Vsi bolniki zajeti v študijo so pred začetkom zdravljenja podpisali»izjavo o privolitvi v raziskavo«(priloga 1). Po terapevtovem pregledu je sledil razgovor z vodjo raziskave, ki je vsakega bolnika podrobno seznanil s protokoli zdravljenja z ADA. Podrobneje smo bolnikom predstavili, kako zdravilo deluje, kakšni so možni neželeni učinki, kakšen je režim odmerjanja in kako poteka samoaplikacija. V raziskavi smo zajeli 102 bolnika. Zastopani so bili predstavniki obeh spolov. Po razgovoru s terapevtom in odločitvi glede zdravljenja z ADA ter podpisu soglasja o sodelovanju v raziskavi smo najprej pridobili osnovne podatke o bolniku (ime, priimek, naslov, starost, spol, kontakt svojcev). Vprašalnik je zajemal še naslednje podatke: bolnikovega zdravnika specialista na kliniki, splošnega zdravnika, leto postavljene diagnoze, telesno težo, vključitveni kriterij, prizadeto področje gastrointestinalnega trakta, pridružene bolezni (bolečine v sklepih ali celo vnetja sklepnih ovojnic, 30

39 sakroileitis, ankilozirajoči spondilitis, za CB značilne kožne spremembe, analne fisure, fistule, abscesi, kožne fistule, povišana telesna temperatura, aftozne ulceracije, spremembe na očeh, perikarditis, miokarditis, osteoporoza, avtoimuno obolenje jeter, avtoimuno obolenje žolča), telesno težo, število mehkih iztrebljanj na dan, podatke o morebitnih boleznih povezanih z gastrointestinalnim traktom pri sorodnikih. Naslednji sklop vprašanj se je nanašal na terapijo z zdravili in sicer o pretekli in trenutni terapiji s standardnimi (aminosalicilati, imunosupresivi, KSi, antibiotiki), biološkimi (IFX) in ostalimi zdravili za simptomatsko terapijo. Pridobili smo še podatke o dosedanjih operativnih posegih, kajenju (sedanjem, bivšem) in področju prizadetosti prebavnega trakta. Nekatere od zbranih podatkov smo uredili po vzoru Montrealske klasifikacije, prikazane v tabeli 7. 6 Klinična značilnost Tabela 7: Montrealska klasifikacija Crohnove bolezni. Starost Spol Povprečje Moški/Ženske A1 pod 17 let Starost ob diagnozi A2 med 17 in 40 let A3 nad 40 let L1 ileum Lokacija vnetja L2 kolon L3 ileokolon L4 bolezen zgornjega prebavnega trakta Obnašanje bolezni Kajenje B1 brez zožitev, brez fistul B1p brez zožitev, brez fistul perianalno B2 zožitve B2p zožitve in fistule perianalno B3 fistule B3p fistule + perianalo Operacija 5-ASA aminosalicilati Spremljajoča terapija Kortikosteroidi Imunosupresivi 31

40 3.2. Odmerjanje ADA Optimalna serumska koncentracija je 4-8 μg/ml in jo dosežemo z odmerjanjem 40 mg vsak drugi teden, pri odmerjanju 40 mg/teden dosežemo serumsko koncentracijo > 10 μg/ml. Razpolovna doba ADA je približno 14 dni, zato je standardno odmerjanje na 14 dni. Na splošno sta utečeni dve shemi odmerjanja ADA. Razlikujeta se po začetnem odmerku. V prvem primeru je začetni odmerek 160 mg, ki se nadaljuje po dveh tednih s 40 mg in vzdržuje vsak drugi teden s 40 mg. Druga shema se razlikuje samo v začetnem odmerku, ki znaša 80 mg, ostale pa so enaki kot v prvem primeru. Prve sheme se navadno poslužujemo, če gre za bolj akutni potek bolezni z visokimi vrednostmi parametrov vnetja. V prvem primeru obstaja nekaj večja možnost pojava neželenih učinkov. Kljub temu smo v naši raziskavi začeli s 160 mg, nadaljevali z 80 mg in vzdrževali terapijo s 40 mg vsak drugi teden. Vzdrževalni odmerek se lahko poviša, tako da se odmerni interval skrajša na en teden, serumska koncentracija pa se pri takem odmerjanju giblje okrog 10 μg/ml. Glede na to, da je začetni odmerek 160 mg, pomeni to štiri injiciranja naenkrat (4 prednapolnjene brizge za samoaplikacijo). To je lahko problem za nekatere bolnike, tako psihični, kot fizični zaradi bolečin in lokalnih alergičnih reakcij na mestu vboda. V takih primerih smo dovolili razdelitev aplikacij na dve injekciji prvi dan in dve injekciji drugi dan. Humira je pripravljena v prednapolnjeni brizgi za samoiniciranje s subkutano aplikacijo. Bolnik si jo lahko aplicira sam, če pa iz kakršnih koli vzrokov to ni mogoče, zato poskrbi ustrezno usposobljena oseba. Če ni druge možnosti, bolnik obišče najbližjo ambulanto, da mu zdravilo aplicirajo tam. 98 V fazi indukcijskega zdravljenja je bila dovoljena vzporedna terapija s standardnimi zdravili, v primerih, da je bil odmerek posameznih zdravil stabilen zadnja dva meseca. V našem primeru smo imunosupresive ukinili takoj po začetnih odmerkih ADA, KSi pa smo postopoma zniževali po 4 mg na teden, z začetkom 14 dni po uvedbi zdravljenja z ADA. Bolniki brez vzporedne terapije so bili tisti, ki so prekinili z vsemi drugimi zdravili pred prvim apliciranim odmerkom ADA. Tekom terapije ni bilo dovoljeno nobeno cepljenje s cepivi z atenuiranimi mikroorganizmi. Prvi odziv na terapijo naj bi se pojavil približno po 2 tednih. Če v tem času ni odziva, se s terapijo nadaljuje še 12 tednov, če pa tudi po tem času ni učinka, se je treba odločiti za prekinitev zdravljenja Odziv na terapijo Uspešnost terapije smo ocenjevali z vprašalnikom IBDQ, laboratorijskimi preiskavami in oceno terapevta. Vprašalnik so bolniki izpolnili prvič pred pričetkom terapije, potem pa po 4, 12, 20 in 30 32

41 tednih zdravljenja. Ob teh terminih je bolnik obiskal ambulanto, kjer ga je vsakič pregledal terapevt, ki je ocenil bolnikovo klinično stanje. Pred uvedbo ADA 8 tednov po uvedbi ADA Slika 5: Endoskopske in histološke spremembe pri bolniku pred in po 8 tednih po uvedbi ADA. Uspešen pokazatelj učinka zdravljenja je biokemijski parameter CRP, saj upadanje njegove vrednosti zelo dobro korelira z učinkovitostjo terapije. Terapijo smo smatrali kot uspešno, če se je vrednost CRP 95, 99 zmanjšala za 25% glede na začetno stanje pred zdravljenjem oz. je CRP padel pod 3 mg/l. IBDQ vprašalnik smo izbrali zato, ker ima zelo širok nabor vprašanj in smo zato lažje zaznali manjše spremembe v učinkovitosti zdravljenja. Vrednosti CDAI pa smo preračunali po korelacijski formuli iz IBDQ. Bolnik je izpolnil vprašalnik tik pred apliciranjem naslednjega odmerka zdravila. Vprašalnik zraven splošnih podatkov o bolniku, časovnem statusu zdravljenja, teži, številu iztrebljanj na dan, zajema še 32 vprašanj v štirih podskupinah: vprašanja glede simptomov povezanih s črevesjem (odvajanje, abdominalna bolečina,...), sistemska funkcija (utrujenost, vzorec spanja, ), socialna funkcija (zmožnost dela, socialno udejstvovanje, ), čustveni status (jeza, depresija, razdraženost, ). Odgovor na vsako vprašanje se ovrednoti s številom točk od 1 do 7, odvisno od bolnikovega stanja. Točkovni obseg je med 32 in 224 točkami in višji kot je seštevek, boljša je kvaliteta življenja oz. boljši je učinek zdravljenja. Skupni IBDQ je vsota odzivov na vsako od 32 vprašanj. Bolniki z remisijo imajo IBDQ med 170 in 190 točkami. O pozitivnem odzivu na zdravljenje govorimo v primeru, ko je razlika med dvema vprašalnikoma vsaj 22 točk. 62 Vprašalnik je priložen (Priloga 2). Posamezni sklopi odgovorov so se nanašali na pogostnost pojavljanja nekega problema (nikoli, skoraj nikoli, tu in tam, občasno, nekaj časa, večino časa, skoraj ves čas, ves čas), glede na velikost problema (zelo velik problem, dokaj velik problem, velik problem, problem, majhen problem, skoraj brez problemov, brez problemov), glede na količino (nič, zelo malo, malo, nekaj, veliko, zelo veliko). 33

42 Poseben problem pri uporabi vprašalnika so predstavljali bolniki s stomo. Tu bi lahko prišlo pri določenih vprašanjih do nerealnih odgovorov, zato smo nekatera vprašanja prilagodili. Najpomembnejše pa je bilo ohraniti število vprašanj, saj bi lahko v nasprotnem primeru prišlo do nerealnih vrednosti vprašalnika in s tem do nerealnega dejanskega stanja. Delno modificirana so bila samo štiri vprašanja. Nanašala so se predvsem na vprašanja v zvezi z iztrebljanjem, konsistenco blata, pojavljanje vetrov in občutka siljenja na blato. Način izpolnjevanja, vrednotenje in interpretacija rezultatov je ostala enaka kot pri ostalih bolnikih. Vprašalnika IBDQ smo se poslužili iz razloga, ker je bolj občutljiv in je sposoben zajeti tudi zelo majhne spremembe v napredku zdravljenja. Bolniki, pri katerih je bolezen trajala več let ali desetletij, so namreč tako navajeni živeti s težavami, da pri njih z ostalimi vprašalniki majhnih sprememb v napredku terapije ne bi zaznali. Delta IBDQ smo izračunali za vsakega bolnika za vsako obdobje, ko je izpolnil vprašalnik. Na osnovi podatkov IBDQ lahko izračunamo vrednosti tudi za drugi najbolj pogosto uporabljeni vprašalnik, to je CDAI ( CDAI = (201 IBDQ)/ 0,21). Iz enačbe vidimo, da porast IBDQ pomeni padec CDAI. Višja je vrednost CDAI, slabše je stanje bolnika. 62, 100, 101 O remisiji govorimo takrat, ko je vrednost CDAI pod 150. Pri IBDQ pa nad Odvzem krvnih vzorcev in vzorcev tkiv za izolacijo DNA/RNA/proteinov Pred aplikacijo prvega odmerka ADA smo bolnikom odvzeli kri za laboratorijske in genetske preiskave. Laboratorijske preiskave smo opravili v Centralnem laboratoriju UKC Maribor, delna priprava vzorcev pa je bila opravljena že na gastroenterološki kliniki v UKC Ljubljana, saj so morali biti deli procedure priprave vzorca izvedeni takoj po odvzemu krvi. Laboratorijske preiskave smo razdelili na hematološke, biokemijske in imunološke. Od hematoloških parametrov smo kontrolirali: K-Lkci, K- Erci, K-Hb, MCV (Ht/št.eritrocitov/L), T-trombociti, MCH (Hb/št.eritrocitov/L) in MCHC (Hb/Ht). Od biokemijskih preiskav smo izvajali meritve: CRP (C-reaktivni protein), S-bil.c (serumski bilirubin celokupni), S-bil.d. (serumski bilirubin direktni), AST (aspartat aminotransferaza), ALT (alanin aminotransferaza), γgt, S-alkalna fosfataza, sečnina, kreatinin, Na, K, kloridi, železo, transferin, feritin, albumin in proteini. Od imunoloških preiskav pa: ASCA (anti-saccharomyces cerevisiae antibody), ANCA (anti-neutrophil cytoplasmic antibody), PAB (polyclonal antibody), protitelesa proti zaviralcem TNF-alfa. Celoten sklop preiskav smo ponovili v 4., 12., 20. in 30. tednu zdravljenja. 34

43 Vsem bolnikom s potrjeno CB, ki so pristali na sodelovanje v raziskavi, smo odvzeli vzorce krvi za izolacijo DNA/RNA in proteinov pred terapijo, ter 4., 12., 20. in 30. teden po terapiji, bolnikom z endoskopsko preiskavo pa še vzorec zdravega in bolnega tkiva črevesne sluznice. Za genetske preiskave smo odvzeli 9 ml venozne krvi, jo razdelili v tri epruvete po 3 ml z antikoagulantom EDTA. Epruvete smo opremili s podatki o bolniku in časovnem statusu terapije. Vzorce krvi smo, kakor hitro je bilo mogoče, dostavili v Center za humano molekularno genetiko in farmakogenomiko Medicinske fakultete Univerze v Mariboru. Vzorci so bili ves čas shranjeni na temperaturi okrog +4 C. V laboratoriju smo kri iz epruvete z EDTA prenesli v 50 ml falkonko, dodali PBS pufer (enako količino kot je bilo krvi), premešali in nanesli na Ficoll, tako da smo iz krvi pridobili limfocite. Le te smo shranili na -80 C za nadaljnjo izolacijo DNA in RNA. Za biokemijske preiskave smo odvzeli kri v enakih časovnih presledkih kot za genetske preiskave. Kri za biokemijske preiskave smo ločili na tri segmente. Prvega za določitev osnovnih parametrov krvne slike, drugega za biokemijske preiskave in tretjega za imunološke preiskave. Za krvno sliko smo vzorec dali v epruveto z antikoagulantom in shranili na +4 C. Vzorec krvi za biokemijske preiskave smo dali v epruveto z gelom brez antikoagulanta in pustili stati na sobni temperaturi 15 minut. Po petnajstih minutah smo vzorec 10 minut centrifugirali pri 3500 obratih. Vzorec krvi za imunološke preiskave smo dali v epruveto brez antikoagulanta in brez gela. Vzorec smo pustili stati 15 minut na sobni temperaturi. Po tem času smo vzorec centrifugirali 10 minut pri 3500 obratih. Tekočo fazo smo previdno odlili v drugo epruveto, označili in shranili na hladnem pri +4 C. Vse vzorce smo dostavili v biokemijski laboratorij UKC Maribor, kjer so opravili zahtevane analize. Ves čas transporta smo vzorce hranili na hladnem. Seznam biokemijskih preiskav je prikazan v Tabeli 8. 35

44 Tabela 8: Preiskave, ki so bile narejene v biokemijskem laboratoriju. PARAMETER OPIS ENOTA REF. VREDNOST HEMATOLOŠKE PREISKAVE K-Lkci Levkociti 10 9 /L 4,0-10,0 K-Erci Eritrociti /L 4,2-6,3 K-Hb hemoglobin g/l Ht (Hematokrit) MCV =Ht/št.eritrocitov/L MCH =Hb/št.eritrocitov/L MCHC =Hb/Ht Volumski delež krvničk v krvi in je posredno merilo za viskoznost krvi / 0,37 0,54 Povprečni celični volumen (cel=eritrocit) fl Povprečni celični hemoglobin pg Povprečna celična koncentracija hemoglobina g/l K-T Trombociti 10 9 /L BIOKEMIJSKE PREISKAVE CRP C reaktivni protein mg/l 0-5 S-bil.c. serumski bilirubin celokupni µmol/l 0-17 S-bil.d. serumski bilirubin direktni µmol/l 0-5 AST (SGOT) ALT (SGPT) aspartat transaminaza ali serumska glutaminsko oksaloacetilna transaminaza alanin transaminaza ali serumska glutaminsko piruična transaminaza µkat/l do 0,58 µkat/l do 0,74 S-γGT gama-glutamil transferaza µkat/l do 0,92 S-alk. fosfataza alkalna fosfataza µkat/l 0,65-1,95 S-sečnina (urea) Sečnina Mmol/L 2,8-7,5 S-kreatinin kreatinin µmol/l S-Na natrij mmol/l S-K kalij mmol/l 3,8-5,5 S-klorid kloridi mmol/l S-železo železo µmol/l 10,7-28,6 S-transferin transferin g/l 2,0-3,8 IMUNOLOŠKE PREISKAVE ASCA (anti-saccharomyces cerevisiae antibody) protitelo proti Saccharomyces cerevisiae ANCA (anti-neutrophil cytoplasmic antibody) PAB (polyclonal antibody) protitelesa proti zaviralcem TNF-α antinevtrofilno citoplazemsko protitelo s perinuklearno razporeditvijo poliklonsko protitelo Eden najpomembnejših parametrov biokemijskih preiskav je vrednost CRP (C-reaktivni protein), ki je zelo dober pokazatelj vnetnih procesov in obenem v našem primeru sorazmerno dober napovednik uspešnosti terapije. CRP je praviloma precej povišan pri CB, še posebej v fazah zagona bolezni. S spremljanjem vrednosti CRP skupaj z IBDQ ter kliničnim pregledom lahko ocenimo uspešnost terapije 36

45 z ADA. Kot vse ostale biokemijske parametre smo tudi CRP določali vsakič pred začetkom terapije, ter 4, 12, 20 in 30 tednov po terapiji. Padec CRP vrednosti za več kot 25% pomeni pozitivni odziva na 61, 95, 99, 102, 103 terapijo. Padec CRP pod vrednost tri pomeni normalizacijo vnetnega procesa. Vzorce tkiva smo vzeli samo v primerih, ko je bila endoskopska preiskava medicinsko indicirana, saj KME ni dovolila rutinskih odvzemov tkivnega vzorca samo zaradi študije. V takih primerih smo odvzeli še vzorec zdravega in bolnega tkiva za določitev ekpresijskih faktorjev, da bi z njimi poskusili napovedati uspešnost terapije. Odvzeti delček tkiva smo po biopsiji takoj prenesli v epruvetke, tako da je raztopina stabilizatorja (RNAlater) v celoti prekrila tkivo. Volumen raztopine je bil najmanj petkratni volumen vzorca. Vialo z vzorcem smo dobro pretresli, da je raztopina povsem obdala vzorec tkiva. Vialo smo opremili z oznako bolnika, datumom odvzema in terminskim obdobjem zdravljenja. Vzorce smo najprej za 24 ur shranili na +4 C, da je raztopina v zadostni meri difundirala v tkivo. Po 24 urah smo vzorec shranili v zamrzovalnik na -20 C Genotipizacija izbranih polimorfizmov SNP Izbrane polimorfizme SNP smo genotipizirali s tehniko polimorfizmov dolžin restrikcijskih fragmentov (RFLP) oziroma smo v primeru, da za določen polimorfizem ni bil na voljo restrikcijskega encima, ki bi razlikoval med obema genotipoma, uporabili tehniko TaqMan. Pri tehniki RFLP smo najprej z verižno reakcijo s polimerazo (PCR) pomnožili odsek DNK, ki je vseboval iskan polimorfizem SNP nato pa PCR produkt čez noč (ca. 16 ur) inkubirali v prisotnosti restrikcijskega encima. Zaporedja začetnih oligonukleotidov, velikosti pomnoženih produktov, uporabljeni restrikcijski encimi za posamezen polimorfizem SNP in velikosti produktov po delovanju restrikcijskega encima, so prikazane v tabeli 9. 37

46 Tabela 9: Zaporedja začetnih oligonukleotidov, velikosti pomnoženih produktov, uporabljeni restrikcijski encimi za posamezen polimorfizem SNP in velikosti produktov po delovanju restrikcijskega encima. Gen rs oznaka velikost prednji začetni reverzni začetni restrikcijski polimorfizma produkta oligonukleotid oligonukleotid encim SNP (bp) NOD2 rs TTCCTGGCAGGGCTGTTGTC AGTGGAAGTGCTTGCGGAGG 133 Msp I NR1/2 rs CTTGTTTATAGCCACTTGTGAGT AATATGTATGCTTGCGTATGTTT 238 HpyF3 I SLC22A4 rs GAGAGTCCTCCTATCTGATTG TAGCTATTCTTCCATGCTTAT 250 Mnl I IL23R rs TCTGCCAATTCCCTAAAC AAGTAGGTGTGGATTGCC 259 HpyF3 I SLC22A5 rs GTTATCACAGGACTTGTTTGT GAGGTCAACATTCTTCTCATA 249 BseL I IL4R rs TCTCGGCCCCCACCAGTGGCGATC GAGGTCTTGGAAAGGCTTATAC 209 Pvu I NOD2 rs GGTCCACTTTGCTGGGACCA TCACCCAAGGCTTCAGCCAG 223 Hha I NOD2 rs CTGGCTAACTCCTGCAGT ACTGAGGTTCGGAGAGCT 217 Nla IV ATG16L1 rs CCACTGCTGCATTTGAAG AATGGAGCCAGACAAAGTAG 308 Tru I/Mse I CTLA4 rs CACCACTATTTGGGATATACC AGGTCTATATTTCAGGAAGGC 216 Nco I Velikosti fragmentov po restrikciji (bp) CC: CT: TT: AA: AC: CC: 238 CC: TT: CT: TT: GT: GG: 259 CC: GG: 249 CG: AA: 209 AG: GG: CC: CG: GG: 223 C: C/-: : CC: 308 CT: TT: AA: 196 AG: GG:

47 PTPN22 rs TCACCAGCTTCCTCAACCAC CTGATAATGTTGCTTCAACGG 217 Rsa I Tas I PTGER4 rs CTATTTAGCTCATCCACAC ATTCAGTCATGGAATCTGC 189 (Tsp509 I) ORMDL3 rs GGGATACTCAAACTGTATCTTTCC GTAGCATCAACATGTCATTAGAAG 200 Nco I NKX2-3 rs GCCAGAAGGCGTGTAGGTAGAG TTTGTTGACTGCATTGGTGGTG 186 Aci I IL4 rs TAGAGATATCTTTGTCAGCATT AGACCCATTAATAGGTGTCG 94 Mnl I DLG5 rs CGCAATTACTACCTCTTGTCAG AAGCCAACAGCTCAGGACAG 256 Cfr10 I IL12B rs TTTCAGCGTGAGACCATTCA CCCCTAGGTCACAAGCGTAG 245 Hph I Fas rs CTACCTAAGAGCTATCTACCGTTC GGCTGTCCATGTTGTGGCTGC 332 Mva I IL12RB1 rs GGACAATTCTTACGGCCTGA TCTAATGCTTGCCCCTGTTC 203 Pvu II Nru I CASP9 rs GGCCTGGAGTCTTAGTTGGCTA CACCCGACTAAGAGGTGTTTGG 310 (Bsp68I) TNFSF15 rs CACTAAGAAGTTACAGAGCCTGGG CCTGAATCTATCACTGTGCCTATC 157 Tsp509 I TIMP-1 rs4898 GCACATCACTACCTGCAGTC GAAACAAGCCCACGATTTAG 175 Alw26 I c110rf30 rs CTTGCAGCTAAGAGAGCCAAGG TGAGCCTCAGTTTCCTCATGGT 196 Tsp509 I AA: 217 AG: GG: AA: AG: GG: 189 AA: GG: 200 AG: CC: CT: TT: 185 CC: CT: TT: 94 CC: 128 CT: TT: 256 CC: CG: GG: CC: CT: TT: AA: AG: GG: 203 CC: 310 CT: TT: AA: AG: GG: CC: CT: TT: 175 CC: 198 CT: TT:

48 AA: 216 ECM1 rs13294 ATGCTGTGAAGACCCACCAC GGAAGAGAGTGGGGAAGGAC 216 BsiE I AG: GG: FCGR3A rs Kaspar (Kbiosciences) AA: CCNY rs TTCAGACACCTACAGCCCTCT AAATGCCCTCAAGCAATGAA 220 Mae I SEPHS1 rs AAGGGGGCAAAAGAGAAATG CATCTGTCCGGAACTTGTGG 184 Rsa I 10q21 rs GCTAAGGATGCTGTGCCTTG CACTGGTTAGCAAAACCCTCTT 214 Mse I 10p11.2 rs AGACCTTCAGGCCCCAGTT GCAGTAGGCTGCCAGATCA 246 Mbo II IL13 rs CCACCTCGATTTTGGTGTCT ACTCCTACCTGGGCCTCAAT 215 Eco72 I IL10 rs AGCCACCAGACAAATGTGAG AACCGAAGTGAGTCAGGTCT 230 Alw26 I IL27 rs AAGTCCTGTGGCTGATGTTG GCATCCACGGCTAGTTCAAA 203 Hph I TNFRSF14 rs ACAGGACAGGGAGAGCACAG CAGTTTAGGGCTGGGGTTG 243 Alw26 I IL12A rs GGCCCATCATACTCCAGAAA CTGAGCAGGCATCATCTGAA 220 Rsa I AC: CC: CC: CT: TT: AA: AG: GG: CC: 246 CT: TT: AA: 215 AG: GG: CC: 230 CT: TT: CC: CT: TT: 203 CC: CT: TT: 243 AA: 220 AG: GG: Produkte reakcij PCR in RFLP smo preverili z agarozno gelsko elektroforezo. Uporabili smo 2 % agarozni gel, za katerega smo natehtali 0,8 g agaroze in jo raztopili v 40 ml 1 x TBE pufra v erlenmajerici. Zmes smo segrevali v mikrovalovni pečici, da se je agaroza popolnoma raztopila ter dodali 4 µl etidijevega bromida. Tako pripravljeno raztopino smo vlili v predhodno pripravljen nosilec z glavnički. Ko se je gel strdil, smo odstranili glavniček ter gel potopili v elekroforezno banjico 40

49 napolnjeno z 1 x TBE pufrom. Vzorce smo nanesli v žepke, ki smo jih predhodno pomešali s 3 µl barvila (0,25 % ksilencianol s 40 % saharozo). Elektroforeza je tekla pri konstantni napetosti 150 V od 10 do 20 min. Agarozni gel smo po končani elektroforezi analizirali na UV transiluminatorju ter določili genotipe Merjenje izražanje izbranih genov z verižno reakcijo s polimerazo v realnem času (qpcr) Izolirano RNK smo uporabili za določanje izražanja izbranih genov s tehniko PCR v realnem času (qpcr), ki omogoča sočasno detekcijo in kvantifikacijo PCR produkta. Z reverzno transkriptazo (High Capacity cdna Reverse Transcription Kit, Applied Biosystems) smo RNK molekule prepisali v cdnk molekule. Vhodna količina RNK v prepis je bila 10 g. Sestava reakcijske mešanice za prepis je prikazana v tabeli 9. Prepisovanje je potekalo po naslednjem temperaturnem protokolu v cikličnem termostatu T1 (Biometra): 10 min pri 25 C, 120 min pri 37 C, 5 s pri 85 C, nato je sledilo hlajenje na 4 C. Tabela 10: Sestava reakcijske mešanice za prepis RNK v cdnk. Količina/reakcijo Komponenta [ L] 10 x RT Buffer 2,0 25 x dntp Mix (100 mm) 0,8 10 RT Random Primers 2,0 MultiScribe TM Reverse Transcriptase 1,0 Nuclease-free H2O 4,2 RNA* 10 Skupaj 20,0 *vhodna koncentracija RNA je bila 1 mgv 10 L. Nadalje smo s tehniko kvantitativnega PCR v realnem času na aparaturi LC480 (Roche) izmerili količino izraženega gena. Sestava reakcijske mešanice za qpcr je bila naslednja: 5 L Maxima SYBR Green qpcr Master Mix (Fermentas), 2 L cdna, začetni in reverzni začetni oligonukleotid (količina določena z optimizacijo) ter H2O do končnega volumna 10 L. Vsak vzorec smo ponovili v duplikatih, 41

50 pri čemer smo pri izračunih upoštevali povprečno vrednost obeh ponovitev. Za relativno kvantifikacijo analiziranih genov smo uporabili dva referenčna gena, ki se konstantno izražata v vseh celicah (B2M in GAPDH) ter glede na ta dva gena ovrednotili izražanje izbranih genov. Količino RNK smo določili z metodo relativne kvantifikacije, pri kateri tarčni gen kvantificiramo relativno na referenčni gen, ki se konstantno izraža v vseh celicah. Tako imenovana 2 -ddct metoda se uporablja za izračun relativnih sprememb v izražanju genov, ki jih določimo iz PCR reakcij v realnem času. Pri izračunu potrebujemo vrednost Ct (ang. za threshold cycle), to je število ciklov, pri katerem količina pomnoženega tarčnega gena doseže prag fluorescence (2;3). Nivo izražanja genov po tej metodi smo izračunali v naslednjih korakih. Najprej izračunamo razliko med Ct (tarčni gen) in Ct (referenčni gen), kar predstavlja vrednost Ct. Kot kalibrator smo izbrali povprečno vrednost vseh meritev, tako da smo v naslednjem koraku izračunali vrednost Ct kot razliko med Ct in Ct (povprečni). Relativno količino izraženega gena smo nato v tretjem koraku izrazili kot 2 - Ct (2). Merili smo izražanje 5 genov. Začetni oligonukleotidi in njihova temperatura pripenjanja so prikazani v tabeli 11. Tabela 11: Zaporedja začetnih oligonukelotidov za merjenje izražanja genov izbranih genov ter njihove temperature pripenjanja. Gen mrna prednji začetni oligonukleotid reverzni začetni oligonukleotid Temperatura pripenjanja ( C) SLC22A5 NM_ GTGCTGCCACTGTTTGCTTA GGGGGACTCAGGGATGAA 60 ATG16L1 NM_ GGAGATGCAGATGAATGAAGC GCTTAGTGCGCAGGTCTAGG 51 CCNY NM_ AGTCCTACCGGCCAGACAC CGAGGATGATCTGAAGGATTG 56 ECM1 NM_ AGCTGGAGAGGGAGTTCCA GGTCACAGTATTTGTCAAGGGTATC 60 ORMDL3 NM_ TCACCAACCTCATTCACAACA CAAAGGGTGTCCCCTTCAC Statistična analiza Za statistično analizo podatkov smo uporabili statistični program SPSS 17.0 (SPSS Inc., Chicago, USA). Pri primerjavi odziva na zdravljenje glede na kategorične klinične podate (spol, operacija, lokacija, obnašanje bolezni, kajenje, vzporedna terapija) in glede na genotipe izbranih SNP-jev, smo uporabili dvostranski Fisherjev natančni test. Pri primerjavi starosti ob diagnozi kot kategorične spremenljivke 42

51 (A1, A2 in A3) med kontinuirnimi kliničnimi podatki (IBDQ, deltaibdq, CRP in deltacrp), smo uporabili v primerih normalne porazdelitve podatkov (Kolmogorov-Smirnov test p > 0.05) test ANOVA, v primerih nepravilne porazdelitve podatkov (Kolmogorov-Smirnov test p < 0.05) pa Kruskal-Wallis test. Pri primerjavi kontinuirnih kliničnih podatkov (IBDQ, deltaibdq, CRP in deltacrp) med različnimi genotipi (dominantni in recesivni model) in aleli smo uporabili t-test za neodvisne vzorce v primerih normalne porazdelitve podatkov (Kolmogorov-Smirnov test p > 0.05) oziroma v primeru nepravilne porazdelitve podatkov (Kolmogorov-Smirnov test p < 0.05)Mann-Whitney U-test. 43

52 4. REZULTATI 4.1. Učinkovitost zdravljenja z ADA Terapijo smo začeli s 160 mg odmerkom, čez 14 dni nadaljevali z 80 mg odmerkom in potem vzdrževali zdravljenje z 40 mg odmerkom vsakih 14 dni. Odgovor na zdravljenje z ADA smo merili z uporabo IBDQ vprašalnika (klinični odgovor) in z merjenjem C-reaktivnega proteina (CRP) v krvi bolnikov (biološki odgovor) po 4, 12, 20 in 30 tednih zdravljenja. Po 4 tednih zdravljenja je bila vrednost IBDQ v skupini bolnikov, ki so imeli pozitiven odgovor na zdravljenje z ADA, 188 točk, v primerjavi z bolniki, ki niso odgovarjali na zdravljenje z ADA in so imeli povprečno vrednost IBDQ 138 točk. Po 12, 20 in 30 tednih zdravljenja je bila vrednost IBDQ v skupini bolnikov, ki so imeli pozitiven odgovor na zdravljenje z ADA, 191, 194 in 189 točk, medtem ko je bilo v skupini bolnikov, ki niso odgovarjali na zdravljenje z ADA, vrednost IBDQ 136, 138 in 141 točk. Po 4, 12, 20 in 30 tednih je na zdravljenje z ADA imelo pozitiven odgovor 63, 68, 66 in 71% bolnikov, saj je njihova IBDQ vrednost znašala 170 točk ali več pa je njihov IBDQ porastel za več kot 22 točk. Petim bolnikom smo morali po 12 tednih ukiniti aplikacijo ADA, ker ni bilo nobenega pozitivnega odziva na zdravljenje. Vrednosti IBDQ pred terapijo ter vrednosti IBDQ in deltaibdq po 4, 12, 20 in 30 tednih po terapiji, so prikazane v tabeli 12. DeltaIBDQ je računana kot razlika v IBDQ vrednosti med n tednom zdravljenja (n = 4, 12, 20 ali 30) in vrednostjo IBDQ pred terapijo (višji deltaibdq pomeni boljši odziv). Gibanje IBDQ vrednosti ter deltaibdq po tednih zdravljenja pri vseh bolnikih ter med bolniki z dobrim in slabim odzivom je prikazano na Sliki 7 in 8. Tabela 12: Vrednosti IBDQ pred terapijo ter vrednosti IBDQ in deltaibdq po 4, 12, 20 in 30 tednih po terapiji. IBDQ pred terapijo IBDQ 4 tedne po terapiji delta IBDQ 4 tedne po terapiji IBDQ 12 tednov po terapiji delta IBDQ 12 tednov po terapij IBDQ 20 tednov po terapij delta IBDQ 20 tednov po terapij IBDQ 30 tednov po terapij delta IBDQ 30 tednov po terapij Vsi bolniki 152,42 169,48 17,06 173,36 20,93 175,08 22,70 175,43 23,01 Dober odziv 158,59 188,17 29,58 191,06 35,16 193,93 37,36 189,50 36,25 Slab odziv 141,97 137,82-4,15 135,67-9,36 138,54-5,74 140,77-9,62 44

53 Slika 6: Gibanje vrednosti IBDQ po tednih pri vseh bolnikih ter pri bolnikih z dobrim in pri bolnikih s slabim odzivom. Slika 7: Gibanje vrednosti deltaibdq po tednih pri vseh bolnikih ter pri bolnikih z dobrim in pri bolnikih s slabim odzivom. 45

54 Pred začetkom zdravljenja je mediana CRP v krvi vseh bolnikov znašala 10 mg/l. Po 4 tednih zdravljenja je CRP v skupini bolnikov, ki so imeli pozitiven odgovor na zdravljenje z ADA, padel na 3 mg/l, medtem ko se je pri bolnikih, ki niso odgovarjali na zdravljenje z ADA, po 4 tednih zdravljenja CRP povečal na 26,5 mg/l. Po 12, 20 in 30 tednih zdravljenja je bila koncentracija CRP pri bolnikih, ki so imeli pozitiven odgovor na zdravljenje, 2, 2 in 2,5 mg/l, medtem ko je bila pri bolnikih, ki niso odgovarjali na zdravljenje z ADA, 14, 23 in 19 mg/l. Po 4, 12, 20 in 30 tednih je na zdravljenje z ADA imelo pozitiven biološki odgovor 83, 72, 73 in 72,5% bolnikov, saj je CRP vrednost padla na < 3 mg/l ali pa je bil relativni padec CRP večji od 25%. Vrednosti CRP pred terapijo ter vrednosti CRP in deltacrp po 4, 12, 20 in 30 tednih po terapiji, so prikazane v tabeli 12. DeltaCRP je računana kot razlika v CRP vrednosti pred terapijo in vrednostjo CRP v tednu n (n = 4, 12, 20 ali 30) (višji deltacrp pomeni boljši odziv). Slika 9 in 10 prikazujeta gibanje CRP in deltacrp po tednih zdravljenja. Tabela 13: Vrednosti CRP pred terapijo ter vrednosti CRP in deltacrp po 4, 12, 20 in 30 tednih po terapiji. CRP pred terapijo CRP 4 tedne po terapiji delta CRP 4 tedne po terapiji CRP 12 tednov po terapiji delta CRP 12 tednov po terapiji CRP 20 tednov po terapiji delta CRP 20 tednov po terapiji CRP 30 tednov po terapiji delta CRP 12 tednov po terapiji Vsi bolniki 19,48 12,42 10,42 11,15 7,38 10,6 5,14 12,55 4,27 Dober odziv 20,10 6,81 13,29 4,08 12,48 4,35 9,77 3,84 9,61 Slab odziv 21,62 24,87-3,25 24,62-5,69 23,54-7,21 33,82-9,81 Slika 8: Gibanje vrednosti CRP po tednih pri vseh bolnikih ter pri bolnikih z dobrim in pri bolnikih s slabim odzivom. 46

55 Slika 9: Gibanje vrednosti deltacrp po tednih pri vseh bolnikih ter pri bolnikih z dobrim in pri bolnikih s slabim odzivom. Klinični odgovor na zdravljenje (merjen z IBDQ) se ni popolnoma ujemal z biološkim odgovorom (merjenim s CRP), vendar smo kljub temu ugotovili signifikantno povezavo med obema odgovoroma na zdravljenje z ADA (R 2 =0,962, Slika 11). Slika 10: Korelacija med IBDQ in CRP vrednostjo. 47

56 Po 4 tednih zdravljenja je bilo v remisiji 51,5% bolnikov, po 12 tednih zdravljenja 60,8% bolnikov ter po 20 in 30 tednih zdravljenja 59,8% bolnikov (Slika 11). Slika 11: Delež bolnikov v remisiji po 4, 12, 20 in 30 tednih zdravljenja z ADA. Fistule so se pri večini zelo dobro zapirale. V dveh primerih je prišlo zaradi tega celo do zapleta, saj se je fistula iz zunanje strani zapirala prehitro, v notranjosti bila še vedno dejavna. Zaradi tega se je nakopičila velika količina eksudata, tako da je bil potreben operativni poseg Vzporedna terapija V fazi indukcijskega zdravljenja je 60 bolnikov prejemalo vzporedno terapijo z zdravili iz skupine aminosalicilatov, antibiotikov ali KSi. Imunosupresive smo ukinili takoj po aplikaciji prvega odmerka. KSi smo postopno zniževali - po 4 mg na teden, z začetkom 14 dni po uvedbi zdravljenja z ADA. Tekom terapije ni bil nobeden bolnik deležen nobenega cepljenje s cepivi z atenuiranimi mikroorganizmi. Pediatričnih bolnikov v študijo nismo vključevali, zato tudi nismo prilagajali odmerkov glede na težo in starost bolnikov. 48

57 Neželeni učinki Med samo študijo nismo ugotovili nobenega hujšega neželenega učinka. Pri štirih bolnikih se je pojavila infekcija spodnjih in zgornjih dihal ter ena okužba z virusom Herpes simplex. Nadalje smo pri 8 bolnikih ugotovili reakcijo na mestu injiciranja zdravila, v obliki rdečine, otekline in srbenja ter pri 11 bolnikih glavobol in bolečine v mišicah in sklepih. Samo pri enem bolniku je prišlo pri prvi aplikaciji do sistemskih neželjenih učinkov v obliki rahle anafilaksije, vendar je bilo že pri naslednji aplikaciji veliko manj izraženo, pri nadaljnjih aplikacijah pa toglednih neželjenih učinkov več ni bilo. Resnejših infekcij, kot posledica zdravljenja z ADA pa ni bilo. Pri enem bolniku je nastal sum komplikacij vida, vendar se je po detajlnih preiskavah izkazalo, da težave niso bile posledica ADA. Pri enem bolniku so se pojavili simptomi podobni tuberkulozi, zato smo zdravljenje prekinili Klinične značilnosti bolnikov s CB in povezava teh značilnosti z genotipi izbranih polimorfizmov SNP ter odzivom na zdravljenjem z ADA Montrealska klasifikacija bolnikov Skupno smo v študijo vključili 102 bolnika s CB, 5 bolnikov je bilo med študijo izločenih, tako da smo v analizo vključili 97 bolnikov, za katere smo imeli na voljo podatke o starosti, spolu, starosti ob diagnozi, lokaciji vnetja, obnašanju bolezni, operaciji, spremljajoči obliki bolezni s fistulami (Crohn fistulizirajoča bolezen), spremljajoči terapiji, družinski anamnezi in kajenju. Povprečna starost vseh bolnikov je znašala 41,1 +/- 11,9 let, med njimi pa je bilo 43,3% moških ter 56,7% žensk. Vse klinične značilnosti so povzete v tabeli

58 Tabela 14: Klinične značilnosti bolnikov s CB. Bolniki s CB Klinična značilnost (N = 97) Starost Povprečje +/- SD* 41,1 +/- 11,9 Spol Moški/Ženske (%) 43,3 / 56,7 A1 pod 17 let (%) 14,4 Starost ob diagnozi A2 med 17 in 40 let (%) 71,2 A3 nad 40 let (%) 14,4 L1 ileum (%) 17,5 Lokacija vnetja L2 kolon (%) 30,9 L3 ile-kolon (%) 51,5 L4 bolezen zgornjega prebavnega trakta (%) 2,1 B1 brez zožitev, brez fistul (%) 20,6 B1p brez zožitev, brez fistul perianalno (%) 13,4 Obnašanje B2 zožitve (%) 17,5 bolezni B2p zožitve in perianalne f.(%) 14,4 B3 fistule (%) 25,8 B3p fistule + perianalne f. (%) 13,4 Kajenje (%) 39,2 Operacija (%) ASA aminosalicilati (%) 45,4 Spremljajoča terapija kortikosteroidi (%) 35,1 imunosupresivi (%) 40,2 infliksimab (%) 20,6 Družinska anamneza (%) 38, Povezava kliničnih značilnosti z genotipi izbranih polimorfizmov SNP - opis statistično signifikantnih povezav V tabeli 15 so prikazane statistično signifikantne povezave in frekvence genotipov pri posamezni povezavi. Našli smo povezavo s polimorfizmi SNP v genih ECM1, ATG16L1, PUS10, IL4, SLC22A5 in CTLA4. Za polimorfizem SNP rs na genu IL4 smo našli povezavo s starostjo pri diagnozi in sicer so bili bolniki z genotipom CC starejši ob diagnozi (29 let) v primerjavi z bolniki z genotipom CT ali TT (23 let, p=2,04e-02). Za polimorfizem SNP rs na genu CTLA4 smo našli povezavo z 50

59 lokacijo vnetja in sicer je imelo le 6,1% bolnikov z genotipom GG vnetje v ileumu, medtem ko jih je 22,6% imelo genotip AA ali AG (p=4,69e-02). Tabela 15: Statistično signifikantne povezave med genotipi in kliničnimi značilnostmi. GEN/SNP Povezava Klinična značilnost p vrednost ECM1 AA proti AG+GG Družinska anamneza AA: DA 0,0%, NE - 100,0% AG+GG: DA 50,0%, NE 50,0% 1,33E-02 rs13294 AA+AG proti GG Družinska anamneza AA+AG: DA 32,4%, NE 67,6% GG: DA 83,3%, NE 16,7% 2,94E-02 ATG16L1 CC proti CT+TT Lokacija L2 CC: DA 47,8%, NE 52,2% CT+TT: 24,3DA - %, NE 75,7% 3,95E-02 rs CC+CT proti TT Lokacija L4 CC+CT: DA 0,0%, NE 100,0% TT: DA 9,7%, NE 90,3% 3,15E-02 IL4 rs CC proti CT+TT Starost ob diagnozi CC= 29 let, CT+TT= 23 let 2,04E-02 SLC22A5 rs CC+CG proti GG Obnašanje B3 CC+CG: DA 23,6%, NE = 76,4% GG: DA 80,0%, NE 20,0% 1,69E-02 CTLA4 rs AA+AG proti GG Lokacija L1 AA+AG: DA 22,6%, NE 77,4% GG: DA 6,1%, NE 93,9% 4,69E Povezava kliničnih značilnosti z biološkim in kliničnim odgovorom na zdravljenje z ADA - opis statistično signifikantnih povezav Nadalje smo primerjali klinične značilnosti glede na odziv, določen z IBDQ (klinični odziv) in CRP (biološki odziv). Statistično signifikantno povezavo smo našli med starostjo ob diagnozi in odzivom, merjenim z IBDQ, po 4 in 20 tednih zdravljenja. Mediana IBDQ po 4 tednih zdravljenja je bila 191 v skupini bolnikov, ki so bili diagnosticirani pred 17 letom starosti (skupina A1, n=14), 168 v skupini bolnikov, ki so bili diagnosticirali med 17 in 40 letom starosti (A2, n=69) in 169 v skupini bolnikov, ki so bili diagnosticirani po 40 letu starosti, (A3, n=14), p=4,46e-02. Delta IBDQ po 4 tednih zdravljenja je bila višja v skupini A1 (35) v primerjavi s skupino A2 (14) in A3 (15), p=2,80e-02. Isto gibanje smo opazili po 20 tednih zdravljenja z ADA. 51

60 Prav tako smo našli statistično signifikantno povezavo med spremljajočo terapijo s kortikosteroidi med zdravljenjem z ADA in odgovorom. Po 4 tednih zdravljenja so imeli bolniki, ki niso prejemali kortikosteroidov med zdravljenjem z ADA, višji IBDQ (178) v primerjavi s tistimi bolniki, ki so prejemali kortikosteroide (164, p=3,00e-02). Po 20 tednih zdravljenja je imelo pozitiven odgovor na zdravljenje z ADA 74,6% bolnikov, ki sočasno z ADA niso prejemali kortikosteroidov, medtem ko je imelo pozitiven odgovor na zdravljenje z ADA le 50% bolnikov, ki so sočasno prejemali kortikosteroide, p=2,39e-02, glede na IBDQ kriterij. Naslednjo povezavo smo našli glede na biološki odgovor po 4 tednih zdravljenja med bolniki, ki pred zdravljenjem z ADA niso prejemali IFX, med katerimi je 91,2% bolnikov imelo pozitiven odgovor na zdravljenje z ADA, in med bolniki, ki so pred zdravljenjem z ADA prejemali IFX, med katerimi je imelo 58,3% bolnikov pozitiven odgovor na zdravljenje z ADA (p=2,03e-02). Bolniki, ki pred zdravljenjem z ADA niso prejemali IFX, so po 4 tednih zdravljenja imeli nižjo vrednost CRP (3 mg/l) v primerjavi z bolniki, ki so pred zdravljenjem z ADA prejemali IFX (9 mg/l, P=2,05E-02). Povezavo smo našli tudi med kajenjem in odgovorom na zdravljenje z ADA in sicer je bilo v skupini nekadilcev 72,9% tistih, ki so imeli pozitiven odgovor na zdravljenje z ADA, v primerjavi s kadilci 52,6%. Ugotovili smo, da so imeli bolniki, ki so bili pred zdravljenjem z ADA operativno zdravljeni, boljši odziv na zdravljenje z ADA po 4 in 12 tednih zdravljenja. Delta IBDQ po 4 tednih zdravljenja je bila pri bolnikih s predhodno operacijo višja (23,3) v primerjavi z bolniki brez operacije (8,8, p=9,70e-03). Po 12 tednih zdravljenja smo isto obnašanje opazili glede na CRP kriterij, ko so bolniki s predhodno operacijo nižji CRP (2,75 mg/l) v primerjavi z bolniki brez operacije (6 mg/l, p=4,00e-02). Izkazalo se je, da so imele pred zdravljenjem z ADA, ženske nižjo vrednost IBDQ (146) v primerjavi z moškimi (161, p=1,22e-02), vendar je bil delta IBDQ po 20 tednih zdravljenja z ADA višji pri ženskah (30) v primerjavi z moškimi (13, p=9,53e-03), kljub temu pa se povprečni IBDQ po 20 tednih zdravljenja ni razlikoval med moškimi in ženskami. Vse statistično značilne povezave med kliničnimi značilnostmi in odgovorom na zdravljenje z ADA so prikazane v tabeli

61 Tabela 16: Statistično signifikantne povezave med kliničnimi značilnostmi ter kliničnim in biološkim odgovorom na terapijo. Klinična znadilnost Klinični in biološki odgovor na terapijo p vrednost Vključitveni kriterij Operacija Sočasno zdravljenje s kortikosteroidi Obnašanje (B2 - zožitve) Kajenje Predhodna terapija z Infliximabom CRP odgovor po 30 tednih zdravljenja 1,08E-02 delta CRP po 20 tednih zdravljenja 3,29E-02 ARCort = 5, RefSt = 1 delta IBDQ po 4 tednih zdravljenja 9,70E-03 Brez OP = 8,8, OP = 23,3 Povprečne (mediane) vrednosti IBDQ, deltaibdq, CRP in deltacrp ARCort: 28,6% slab odgovor, 71,4% dober odgovor RefSt: 81,8% slab odgovor, 18,2% dober odgovor delta IBDQ po 12 tednih zdravljenja 2,97E-02 Brez OP = 12,8, OP = 27,1 CRP po 12 tednih zdravljenja 4,00E-02 Brez OP = 6, OP = 2,75 IBDQ odgovor po 20 tednih zdravljenja 2,39E-02 Brez CORT: 25,4 slab odgovor, 74,6 dober odgovor Cort: 50 % slab odgovor, 50% dober odgovor IBDQ po 4 tednih zdravljenja 3,00E-02 Brez CORT = 178, CORT = 164 delta IBDQ po 4 tednih zdravljenja 4,31E-02 Brez B2 = 13,2, B2 = 25,3 delta CRP po 4 tednih zdravljenja 2,31E-02 Brez B2 = 5,5, B2 = 14 splošen odgovor 5,12E-02 IBDQ 4,00E-02 Kadilci: ni odgovora CRP odgovor po 4 tednih zdravljenja 2,03E-02 CRP po 4 tednih zdravljenja 2,05E-02 Brez IFX = 3, IFX = 9 Nekadilci: 27,1% slab odgovor, 72,9% dober odgovor Kadilci: 47,4% slab odgovor, 52,6% dober odgovor Brez IFX: 8,8% slab odgovor, 91,2% dober odgovor IFX: 41,7% slab odgovor, 58,3% dober odgovor Sočasna terapija z aminosalicilati delta CRP po 20 tednih zdravljenja 4,22E-02 Brez ASA = 5,5, ASA = 1,9 Sočasna terapija z imunosupresivi CRP po 12 tednih zdravljenja 1,35E-02 Brez IS = 5, IS = 2 Starost ob diagnozi (leta) Starost ob diagnozi (A1, A2, A3) IBDQ odgovor po 4 tednih zdravljenja 2,75E-02 mediana: dober odgovor = 23, slab odgovor = 26,5 IBDQ odgovor po 20 tednih zdravljenja 3,29E-02 mediana: dober odgovor = 23, slab odgovor = 27 IBDQ odgovor po 30 tednih zdravljenja 3,31E-02 mediana: dober odgovor = 23, slab odgovor = 27 delta IBDQ po 4 tednih zdravljenja 2,80E-02 povprečje: A1=35, A2=14, A3=15 delta IBDQ po 20 tednih zdravljenja 3,56E-02 povprečje: A1=43, A2=19, A3=22 IBDQ po 4 tednih zdravljenja 4,46E-02 mediana: A1=191, A2=168, A3=169 IBDQ po 20 tednih zdravljenja 1,24E-02 mediana: A1=201, A2=177, A3=181 splošen odziv 1,73E-02 A1: 92,9 % dober odgovor, A2+A3: 60,2 % dober odgovor 53

62 4.4. Povezava med izbranimi polimorfizmi SNP in biološkim ter kliničnim odzivom na zdravljenje Skupno smo našli 91 signifikantnih povezav (p<0,05) med 26 polimorfizmi SNP in odgovorom na zdravljenje. 18 najmočnejših povezav (p<0,01) za 8 kandidatnih genov je prikazanih v tabeli Povezava med polimorfizmom SNP rs (ATG16L1) in odgovorom na zdravljenje Najmočnejšo povezavo med biološkim odgovorom in zdravljenjem z ADA smo našli za SNP rs na genu ATG16L1. Po 12 tednih zdravljenja z ADA je 85% bolnikov z genotipom CT ali TT imelo pozitiven odgovor na zdravljenje, v primerjavi 37,5% bolnikov s CC genotipom (p=8,11e-04, Slika 12). Delta CRP po 12 tednih zdravljenja je bila višja pri bolnikih s CT ali TT genotipom (5 mg/l) v primerjavi z bolniki s CC genotipom (0,5 mg/l, p=1,79e-03). Višji delta CRP predstavlja boljši odziv. Signifikantno boljši odziv so imeli bolniki s TT genotipom tudi po 20 in 30 tednih zdravljenja. p = 8,11E-04 Slika 12: Bolniki z dobrim in slabim odgovorom na zdravljenje z ADA po 12. tednih zdravljenja glede na genotip SNP-ja rs v genu ATG16L1. 54

63 Povezava med polimorfizmom SNP rs (blizu gena PTGER4) in odgovorom na zdravljenje Ugotovili smo statistično signifikantno povezavo med polimorfizmom SNP rs , ki je lociran v genski puščavi blizu gena PTGER4 in kliničnim ter biološkim odgovorom na zdravljenje z ADA. Po 12 tednih zdravljenja je bil deltaibdq višji v skupini bolnikov z genotipom GG (47,6) v primerjavi s tistimi z genotipom AA ali AG (17,4, p=7,06e-03). Razlika se je statistično signifikantno razlikovala tudi po 30 tednih zdravljenja in sicer je deltaibdq pri bolnikih z genotipom GG znašala 34,2, pri bolnikih z genotipom AA ali AG pa 18, p=4,70e-02. Po 12 tednih zdravljenja so imeli vsi bolniki z genotipom GG (n=9) pozitiven odgovor na zdravljenje v primerjavi s 63,5% (n=85) bolnikov z genotipom AA ali AG (p=2,76e-02, Slika 13). p = 2,76E-02 Slika 13: Bolniki z dobrim in slabim odgovor na zdravljenje z ADA po 12. tednih zdravljenja glede na genotip SNP-ja rs v bližini gena PTGER4. Vrednost IBDQ je bila višja pri bolnikih z genotipom GG (202) v primerjavi z bolniki z genotipom AA ali AG (179, p=2,58e-02). Spreminjanje IBDQ vrednosti med zdravljenjem glede na genotip polimorfizma SNP rs je prikazano na sliki 14. Isto gibanje smo opazili tudi pri biološkem odgovoru, kjer je bil deltacrp po 12 tednih zdravljenja višji pri bolnikih z genotipom GG (4,25) v primerjavi z bolniki z genotipom AA (2,3), vendar statistične signifikantne razlike nismo dosegli (p=1,61e-01). 55

64 Slika 14: Gibanje IBDQ vrednosti po tednih zdravljenja glede na genotip SNP-ja rs v bližini gena PTGER4. 56

65 Tabela 17: Statistično najmočnejše povezave (p<0,01) med SNP-ji in odgovorom na ADA. Gen SNP Frekvenca genotipov Model Odgovor na terapijo p vrednost Povprečne (mediane) vrednosti IBDQ, deltaibdq, CRP in deltacrp ter frekvence genotipov CC vs. CT+TT deltacrp po 12 tednih zdravljenja 1,79E-03 deltacrp: CC=-0,5, CT+TT=5 ATG16L1 rs CC=24,5% CT=43,6% TT=31,9% CC vs. CT+TT deltacrp po 20 tednih zdravljenja 7,46E-03 deltacrp: CC=-1, CT+TT=4 C vs. T deltacrp po 12 tednih zdravljenja 2,12E-03 deltacrp: C=2, T=5 CC vs. CT+TT CRP odgovor po 12 tednih zdravljenja 8,11E-04 CC: 62,5% nr, 37,5% r; CT+TT: 15% nr, 85% r CC vs. CT+TT CRP odgovor po 20 tednih zdravljenja 4,05E-03 CC: 63,6% nr, 36,4% r; CT+TT: 15,2% nr, 84,8% r CASP9 rs CC=76,5% CT=13,6% TT=9,9% CC vs. CT+TT IBDQ po 4 tednih zdravljenja 8,95E-03 IBDQ: CC=164,5, CT+TT=190,3 C vs. T IBDQ po 4 tednih zdravljenja 6,91E-03 IBDQ: C=168, T=188 C vs. T deltacrp po 4 tednih zdravljenja 7,22E-03 deltacrp: C=3, T=18 PTGER4 rs AA=52,1% AG=38,3% GG=9,6% AA+AG vs. GG deltaibdq po 12 tednih zdravljenja 7,06E-03 deltaibdq: AA+AG=17,4, GG=47,6 A vs. G deltaibdq po 12 tednih zdravljenja 4,62E-03 deltaibdq: A=16, G=34,8 IL27 rs CC=23,7% CT=45,4% TT=30,9% CC vs. CT+TT CRP odgovor po 4 tednih zdravljenja 9,71E-03 CC: 40,0% nr, 60,0% r; CT+TT: 6,5% nr, 93,5% r C vs. T CRP odgovor po 4 tednih zdravljenja 5,56E-03 C: 28,9% nr, 71,1% r; T: 6,4% nr, 93,6% r C11orf30 rs CC=43,2% CT=44,2% TT=12,6% CC vs. CT+TT CRP po 20 tednih zdravljenja 5,83E-03 CRP: CC=2, CT+TT=5 C vs. T CRP po 20 tednih zdravljenja 7,86E-03 CRP: C=2, T=8,5 CCNY rs AA=12,0% AC=48,9% CC=39,1% AA+AC vs. CC CRP po 20 tednih zdravljenja 6,78E-03 CRP: AA+AC=5, CC=2 A vs. C CRP po 20 tednih zdravljenja 6,69E-03 CRP: A=12, C=2 NR12 rs AA=63,5% AC=27,1% CC=9,4% A vs. C deltacrp po 30 tednih zdravljenja 9,64E-03 deltacrp: A=2, C=6,6 IL13 Legenda: rs AA=4,9% AG=24,4% GG=70,7% AA vs. AG+GG deltaibdq po 20 tednih zdravljenja 6,07E-03 deltaibdq: AA=69,2, AG+GG=22,4 r dober odgovor na terapijo z ADA nr slab odgovor na terapijo z ADA 57

66 Povezave med ostalimi polimorfizmi SNP in biološkim ter kliničnim odgovorom na zdravljenje Ugotovili smo povezavo med polimorfizmom SNP rs na genu CASP9 in odgovorom na zdravljenje. Bolniki z genotipom TT ali alelom T so bolje odgovarjali na zdravljenje z ADA v primerjavi z bolniki z genotipom CC ali alelom C. DeltaCRP je bila po 4 tednih zdravljenja višja pri bolnikih z genotipom CT ali TT polimorfizma SNP rs (18 mg/l) ali alelom T (18 mg/l) v primerjavi z bolniki z genotipom CC (3 mg/l, p=2,44e-02) ali alelom C (2 mg/l, p=7,22e-03). Po 12 tednih zdravljenja so vsi bolniki z genotipom TT imeli pozitiven odgovor na zdravljenje z ADA v primerjavi z 72,5% bolnikov z genotipom CC ali CT. Naslednjo povezavo smo našli po 4 tednih zdravljenja med polimorfizmom SNP rs blizu gena IL27 in kliničnim ter biološkim odgovorom na zdravljenje. 93,5% bolnikov z genotipom CT ali TT je imelo pozitiven biološki odgovor na zdravljenje z ADA v primerjavi a 60,0% bolnikov z genotipom CC (p=9,71e-03). DeltaCRP je bil višji pri bolnikih s TT genotipom (6 mg/l) v primerjavi z bolniki z genotipom CC (0 mg/l, p=1,61e-02). Glede na klinični odgovor je bila povprečna vrednost IBDQ višja pri bolnikih s CT ali TT genotipom (173) v primerjavi z bolniki z genotipom CC (157,7, p=2,96e-02). Prav tako smo našli povezavo med polimorfizmom SNP rs blizu gena c11orf30 in odgovorom na zdravljenje. Po 12 tednih zdravljenja so imeli bolniki z genotipom CC višji deltaibdq (30) in nižji CRP (2,5 mg/l) v primerjavi z bolniki z genotipom CT ali TT genotipom (deltaibdq 14,1, p=1,68e-02, CRP 6 mg/l, p=243e-02). Po 20 tednih zdravljenja smo ugotovili še večjo razliko v CRP med bolniki z genotipom CC ter CT in TT (p=5,83e-03). Naslednjo povezavo smo našli na kromosomu 10 med polimorfizom SNP rs na genu CCNY in odgovorom na zdravljenje. Bolniki z genotipom CC so imeli boljši klinični in biološki odgovor na zdravljenje z ADA. Po 4 tednih zdravljenja je imelo 77,8% bolnikov z genotipom CC pozitiven odgovor na zdravljenje v primerjavi z 51 % bolnikov z genotipom AA ali AC (p=1,56e-02). Po 20 tednih zdravljenja so imeli bolniki z genotipom AA ali AC višji CRP (5 mg/l) v primerjavi z bolniki z genotipom CC polimorfizma SNP rs , pri katerih je CRP znašal 2 mg/l (p=6,78e-03). Za alel C je CRP po 20 tednih zdravljenja znašal 2 mg/l v primerjavi z alelom A (12 mg/l, p=6,69e-03). Na splošno so imeli bolniki z genotipom CC oziroma alelom C polimorfizma SNP rs na genu CCNY boljši odgovor po 12 in 20 tednih zdravljenja z ADA v primerjavi z bolniki z genotipom AA oziroma alelom A. 58

67 Ugotovili smo tudi povezavo med polimorfizmom SNP rs na genu NR1 2 in biološkim odgovorom na zdravljenje z ADA po 30 tednih. Bolniki z genotipom CC oziroma alelom C so imeli boljši odgovor glede na genotip AA oziroma alelom A. DeltaCRP po 30 tednih zdravljenja je bila višja pri bolnikih z alelom C (6,6 mg/l) v primerjavi z bolniki z alelom A (2 mg/l, p=9,64e-03). 94,1% bolnikov z alelom C je imelo pozitiven odgovor na zdravljenje z ADA v primerjavi s 63,8% bolnikov z alelom A (p=2,53e-02). Naslednjo močnejšo povezavo smo našli med polimorfizmom rs na genu IL13 in kliničnim odgovorom. Po 20 tednih zdravljenja so imeli bolniki z genotipom AA višji deltaibdq (69,2) v primerjavi z bolniki z AG ali GG (22,4, p=607e-03). DeltaIBDQ je ostala višja pri bolnikih z genotipom AA tudi po 30 tednih zdravljenja z ADA (p=1,84e-02). Povezavo smo našli tudi glede na biološki odgovor in sicer so imeli bolniki z genotipom AA višji deltacrp (28 mg/l) v primerjavi z bolniki z genotipom AG (1 mg/l) ali GG (6 mg/l, p=4,27e-02). Zanimiva pa je tudi ugotovitev, da so imeli bolniki z genotipom GG statistično višjo vrednost IBDQ pred začetkom zdravljenja (154) v primerjavi z bolniki z genotipom AA istega polimorfizma SNP, pri katerih je vrednost IBDQ znašala 116, p=9,20e-05. Iz tega gre sklepati, da imajo bolniki z genotipom AA težjo obliko CB, vendar tudi bolje odgovarjajo na zdravljenje z ADA Povezave med izražanjem izbranih genov in biološkim ter kliničnim odgovorom na zdravljenje Skupno smo izmerili izražanje 5 genov, predhodno povezanih s KVČB. Na voljo smo imeli RNK bolnikov pred zdravljenjem in 4, 12, 20 in 30 tednov po zdravljenju. Najprej smo naredili analizo izražanja genov pred in po določenem tednu zdravljenja skupno za vse bolnike. Rezultati so prikazani v tabeli 18. Kot je razvidno iz rezultatov, se je z zdravljenjem najbolj spreminjalo izražanje gena ATG16L1. 59

68 Tabela 18: Izražanje genov po tednih od začetka zdravljenja. 0. teden 4. teden 12. teden 20. teden 30. teden CCNY n mediana 1,76 3,00 1,05 1,31 3,24 p-vrednost 0,089 0,0004 0,034 0,076 ATG16L1 n mediana 1,77 0,65 0,45 0,77 2,91 p-vrednost 4, , , , SLC22A5 n mediana 1,15 1,23 0,80 1,00/1,15 1,31 p-vrednost 0,323 0,017 0,356 0,451 ORMDL3 n mediana 1,01 1,21 1,07 1,10 1,03 p-vrednost 0,047 0,767 0,206 0,741 ECM1 n mediana 1,12 0,76 0,4 1,07 1,11 p-vrednost 0,0009 0,0006 0,185 0,255 Nadalje smo naredili primerjavo izražanja genov med odzivniki in neodzivniki glede na parameter deltaibdq. Rezultati so prikazani v tabeli 19. V skupino dobrih odzivnikov smo razvrstili bolnike, pri katerih se je vrednost indeksa IBDQ glede na 0. teden zvišala za vsaj 22 točk. Ugotovili smo, izražanje gena ATG16L1 statistično značilno razlikuje med dobrimi in slabimi odziviniki po 12. tednu zdravljenja z ADA (p = 0,016). Prav tako se razlikuje izražanje gena SLC22A5 po 12. tednih zdravljenja med dobrimi in slabimi odzivniki z mejno statistično signifikanco (p = 0,042). Tabela 19:Razlika v izražanju izbranih genov med dobrimi in slabimi odzivniki glede na parameter IBDQ po tednih zdravljenja. 4. teden 12. teden 20. teden 30. teden CCNY n (odzivniki/neodzivniki) 35/13 32/14 25/10 26/9 mediana 1,71/1,70 0,55/0,51 1,42/1,17 1,41/1,43 p-vrednost 0,891 0,505 0,290 0,775 ATG16L1 n (odzivniki/neodzivniki) 31/14 30/13 25/6 23/8 mediana 0,64/0,82 0,53/0,34 0,77/0,95 3,07/2,71 p-vrednost 0,175 0,016 0,448 0,604 SLC22A5 n (odzivniki/neodzivniki) 40/22 35/18 33/11 25/9 mediana 1,30/1,13 0,90/0,59 1,05/0,89 1,29/1,50 p-vrednost 0,883 0,042 0,136 0,545 ORMDL3 n (odzivniki/neodzivniki) 41/20 36/15 34/10 27/10 mediana 1,12/1,37 1,15/0,97 1,30/0,99 1,09/0,88 p-vrednost 0,056 0,387 0,435 0,240 ECM1 n(odzivniki/neodzivniki) 36/18 35/16 32/12 23/10 mediana 1,15/1,40 0,90/0,90 1,11/0,90 1,20/1,01 p-vrednost 0,302 0,721 0,627 0,153 60

69 4.6. Povezave med biokemijskimi parametri in biološkim ter kliničnim odgovorom na zdravljenje Ob odvzemu krvi smo bolnikom izmerili biokemijske, hematološke in imunološke parametre. Na spodnjih slikah (Slika 15 Slika 20) je prikazano gibanje nekaterih parametrov tekom zdravljenja med med bolniki z dobrim odzivom in slabim odzivom. Iz slik je razvidno, da med analiziranimi parametri ni večjih razlik med odzivniki in neodzivniki. Slika 15: Gibanje levkocitov po tednih pri bolnikih z dobrim in slabim odzivom na zdravljenje z ADA. Slika 16: Gibanje hematokrita po tednih pri bolnikih z dobrim in slabim odzivom na zdravljenje z ADA. 61

70 Slika 17: Gibanje železa po tednih pri bolnikih z dobrim in slabim odzivom na zdravljenje z ADA. Slika 18: Gibanje transferina po tednih pri bolnikih z dobrim in slabim odzivom na zdravljenje z ADA. 62

71 Slika 19: Gibanje albumina po tednih pri bolnikih z dobrim in slabim odzivom na zdravljenje z ADA. Slika 20: Gibanje feritina po tednih pri bolnikih z dobrim in slabim odzivom na zdravljenje z ADA. Koncentracije železa, transferina, feritina in albumina so neposredno vezane na malabsorpcijo, ki je stalnica v primerih zagona CB, zato smo predvidevali, da bi nam lahko katera od njih služila kot napovednik za odzivnost na terapijo z ADA. 63

72 5. RAZPRAVA Učinkovitost ADA pri bolnikih s CB, ki niso odzivni na standardno terapijo, so dokazale številne multicentrične klinične študije, narejene v zadnjih letih. 48, 53, 57, 68, 74 Izsledki naše študije se ujemajo z ugotovitvami predhodnih študij. Ugotovili smo, da je po 30 tednih terapije več kot 70% bolnikov imelo pozitiven odziv na terapijo z ADA glede na oba kriterija (71,1% glede na IBDQ in 72,5% glede na biološki odziv CRP), kar je v skladu s predhodnimi kliničnimi študijami. Ugotovili smo, da je bil pozitiven odziv na zdravljenje z ADA merjen z IBDQ po 4 tednih pri 62,9% bolnikov, po 12 tednih 68%, po 20 tednih 66% in po 30 tednih 71%. V primeru merjenja odziva s CRP pa je imelo po 4 tednih pozitivni odziv 82,6% bolnikov, po 12 tednih 71,9%, po 20 tednih 72,7% in po 30 tednih 72,5% bolnikov. V praksi se za merjenje učinka zdravljenja CB sicer pogosteje kot IBDQ uporablja vprašalnik CDAI. V naši študiji smo za merjenje učinkovitosti zdravljenja uporabili obsežnejši vprašalnik IBDQ, z namenom, da bi lažje zaznali tudi manjše spremembe učinka zdravljenja. Dodatno smo se za IBDQ vprašalnik odločili zaradi mnenja KME, ki ni odobrila izvajanje kolonoskopij, ki bi jih izvajali samo za potrebe raziskave, CDAI pa v veliki meri potrebuje prav ugotovitve na osnovi kolonoskopij. IBDQ vprašalnik vsebuje tudi vprašanja, ki se navezujejo neposredno na kvaliteto življenja, zato smo lahko iz vrednosti direktno ocenili kvaliteto življenja, ki je poleg zazdravljene sluznice eden bistvenih učinkov zdravljenja, saj je zelo pomembno, da je bolnik poleg ustreznega napredka v kliničnem smislu, sp+osoben opravljanja vsakodnevnih življenjskih aktivnosti. V naši študiji smo ugotovili zelo dobro korelacijo med oceno učinka zdravljenja na osnovi IBDQ in normalizacije vrednosti CRP, kar je skladno z ugotovitvami drugih študij. 48, 53, 104 Potrdili smo ugotovitve glede učinkovitosti ADA tako za indukcijsko, kot tudi za vzdrževalno 48, 56 zdravljenje. Pri večini bolnikov je bilo že po nekaj dneh opaziti zelo hitre pozitivne učinke zdravljenja. Predvidevamo, da je to zato, ker smo imeli precejšnje število bolnikov, ki so čakali na zdravljenje z ADA, saj je ravno v tem času zavarovalnica sprostila ADA za zdravljenje vseh bolnikov s CB, katerim so na posebnih komisijah odobrili zdravljenje z ADA. Mnogo teh bolnikov je bilo v precej slabem stanju z akutnimi zagoni bolezni, visokimi parametri vnetja, zato se je pri večini teh bolnikov zelo hitro pokazal pozitivni učinek zdravljenja. Na odzivnost oz. neodzivnost na terapijo z ADA lahko vpliva veliko faktorjev: spol, BMI, kajenje, družinska predispozicija, indukcijski odmerek, ekstraintestinalne manifestacije, trajanje bolezni, starost ob diagnozi, vzporedna terapija z imunosupresivi, aminosalicilati ali KSi, serumske 64

73 koncentracije, tvorba protiteles in morebitna predhodna terapija z IFX. Četrtina bolnikov ni odgovorila na zdravljenje, druga četrtina pa je samo delno odgovorila na zdravljenje. Pri več kot 48, 57 polovici bolnikov smo dosegli popolno remisijo, kar je v povprečju višje kot v dosedanjih študijah. Povsem točne razlage za to nimamo. Nekaj bi lahko bilo zaradi IBDQ vprašalnika, ki da nekaj večjo težo psihološkim komponentam, te so pa bile pri naših bolnikih bolj izražene, saj je šlo za relativno težke bolnike in je bil vsak najmanjši pozitivni učinek zdravljenja že veliko olajšanje. Dober in hiter začetni učinek pripisujemo našemu odmernemu režimu z začetnim odmerkom 160 mg, sorazmerno težkim bolnikom in manjši tvorbi protiteles. Prav tvorba protiteles naj bi bila največja prav na začetku zdravljenja ob prenizkih serumskih koncentracijah. Pri večini bolnikov se je začetni učinek pokazal že po dobrem tednu zdravljenja. Odmerjanje je potekalo po režimu 160/80/40mg, saj je bilo dokazano, da je pri takšnem odmerjanju manjša možnost hitrejšega izzvena učinka. 98 Prvi odmerek je sestavljen iz štirih zaporednih injekcij isti dan ali pa po dve in dve vsak drugi dan. Prilagajanja odmerkov glede na težo in starost bolnikov nismo izvajali, saj tega tudi v literaturi nismo zasledili, pediatričnih bolnikov pa nismo imeli. Glede tedenskega režima so v študijah še vedno deljena mnenja, koliko je učinkovitost zares boljša. 105 Pri naši študiji smo poskusno šli na tedenski režim pri dveh bolnikih, vendar nismo dosegli boljšega odziva, tako da smo se posluževali samo dvotedenskega. Pri pregledu študij smo bili priča različnim pristopom ugotavljanja neodzivnikov, tako točkovno kot terminsko, tako da še vedno odprto vprašanje, koliko zares pripomore povečevanje odmerka oz. spreminjanje odmernega režima na povečanje števila bolnikov v remisiji. 98, 106 Posebnih vprašalnikov glede sodelovanja pri izpolnjevanju anket nismo prakticirali. Iz razgovorov z bolniki je bilo razbrati, da glede urnika, ki smo ga vsakemu bolniku dali na začetku zdravljenja, ni bilo težav in da je subkutano samoiniciranje potekalo brez težav. Pojavljajo se sicer dileme, če si bolniki res redno po urniku aplicirajo zdravilo in če ga redno shranjujejo v hladilniku ter če redno javljajo neželene učinke. Glede na to, da smo imeli opravka z relativno mladimi in urejenimi bolniki, ki so bili vsi zelo dobro informirani, tako glede bolezni, kot zdravil, smo predvidevali, da je njihova pripravljenost izpolnjevanja anket najmanj zadovoljiva. Smo pa že na samem začetku zdravljenja dali vsakemu bolniku na izbiro, da si v primeru nezmožnosti samoiniciranja poišče ustrezno osebo ali pa ambulanto, kjer mu bodo aplicirali zdravilo. Spol naj ne bi vplival na odzivnost terapije. Sicer ena 107, 108 študija navaja boljšo adherenco, kar pa mi za naše bolnike ne moremo ne ovreči ne potrditi. Ne glede na naštete pomisleke je ADA, kar se tiče same subkutane aplikacije, v absolutni prednosti pred IFX, kjer pa je potrebna 2-urna infuzija v ambulanti, po njej pa mora bolnik čakati 2 uri preden lahko gre domov. Prednost IFX je edino ta, da ni dileme, če je bolnik dobil zdravilo ali ne

74 ADA tudi zelo uspešno deluje pri bolnikih s perianalnimi fistulami. Fistule so se pri večini zelo dobro zapirale. Pri petnajstih bolnikih so se zelo dobro zazdravile oz. celo izginile. Izkazalo pa se je, da prehitro zapiranje fistul lahko privede do zapletov. V dveh primerih je namreč prišlo do zapleta, saj se je fistula zapirala prehitro, zaradi tega se je začelo nabirati veliko eksudata in potreben je bil operativni poseg. 72 Vzporedne terapije s standardnimi zdravili nismo prakticirali, razen v primerih, ko so bili bolniki odzivni na aminosalicilate in na budenofalk in je bil odmerek stabilen zadnja dva meseca. Nobene signifikantne razlike pa nismo zaznali med bolniki, ki so prejemali vzporedno terapijo in tistimi brez nje. Imunosupresive smo ukinili takoj po prejemu prvih odmerkov ADA, KSi pa smo začeli zmanjševati postopoma po drugem odmerku ADA. Dosedanji izsledki kažejo na to, da vzporedna terapija s Ksi in IS pri ADA nima posebnega dodatnega učinka. Ukinjanje KSi je zelo pomembno, saj se na ta način 48, 69 izognemo resnim neželenim učinkom, ki jih povzročajo. Nekatere študije so potrdile povezavo med ADA terapijo in operativnim posegom. 109, 110 Tudi mi smo opazili boljši odziv na ADA terapijo pri bolnikih, ki so imeli predhodno operativni poseg. Našli smo signifikantno povezavo med starostjo, pri kateri je bila potrjena diagnoza CB in odzivom na terapijo merjeno z IBDQ. Opažanja po 4 in 20 tednih terapije kažejo, da so imeli bolniki z zgodnejšo 48, 74 diagnozo CB boljši odziv na ADA terapijo. Ženske so imele nižje IBDQ vrednosti pred začetkom terapije v primerjavi z moškimi bolniki, ampak po 20 tednih terapije je bilo zvečanje vrednosti IBDQ višje pri ženskah kot pri moških bolnikih. Odkrili smo signifikantne razlike v odzivu in sicer so se ženske boljše odzivale na terapijo. To se ujema z Billioudovimi izsledki, kjer navaja, da je pri moških slabši odziv in tudi hitreje prihaja do izzvena 48, 57, 105 učinka. Večjih razlik glede učinkovitosti glede na spol pa ni bilo zaznati. Našli smo signifikantno boljši odziv na ADA pri skupini bolnikov, ki še niso bili zdravljeni z IFX, glede na tiste, ki so predhodno prejemali IFX. Glede biološkega odziva bolnikov, ki niso predhodno prejemali IFX, je bilo 91,2% bolnikov, ki so imeli odziv na terapijo z ADA, medtem ko je bilo v skupini, ki je bila predhodno zdravljena z IFX, samo 58,3% pozitivnih odgovorov. To se ujema z izsledki študije CLASSIC- I 57, kjer je 86% bolnikov pokazalo zelo dober odziv na ADA in GAIN študijo 58, kjer je 59% rezistentnih bolnikov pokazalo zelo dober odziv na ADA terapijo. Opaženo je bilo podprto tudi z zaključki CARE študije 74, ker je bila opažena remisija bolezni pri 62% na IFX naivnih bolnikov v 74, 104, 111, 112 primerjavi z 42% bolnikov, ki so že bili zdravljeni z IFX. V naši študiji nismo ciljno ugotavljali in merili kvalitete življenja bolnikov. Se pa da na osnovi dobljenih rezultatov z IBDQ, ki ima veliko vprašanj, ki se tičejo kvalitete življenja, zagotovo potrditi dejstvo, kot IFX 66

75 so ga potrdile mnoge predhodne študije, da se je kvaliteta življenja pri bolnikih, zdravljenih z ADA, 113, 114 znatno izboljšala. Povezava med kajenjem in odzivom na ADA terapijo v nekaterih študijah ni pokazala vpliva na stopnjo odziva bolnika na zdravljenje z ADA 115, druge pa so pokazale signifikantno razliko v stopnji odziva med kadilci in nekadilci v prednost nekadilcem. 112 V naši študiji smo ugotovili boljši odziv nekadilcev na terapijo z ADA, predvsem po 4 in po 30 tednih terapije. Bolniki so ADA zelo dobro prenašali, tako da ni bilo zaznati nobenih resnih neželenih učinkov. Smo pa imeli primere standardnih kot so: bolečina na mestu vboda, rdečina in oteklina na mestu vboda, pojav Herpes simpleksa, nekaj več in pogostejših vnetij zgornjega dihalnega trakta, anemije in hipoalbuminemija. Resnejših infekcij kot posledice zdravljenja z ADA ni bilo. Imeli smo eno komplikacijo vida, vendar se je po podrobnih preiskavah izkazalo, da težave niso bile posledica terapije z ADA. Pri enem bolniku so se pojavili simptomi podobni tuberkulozi, zato smo pri tem bolniku ukinili ADA. Predvidevali smo, da bi lahko bila pojavnost neželenih učinkov večja, vsaj na začetku zdravljenja, ker smo uporabili shemo 160/80/40, vendar ni prišlo do večje pojavnosti neželenih učinkov. Glede ostalih laboratorijskih biokemijskih in imunoloških preiskav nismo našli signifikantnih povezav glede učinka ADA, razen pri CRP, za katerega smo enako kot v predhodnih študijah ugotovili, da je 55, 57 dober napovednik učinka zdravljenja in je dobro koreliral tudi z vrednostmi IBDQ. Drugi del naloge je obsegal farmakogenetsko analizo izbranih polimorfizmov SNP. Polimorfizme SNP smo izbrali glede na naslednje kriterije: SNP-ji, močno povezani s KVČB v posameznih kandidatnih študijah , SNP-ji, ki so jih potrdile GWA študije za KVČB , ter SNP-ji, ki so bili povezani z odzivom na IFX 94, 134. Do sedaj je bila izvedena samo ena preliminarna študija, ki je analizirala povezavo med SNP-ji v genih NOD2, CD14 in TLR4 ter odzivom na ADA. 88 Ta študija je vključevala 24 bolnikov, ki so izgubili odziv ali so bili netolerantni na IFX. Uspešnost zdravljenja so ocenjevali po 52. tednu. V tej študiji niso odkrili nobene statistično značilne povezave med preučevanimi polimorfizmi in odzivom na ADA. Več študij se je nanašalo na povezave med SNP-ji in odzivom na terapijo z IFX in 59, 89, 91, 92, te so nam bile kot vodilo za farmakogenetske raziskave na ADA. V študiji smo našli številne povezave med izbranimi SNP-ji in odgovorom na ADA. Našli smo zelo močno povezavo med SNP-jem rs v genu ATG16L1 in biološkim odgovorom na terapijo z ADA, merjenim s CRP. Ugotovili smo, da imajo bolniki z genotipom TT boljši odgovor po 12., 20. in 30. tednih zdravljenja v primerjavi z bolniki z genotipom CC. ATG16L1 gen je eden najpomembnejših genov, povezanih s CB 125, 128, kar so potrdile številne študije. 22, 135 Povezava med ATG16L1 in IBD 67

76 nakazuje na pomembno vlogo avtofagosomne poti pri razvoju CB. 125 Zanimivo povezavo so odkrili med SNP-jem v genu ATG16L1 in povečano translokacijo bakterijske DNA iz črevesja v kri pri bolnikih s CB ter predvidevali, da prav ta bakterijska translokacija vpliva na učinkovitost anti-tnfα terapij. 136 Številne SNP-je v ATG16L1 genu so povezali tudi s kiničnimi karakteristikami, vključno z intenzivnostjo bolezni. 137 Z našo študijo smo tako še poudarilli pomembnost gena ATG16L1 kot napovedovalca odgovora na anti-tnfα terapijo, še zlasti za ADA. Veliko povezav smo našli za SNP rs na genu CASP9. Prvi je gen CASP9 v povezavi z odgovorom na IFX opisal Hlavaty s sod. 94, kjer so ugotovili, da polimorfizem SNP rs v genu CASP9 vpliva na odgovor na terapijo z IFX pri bolnikih z luminalno in fistulizirajočo obliko CB. Ugotovili so, da imajo bolniki z genotipom TT vsi dober odgovor na zdravljenje v primerjavi s 67% bolnikov z genotipom CC in CT (p=0,04). V naši študiji smo prav tako ugotovili, da imajo nosilci alela T tega istega SNP-ja rs boljši odgovor na ADA v primerjavi z nosilci alela C. CASP9 je z apoptozo povezana cisteinska proteaza, ki sproži aktivacijo kaspazne kaskade ter inducira apoptozo celic, prav tako pa je bil predlagan gen, povezan s KVČB. 138 Nadalje smo močno povezavo našli med SNP-jem rs in odgovorom na ADA, pri čemer so imeli bolniki z genotipom GG boljši odgovor v primerjavi z bolniki z genotipom AA. SNP rs je lociran v genski puščavi na kromosomu 5p13.1. Dokazano je bilo, da vpliva na izražanje gena PTGER4, ki je pomemben kandidatni gen za CB. Znano je namreč, da miške z izbitim genom (knock-out miške) razvijejo hudo obliko kolitisa po zdravljenju z dekstran natrijevim sulfatom, za razliko od mišk, ki jim primanjkuje katerikoli od drugih sedmih tipov prostanoidnih receptorjev. 122 Najmočnejšo povezavo z odgovorom na zdravljenje z ADA smo ugotovili glede na IBDQ kriterij, se je pa isti trend boljšega odziva pri bolnikih z genotipom GG opazil tudi glede na CRP kriterij. Glede na to, da smo največjo razliko frekvence genotipa SNP-ja rs blizu gena PTGER4 med dobrimi in slabimi odzivniki našli v 4. in 12. tednu zdravljenja z ADA, bi lahko PTGER4 služil kot napovednik kratkotrajnega odgovora na ADA. Ostale statistično najbolj značilne povezave smo ugotovili med SNP-ji v genih IL27, CCNY, C11orf30, NR1I2 in IL13 ter odgovorom na zdravljenje z ADA. Za bolnike z genotipom AA SNP-ja rs na genu IL13 smo ugotovili, da imajo težjo obliko CB, kar se je kazalo v zelo nizki vrednosti IBDQ pred začetkom zdravljenja z ADA (116) v primerjavi z bolniki z genotipom GG (154), nadalje pa so bolniki z genotipom AA zelo dobro odgovorili na zdravljenje z ADA, pri njih se je po 20. tednih zdravljenja IBDQ v povprečju povečal kar za 69,2, v primerjavi z bolniki z genotipom GG, pri katerih se je IBDQ po 20. tednih zdravljenja povečal le za 22,4. Iz tega lahko zaključimo,da imajo bolniki z genotipom AA bolj komplicirano obliko CB, imajo pa zelo dober odziv na terapijo z ADA. 68

77 6. ZAKLJUČEK Namen naloge je bil izvesti sistematično farmakogenomsko študijo pri bolnikih s Crohnovo boleznijo, zdravljenimi z adalimumabom. Ugotovili naj bi povezave med biokemijskimi, imunološkimi, kliničnimi in genetskimi značilnostmi posameznikov, glede na odziv na zdravljenje z adalimumabom (ADA) in poskusiti določiti zanesljive napovedne profile za individualizirano zdravljenje bolnikov s Crohnovo boleznijo. Predpogoj za dobro izvedbo takšnih študij je dober način ocenjevanja uspešnosti zdravljenja. Glede na to, da so se tudi v drugih raziskavah naleteli na težave, bi bilo nujno v bodoče narediti nov pristop za ocenjevanje uspešnosti zdravljenja v smislu poenotenja vprašalnikov za ocenjevanje uspešnosti zdravljenja. Glavne ugotovitve naše raziskave glede odziva na zdravljenje in iskanja napovednikov za individualizirano zdravljenje so: boljši odziv na zdravljenje z adalimumabom imajo bolniki, ki predhodno še niso bili zdravljeni z IFX, nekadilci, kirurško zdravljeni ali pa so bili ob postavitvi diagnoze mlajši. S tem smo potrdili že znane povezave med fenotipskimi značilnostmi in odzivom na zdravljenje. Pri analizi biokemijskih in imunoloških parametrov v povezavi z odzivom na terapijo z ADA nismo ugotovili novih statistično signifikantnih povezav, ki bi lahko predstavljale nov parameter pri načrtovanju individualiziranega zdravljenja. Torej na področju fenotipskih parametrov nismo uspeli odkriti potencialnih napovednikov glede učineka zdavljenja. Smiselno bi bilo te parametre spremljati skozi daljše obdobje zdravljenja in opraviti analizo na večjem številu bolnikov. Odziv na zdravljenje z ADA je deloma genetsko pogojen s polimorfizmi SNP, povezanimi z nastankom Crohnove bolezni, vplivom na farmakokinetične in farmakodinamske lastnosti adalimumaba. Najbolj obetaven kandidatni gen za odgovor na zdravljenje z ADA se je izkazal gen ATG16L1. Našli pa smo povezave tudi z drugimi geni, ki so povezani s patogenezo kronično vnetne črevesne bolezni in učnki zdravila (CASP9, IL27, CCNY, C11orf30, NR1I2 in IL13). Prav tako smo ugotovili, da je izražanje genov pomemben napovedovalec odziva, pri čemer smo najmočnejšo povezavo med izražanjem gena in odzivom na ADA prav tako ugotovili za gen ATG16L1. S tem smo prispevali pomembne genetske biooznačevalce odziva na terapijo in odlično izhodišče za nadaljnje raziskave v smeri prenosa farmakogenomike v klinično prakso. Izsledki raziskave so pokazali, da bo v okviru fenotipskih parametrov težko najti biooznačevalce, ki bi bili dovolj dobri napovedniki zdravljenja z adalimumabom in bi jih bilo možno implementirati v terapevtsko prakso. Obetavnejše je področje farmakogenomike, kjer smo odkrili potencialne biooznačevalce. Potrebnih bo pa več podobnih prospektivnih kohortnih študij, kot je bila naša, da bi 69

78 potrdili potencialne ali odkrili nove molekularne biooznačevalce in napovedne modele, ki bi jih lahko uporabili v smeri individualiziranega zdravljenja. Odkrivanje biooznačevalcev in individualizirano zdravljenje bodo torej teme prihodnjih raziskav. Kompleksnost našega genoma in multigenske karakteristike, tako v povezavi z boleznijo kot terapijo, pa bodo še naprej narekovale tempo in hitrost raziskav. Vsekakor je eno od bolj obetajočih področij uporabe genetskega znanja napovedovanje poteka bolezni, saj bi z uspešno identifikacijo ključnih genetskih markerjev za imunomodulatorni odziv tudi pri KVČB lahko znatno vplivali na paradigme terapije - to pa ostaja izziv, za katerega upamo, da bo uresničen v bližnji prihodnosti. 70

79 7. LITERATURA 1. Abraham C, Cho JH. Inflammatory bowel disease. NEnglJMed 2009; 361(21): Molodecky NA, Soon IS, Rabi DM, Ghali WA, Ferris M, Chernoff G, et al. Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology 2012; 142(1): Peyrin-Biroulet L, Loftus EV, Jr., Colombel JF, Sandborn WJ. The natural history of adult Crohn's disease in population-based cohorts. AmJGastroenterol 2010; 105(2): Gasche C, Scholmerich J, Brynskov J, D'Haens G, Hanauer SB, Irvine EJ, et al. A simple classification of Crohn's disease: report of the Working Party for the World Congresses of Gastroenterology, Vienna InflammBowelDis 2000; 6(1): Carter MJ, Lobo AJ, Travis SP. Guidelines for the management of inflammatory bowel disease in adults. Gut 2004; 53 Suppl 5: V Satsangi J, Silverberg MS, Vermeire S, Colombel JF. The Montreal classification of inflammatory bowel disease: controversies, consensus, and implications. Gut 2006; 55(6): Baumgart DC, Sandborn WJ. Crohn's disease. Lancet 2012; 380(9853): Evans JM, McMahon AD, Murray FE, McDevitt DG, MacDonald TM. Non-steroidal antiinflammatory drugs are associated with emergency admission to hospital for colitis due to inflammatory bowel disease. Gut 1997; 40(5): Podolsky DK. Inflammatory bowel disease. NEnglJMed 2002; 347(6): Danese S, Sans M, Fiocchi C. Inflammatory bowel disease: the role of environmental factors. AutoimmunRev 2004; 3(5): Lakatos PL, Szamosi T, Lakatos L. Smoking in inflammatory bowel diseases: good, bad or ugly? World JGastroenterol 2007; 13(46): Bridger S, Lee JC, Bjarnason I, Jones JE, Macpherson AJ. In siblings with similar genetic susceptibility for inflammatory bowel disease, smokers tend to develop Crohn's disease and non-smokers develop ulcerative colitis. Gut 2002; 51(1): Ananthakrishnan AN. Environmental triggers for inflammatory bowel disease. CurrGastroenterolRep 2013; 15(1):

80 14. Mahid SS, Minor KS, Soto RE, Hornung CA, Galandiuk S. Smoking and inflammatory bowel disease: a meta-analysis. Mayo ClinProc 2006; 81(11): Frisch M, Johansen C, Mellemkjaer L, Engels EA, Gridley G, Biggar RJ, et al. Appendectomy and subsequent risk of inflammatory bowel diseases. Surgery 2001; 130(1): Reif S, Lavy A, Keter D, Broide E, Niv Y, Halak A, et al. Appendectomy is more frequent but not a risk factor in Crohn's disease while being protective in ulcerative colitis: a comparison of surgical procedures in inflammatory bowel disease. AmJGastroenterol 2001; 96(3): Radford-Smith GL, Edwards JE, Purdie DM, Pandeya N, Watson M, Martin NG, et al. Protective role of appendicectomy on onset and severity of ulcerative colitis and Crohn's disease. Gut 2002; 51(6): Andersson RE, Olaison G, Tysk C, Ekbom A. Appendectomy and protection against ulcerative colitis. NEnglJMed 2001; 344(11): Lopez-Serrano P, Perez-Calle JL, Perez-Fernandez MT, Fernandez-Font JM, Boixeda de MD, Fernandez-Rodriguez CM. Environmental risk factors in inflammatory bowel diseases. Investigating the hygiene hypothesis: a Spanish case-control study. ScandJGastroenterol 2010; 45(12): Riordan AM, Ruxton CH, Hunter JO. A review of associations between Crohn's disease and consumption of sugars. EurJClinNutr 1998; 52(4): Jantchou P, Morois S, Clavel-Chapelon F, Boutron-Ruault MC, Carbonnel F. Animal protein intake and risk of inflammatory bowel disease: The E3N prospective study. AmJGastroenterol 2010; 105(10): Jostins L, Ripke S, Weersma RK, Duerr RH, McGovern DP, Hui KY, et al. Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nature 2012; 491(7422): Schwartz DA, Loftus EV, Jr., Tremaine WJ, Panaccione R, Harmsen WS, Zinsmeister AR, et al. The natural history of fistulizing Crohn's disease in Olmsted County, Minnesota. Gastroenterology 2002; 122(4): Berry SM, Fischer JE. Classification and pathophysiology of enterocutaneous fistulas. SurgClinNorth Am 1996; 76(5):

81 25. Datta V, Engledow A, Chan S, Forbes A, Cohen CR, Windsor A. The management of enterocutaneous fistula in a regional unit in the United kingdom: a prospective study. DisColon Rectum 2010; 53(2): Orangio GR. Enterocutaneous fistula: medical and surgical management including patients with Crohn's disease. ClinColon RectalSurg 2010; 23(3): Voulgari PV. Rheumatological manifestations in inflammatory bowel disease. AnnGastroenterol 2011; 24(3): Buckland MS, Mylonaki M, Rampton D, Longhurst HJ. Serological markers (anti- Saccharomyces cerevisiae mannan antibodies and antineutrophil cytoplasmic antibodies) in inflammatory bowel disease: diagnostic utility and phenotypic correlation. ClinDiagnLab Immunol 2005; 12(11): Mahler M, Bogdanos DP, Pavlidis P, Fritzler MJ, Csernok EDJ, Bentow C, et al. PR3-ANCA: A promising biomarker for ulcerative colitis with extensive disease. Clinica Chimica Acta 2014; 424: Seibold F, Weber P, Jenss H, Wiedmann KH. Antibodies to a trypsin sensitive pancreatic antigen in chronic inflammatory bowel disease: specific markers for a subgroup of patients with Crohn's disease. Gut 1991; 32(10): Kocijancic A, Mrevlje F, Stajer D. Interna medicina, 3. izdaja, Ljubljana. Zalozba Littera Picta Pham M, Lemberg DA, Day AS. Probiotics: sorting the evidence from the myths. MedJAust 2008; 188(5): Sanderson IR, Udeen S, Davies PS, Savage MO, Walker-Smith JA. Remission induced by an elemental diet in small bowel Crohn's disease. ArchDisChild 1987; 62(2): Johnson GJ, Cosnes J, Mansfield JC. Review article: smoking cessation as primary therapy to modify the course of Crohn's disease. AlimentPharmacolTher 2005; 21(8): Bratkovic T. Bioloske učinkovine pri zdravljenju Crohnove bolezni in ulceroznega kolitisa. Farmacevtski vestnik 2008; 59(2): Summers RW, Switz DM, Sessions JT, Jr., Becktel JM, Best WR, Kern F, Jr., et al. National Cooperative Crohn's Disease Study: results of drug treatment. Gastroenterology 1979; 77(4 Pt 2):

82 37. Malchow H, Ewe K, Brandes JW, Goebell H, Ehms H, Sommer H, et al. European Cooperative Crohn's Disease Study (ECCDS): results of drug treatment. Gastroenterology 1984; 86(2): Akobeng AK, Gardener E. Oral 5-aminosalicylic acid for maintenance of medically-induced remission in Crohn's Disease. CochraneDatabaseSystRev 2005;(1): CD Steinhart AH, Feagan BG, Wong CJ, Vandervoort M, Mikolainis S, Croitoru K, et al. Combined budesonide and antibiotic therapy for active Crohn's disease: a randomized controlled trial. Gastroenterology 2002; 123(1): Rutgeerts P, Hiele M, Geboes K, Peeters M, Penninckx F, Aerts R, et al. Controlled trial of metronidazole treatment for prevention of Crohn's recurrence after ileal resection. Gastroenterology 1995; 108(6): Belaiche J, Louis E. Corticosteroid treatment in active Crohn's disease. Acta GastroenterolBelg 1998; 61(2): Rutgeerts P, Lofberg R, Malchow H, Lamers C, Olaison G, Jewell D, et al. A comparison of budesonide with prednisolone for active Crohn's disease. NEnglJMed 1994; 331(13): Campieri M, Ferguson A, Doe W, Persson T, Nilsson LG. Oral budesonide is as effective as oral prednisolone in active Crohn's disease. The Global Budesonide Study Group. Gut 1997; 41(2): Pearson DC, May GR, Fick GH, Sutherland LR. Azathioprine and 6-mercaptopurine in Crohn disease. A meta-analysis. AnnInternMed 1995; 123(2): Feagan BG, Rochon J, Fedorak RN, Irvine EJ, Wild G, Sutherland L, et al. Methotrexate for the treatment of Crohn's disease. The North American Crohn's Study Group Investigators. NEnglJMed 1995; 332(5): Feagan BG, Fedorak RN, Irvine EJ, Wild G, Sutherland L, Steinhart AH, et al. A comparison of methotrexate with placebo for the maintenance of remission in Crohn's disease. North American Crohn's Study Group Investigators. NEnglJMed 2000; 342(22): Mowat C, Cole A, Windsor A, Ahmad T, Arnott I, Driscoll R, et al. Guidelines for the management of inflammatory bowel disease in adults. Gut 2011; 60(5): Sandborn WJ, Hanauer SB, Rutgeerts P, Fedorak RN, Lukas M, MacIntosh DG, et al. Adalimumab for maintenance treatment of Crohn's disease: results of the CLASSIC II trial. Gut 2007; 56(9):

83 49. Rutgeerts P, Vermeire S, Van AG. Biological therapies for inflammatory bowel diseases. Gastroenterology 2009; 136(4): Rutgeerts P, Schreiber S, Feagan B, Keininger DL, O'Neil L, Fedorak RN. Certolizumab pegol, a monthly subcutaneously administered Fc-free anti-tnfalpha, improves health-related quality of life in patients with moderate to severe Crohn's disease. IntJColorectal Dis 2008; 23(3): Trinder MW, Lawrance IC. Efficacy of adalimumab for the management of inflammatory bowel disease in the clinical setting. JGastroenterolHepatol 2009; 24(7): Sandborn WJ. Current directions in IBD therapy: what goals are feasible with biological modifiers? Gastroenterology 2008; 135(5): Colombel JF, Sandborn WJ, Rutgeerts P, Enns R, Hanauer SB, Panaccione R, et al. Adalimumab for maintenance of clinical response and remission in patients with Crohn's disease: the CHARM trial. Gastroenterology 2007; 132(1): D'Haens GR, Panaccione R, Higgins PD, Vermeire S, Gassull M, Chowers Y, et al. The London Position Statement of the World Congress of Gastroenterology on Biological Therapy for IBD with the European Crohn's and Colitis Organization: when to start, when to stop, which drug to choose, and how to predict response? AmJGastroenterol 2011; 106(2): Schreiber S, Reinsich R, Colombel J, et.al. Early Crohn's disease shows high levels of remission to therapy with adalimumab: sub-analysis of CHARM. Gastroenterology 2007; 132(A-147). 56. Rutgeerts P, D'Haens G, Van Assche G, et al. Adalimumab induces and maintains mucosal healing in patients with moderate to severe ileocolonic Crohn's disease. First results of the EXTEND trial. Gastroenterology 2009; 136(A-116). 57. Hanauer SB, Sandborn WJ, Rutgeerts P, Fedorak RN, Lukas M, MacIntosh D, et al. Human anti-tumor necrosis factor monoclonal antibody (adalimumab) in Crohn's disease: the CLASSIC-I trial. Gastroenterology 2006; 130(2): Mannon P. GAIN for loss: adalimumab for infliximab-refractory Crohn disease. AnnInternMed 2007; 146(12): Louis EJ, Watier HE, Schreiber S, Hampe J, Taillard F, Olson A, et al. Polymorphism in IgG Fc receptor gene FCGR3A and response to infliximab in Crohn's disease: a subanalysis of the ACCENT I study. PharmacogenetGenomics 2006; 16(12):

84 60. Karmiris K, Paintaud G, Noman M, Magdelaine-Beuzelin C, Ferrante M, Degenne D, et al. Influence of trough serum levels and immunogenicity on long-term outcome of adalimumab therapy in Crohn's disease. Gastroenterology 2009; 137(5): Kiss LS, Szamosi T, Molnar T, Miheller P, Lakatos L, Vincze A, et al. Early clinical remission and normalisation of CRP are the strongest predictors of efficacy, mucosal healing and dose escalation during the first year of adalimumab therapy in Crohn's disease. AlimentPharmacolTher 2011; 34(8): Hlavaty T, Persoons P, Vermeire S, Ferrante M, Pierik M, van AG, et al. Evaluation of shortterm responsiveness and cutoff values of inflammatory bowel disease questionnaire in Crohn's disease. InflammBowelDis 2006; 12(3): Devlin SM, Panaccione R. Adalimumab for the treatment of Crohn's disease. ExpertOpinBiolTher 2008; 8(7): Koelewijn CL, Schwartz MP, Samsom M, Oldenburg B. C-reactive protein levels during a relapse of Crohn's disease are associated with the clinical course of the disease. World JGastroenterol 2008; 14(1): Riis L, Vind I, Vermeire S, Wolters F, Katsanos K, Politi P, et al. The prevalence of genetic and serologic markers in an unselected European population-based cohort of IBD patients. InflammBowelDis 2007; 13(1): Groselj D, Grabec I, Seme K, Ihan A, Ferkolj I. Prediction of clinical response to anti-tnf treatment by oral parameters in Crohn's disease. Hepatogastroenterology 2008; 55(81): Feagan BG, Lemann M, Befrits R, Connell W, D'Haens G, Ghosh S, et al. Recommendations for the treatment of Crohn's disease with tumor necrosis factor antagonists: an expert consensus report. InflammBowelDis 2012; 18(1): Loftus EV, Colombel JF, Rutgeerts PJ, et al. Short-term ADA therapy improves quality of life in patients who had failed infl iximab therapy: Results from the GAIN trial. Gastroenterology 2007; 132(4 (Suppl.2)): T Sandborn WJ, Rutgeerts P, Enns R, Hanauer SB, Colombel JF, Panaccione R, et al. Adalimumab induction therapy for Crohn disease previously treated with infliximab: a randomized trial. AnnInternMed 2007; 146(12): Youdim A, Vasiliauskas EA, Targan SR, Papadakis KA, Ippoliti A, Dubinsky MC, et al. A pilot study of adalimumab in infliximab-allergic patients. InflammBowelDis 2004; 10(4):

85 71. Van AG, Vermeire S, Rutgeerts P. Adalimumab in Crohn's disease. Biologics 2007; 1(4): Feagan BG, Panaccione R, Sandborn WJ, et al. An evaluation of ADA on the risk of hospitalization in patients with Crohn's disease, data from CHARM. Gastroenterology 2007; 132(T1312). 73. Panaccione R, Loftus EV, Jr., Binion D, McHugh K, Alam S, Chen N, et al. Efficacy and safety of adalimumab in Canadian patients with moderate to severe Crohn's disease: results of the Adalimumab in Canadian SubjeCts with ModErate to Severe Crohn's DiseaSe (ACCESS) trial. CanJGastroenterol 2011; 25(8): Lofberg R, Louis EV, Reinisch W, Robinson AM, Kron M, Camez A, et al. Adalimumab produces clinical remission and reduces extraintestinal manifestations in Crohn's disease: results from CARE. InflammBowelDis 2012; 18(1): Khor B, Gardet A, Xavier RJ. Genetics and pathogenesis of inflammatory bowel disease. Nature 2011; 474(7351): Lees CW, Barrett JC, Parkes M, Satsangi J. New IBD genetics: common pathways with other diseases. Gut 2011; 60(12): Orchard TR, Dhar A, Simmons JD, Vaughan R, Welsh KI, Jewell DP. MHC class I chain-like gene A (MICA) and its associations with inflammatory bowel disease and peripheral arthropathy. Clin Exp Immunol 2001; 126(3): Rioux JD, Daly MJ, Silverberg MS, Lindblad K, Steinhart H, Cohen Z, et al. Genetic variation in the 5q31 cytokine gene cluster confers susceptibility to Crohn disease. NatGenet 2001; 29(2): Yamazaki, K. et al. Single nucleotide polymorphisms in TNFSF15 confer susceptibility to Crohn's disease. Hum.Mol.Genet. 14, (2005). 80. McGovern DP, Butler H, Ahmad T, Paolucci M, van Heel DA, Negoro K, et al. TUCAN (CARD8) genetic variants and inflammatory bowel disease. Gastroenterology 2006; 131(4): Wang K, Baldassano R, Zhang H, Qu HQ, Imielinski M, Kugathasan S, et al. Comparative genetic analysis of inflammatory bowel disease and type 1 diabetes implicates multiple loci with opposite effects. HumMolGenet 2010; 19(10):

86 82. Glocker EO, Kotlarz D, Boztug K, Gertz EM, Schaffer AA, Noyan F, et al. Inflammatory bowel disease and mutations affecting the interleukin-10 receptor. NEnglJMed 2009; 361(21): Momozawa Y, Mni M, Nakamura K, Coppieters W, Almer S, Amininejad L, et al. Resequencing of positional candidates identifies low frequency IL23R coding variants protecting against inflammatory bowel disease. NatGenet 2011; 43(1): Muise AM, Walters TD, Glowacka WK, Griffiths AM, Ngan BY, Lan H, et al. Polymorphisms in E-cadherin (CDH1) result in a mis-localised cytoplasmic protein that is associated with Crohn's disease. Gut 2009; 58(8): Sabath E, Negoro H, Beaudry S, Paniagua M, Angelow S, Shah J, et al. Galpha12 regulates protein interactions within the MDCK cell tight junction and inhibits tight-junction assembly. JCell Sci 2008; 121(Pt 6): Ma Q, Lu AY. Pharmacogenetics, pharmacogenomics, and individualized medicine. PharmacolRev 2011; 63(2): Torok HP, Goke B, Konrad A. Pharmacogenetics of Crohn's disease. Pharmacogenomics 2008; 9(7): Barreiro-de AM, Ouburg S, Morre SA, Crusius JB, Lorenzo A, Potel J, et al. NOD2, CD14 and TLR4 mutations do not influence response to adalimumab in patients with Crohn's disease: a preliminary report. RevEspEnfermDig 2010; 102(10): Vermeire S, Louis E, Rutgeerts P, De VM, Van GA, Belaiche J, et al. NOD2/CARD15 does not influence response to infliximab in Crohn's disease. Gastroenterology 2002; 123(1): Mascheretti S, Hampe J, Croucher PJ, Nikolaus S, Andus T, Schubert S, et al. Response to infliximab treatment in Crohn's disease is not associated with mutations in the CARD15 (NOD2) gene: an analysis in 534 patients from two multicenter, prospective GCP-level trials. Pharmacogenetics 2002; 12(7): Mascheretti S, Hampe J, Kuhbacher T, Herfarth H, Krawczak M, Folsch UR, et al. Pharmacogenetic investigation of the TNF/TNF-receptor system in patients with chronic active Crohn's disease treated with infliximab. PharmacogenomicsJ 2002; 2(2): Pierik M, Vermeire S, Steen KV, Joossens S, Claessens G, Vlietinck R, et al. Tumour necrosis factor-alpha receptor 1 and 2 polymorphisms in inflammatory bowel disease and their association with response to infliximab. AlimentPharmacolTher 2004; 20(3):

87 93. Louis E, Vermeire S, Rutgeerts P, De VM, Van GA, Pescatore P, et al. A positive response to infliximab in Crohn disease: association with a higher systemic inflammation before treatment but not with -308 TNF gene polymorphism. ScandJGastroenterol 2002; 37(7): Hlavaty T, Pierik M, Henckaerts L, Ferrante M, Joossens S, van SN, et al. Polymorphisms in apoptosis genes predict response to infliximab therapy in luminal and fistulizing Crohn's disease. AlimentPharmacolTher 2005; 22(7): Louis E, El GZ, Vermeire S, Dall'Ozzo S, Rutgeerts P, Paintaud G, et al. Association between polymorphism in IgG Fc receptor IIIa coding gene and biological response to infliximab in Crohn's disease. AlimentPharmacolTher 2004; 19(5): Dideberg V, Theatre E, Farnir F, Vermeire S, Rutgeerts P, De VM, et al. The TNF/ADAM 17 system: implication of an ADAM 17 haplotype in the clinical response to infliximab in Crohn's disease. PharmacogenetGenomics 2006; 16(10): Dubinsky MC, Mei L, Friedman M, Dhere T, Haritunians T, Hakonarson H, et al. Genome wide association (GWA) predictors of anti-tnfalpha therapeutic responsiveness in pediatric inflammatory bowel disease. InflammBowelDis 2010; 16(8): Dignass A, Van AG, Lindsay JO, Lemann M, Soderholm J, Colombel JF, et al. The second European evidence-based Consensus on the diagnosis and management of Crohn's disease: Current management. JCrohnsColitis 2010; 4(1): Vermeire S, Van AG, Rutgeerts P. Laboratory markers in IBD: useful, magic, or unnecessary toys? Gut 2006; 55(3): Guyatt G, Mitchell A, Irvine EJ, Singer J, Williams N, Goodacre R, et al. A new measure of health status for clinical trials in inflammatory bowel disease. Gastroenterology 1989; 96(3): Thia KT, Sandborn WJ, Lewis JD, Loftus EV, Feagan BG, Steinhart AH, et al. Defining the optimal response criteria for the Crohn's disease activity index for induction studies in patients with mildly to moderately active Crohn's disease. Am J Gastroenterol 2008; 103(12): Solem CA, Loftus EV, Tremaine WJ, Harmsen WS, Zinsmeister AR, Sandborn WJ. Correlation of C-reactive protein with clinical, endoscopic, histologic, and radiographic activity in inflammatory bowel disease. Inflamm Bowel Dis 2005; 11(8): Bitton A, Dobkin PL, Edwardes MD, Sewitch MJ, Meddings JB, Rawal S, et al. Predicting relapse in Crohn's disease: a biopsychosocial model. Gut 2008; 57(10):

88 104. Zorzi F, Zuzzi S, Onali S, Calabrese E, Condino G, Petruzziello C, et al. Efficacy and safety of infliximab and adalimumab in Crohn's disease: a single centre study. AlimentPharmacolTher 2012; 35(12): Billioud V, Sandborn WJ, Peyrin-Biroulet L. Loss of response and need for adalimumab dose intensification in Crohn's disease: a systematic review. AmJGastroenterol 2011; 106(4): Clark M, Colombel JF, Feagan BC, Fedorak RN, Hanauer SB, Kamm MA, et al. American gastroenterological association consensus development conference on the use of biologics in the treatment of inflammatory bowel disease, June 21-23, Gastroenterology 2007; 133(1): Fidder HH, Singendonk MM, van der Have M, Oldenburg B, van Oijen MG. Low rates of adherence for tumor necrosis factor-α inhibitors in Crohn's disease and rheumatoid arthritis: results of a systematic review. World J Gastroenterol 2013; 19(27): Billioud V, Laharie D, Filippi J, Roblin X, Oussalah A, Chevaux JB, et al. Adherence to adalimumab therapy in Crohn's disease: a French multicenter experience. Inflamm Bowel Dis 2011; 17(1): Papamichael K, Archavlis E, Lariou C, Mantzaris GJ. Adalimumab for the prevention and/or treatment of post-operative recurrence of Crohn's disease: a prospective, two-year, single center, pilot study. JCrohnsColitis 2012; 6(9): Savarino E, Dulbecco P, Bodini G, Assandri L, Savarino V. Prevention of postoperative recurrence of Crohn's disease by Adalimumab: a case series. EurJGastroenterolHepatol 2012; 24(4): Sandborn WJ, Hanauer S, Loftus EV, Tremaine WJ, Kane S, Cohen R, et al. An open-label study of the human anti-tnf monoclonal antibody adalimumab in subjects with prior loss of response or intolerance to infliximab for Crohn's disease. Am J Gastroenterol 2004; 99(10): Triantafillidis JK, Mantzaris G, Karagiannis J, Papavasilliou E, Papatheodoridis G, Fouskas J, et al. Similar response to adalimumab in patients with active Crohn's disease either naive to biologic agents or with prior loss of response or intolerance to infliximab. RevMedChir SocMedNatIasi 2010; 114(1): Verissimo R. Quality of life in inflammatory bowel disease: psychometric evaluation of an IBDQ cross-culturally adapted version. J Gastrointestin Liver Dis 2008; 17(4):

89 114. Cohen RD. The quality of life in patients with Crohn's disease. Aliment Pharmacol Ther 2002; 16(9): Nichita C, Stelle M, Vavricka S, El-Wafa AA, Ballabeni P, de SP, et al. Clinical experience with adalimumab in a multicenter Swiss cohort of patients with Crohn's disease. Digestion 2010; 81(2): Luo Y, Xia B, Li C, Chen Z, Ge L, Jiang T, et al. Cytotoxic T lymphocyte antigen-4 promoter - 658CT gene polymorphism is associated with ulcerative colitis in Chinese patients. IntJColorectal Dis 2009; 24(5): Franke A, Balschun T, Karlsen TH, Hedderich J, May S, Lu T, et al. Replication of signals from recent studies of Crohn's disease identifies previously unknown disease loci for ulcerative colitis. NatGenet 2008; 40(6): Li Y, Chang M, Schrodi SJ, Callis-Duffin KP, Matsunami N, Civello D, et al. The 5q31 variants associated with psoriasis and Crohn's disease are distinct. HumMolGenet 2008; 17(19): Dring MM, Goulding CA, Trimble VI, Keegan D, Ryan AW, Brophy KM, et al. The pregnane X receptor locus is associated with susceptibility to inflammatory bowel disease. Gastroenterology 2006; 130(2): Browning BL, Huebner C, Petermann I, Demmers P, McCulloch A, Gearry RB, et al. Association of DLG5 variants with inflammatory bowel disease in the New Zealand Caucasian population and meta-analysis of the DLG5 R30Q variant. InflammBowelDis 2007; 13(9): Klein W, Tromm A, Griga T, Fricke H, Folwaczny C, Hocke M, et al. Interleukin-4 and interleukin-4 receptor gene polymorphisms in inflammatory bowel diseases. Genes Immun 2001; 2(5): Libioulle C, Louis E, Hansoul S, Sandor C, Farnir F, Franchimont D, et al. Novel Crohn disease locus identified by genome-wide association maps to a gene desert on 5p13.1 and modulates expression of PTGER4. PLoSGenet 2007; 3(4): e Feng T, Zhu X. Genome-wide searching of rare genetic variants in WTCCC data. HumGenet 2010; 128(3): Duerr RH, Taylor KD, Brant SR, Rioux JD, Silverberg MS, Daly MJ, et al. A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science 2006; 314(5804):

90 125. Hampe J, Franke A, Rosenstiel P, Till A, Teuber M, Huse K, et al. A genome-wide association scan of nonsynonymous SNPs identifies a susceptibility variant for Crohn disease in ATG16L1. NatGenet 2007; 39(2): Dubinsky MC, Kugathasan S, Kwon S, Haritunians T, Wrobel I, Wahbeh G, et al. Multidimensional prognostic risk assessment identifies association between IL12B variation and surgery in Crohn's disease. InflammBowelDis 2013; 19(8): Wang K, Zhang H, Kugathasan S, Annese V, Bradfield JP, Russell RK, et al. Diverse genomewide association studies associate the IL12/IL23 pathway with Crohn Disease. AmJHumGenet 2009; 84(3): Franke A, McGovern DP, Barrett JC, Wang K, Radford-Smith GL, Ahmad T, et al. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. NatGenet 2010; 42(12): Anderson CA, Boucher G, Lees CW, Franke A, D'Amato M, Taylor KD, et al. Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. NatGenet 2011; 43(3): McGovern DP, Gardet A, Torkvist L, Goyette P, Essers J, Taylor KD, et al. Genome-wide association identifies multiple ulcerative colitis susceptibility loci. NatGenet 2010; 42(4): Parkes M, Barrett JC, Prescott NJ, Tremelling M, Anderson CA, Fisher SA, et al. Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn's disease susceptibility. NatGenet 2007; 39(7): Yamazaki K, McGovern D, Ragoussis J, Paolucci M, Butler H, Jewell D, et al. Single nucleotide polymorphisms in TNFSF15 confer susceptibility to Crohn's disease. HumMolGenet 2005; 14(22): Baldassano RN, Bradfield JP, Monos DS, Kim CE, Glessner JT, Casalunovo T, et al. Association of variants of the interleukin-23 receptor gene with susceptibility to pediatric Crohn's disease. ClinGastroenterolHepatol 2007; 5(8): Roberts RL, Barclay ML. Current relevance of pharmacogenetics in immunomodulation treatment for Crohn's disease. JGastroenterolHepatol 2012; 27(10): Rioux JD, Xavier RJ, Taylor KD, Silverberg MS, Goyette P, Huett A, et al. Genome-wide association study identifies new susceptibility loci for Crohn disease and implicates autophagy in disease pathogenesis. NatGenet 2007; 39(5):

91 136. Gutierrez A, Scharl M, Sempere L, Holler E, Zapater P, Almenta I, et al. Genetic susceptibility to increased bacterial translocation influences the response to biological therapy in patients with Crohn's disease. Gut 2014; 63(2): Duraes C, Machado JC, Portela F, Rodrigues S, Lago P, Cravo M, et al. Phenotype-genotype profiles in Crohn's disease predicted by genetic markers in autophagy-related genes (GOIA study II). InflammBowelDis 2013; 19(2): Guo C, Ahmad T, Beckly J, Cummings JR, Hancock L, Geremia A, et al. Association of caspase- 9 and RUNX3 with inflammatory bowel disease. Tissue Antigens 2011; 77(1):

92 8. ČLANEK, VEZAN NA TEMO DOKTORSKE DISERTACIJE KODER, Silvo, REPNIK, Katja, FERKOLJ, Ivan, PERNAT DROBEŽ, Cvetka, SKOK, Pavel, WEERSMA, Rinse K., POTOČNIK, Uroš. Genetic polymorphism in ATG16L1 gene influences the response to adalimumab in Crohn's disease patients. Pharmacogenomics, ISSN , 2015, vol. 16, no. 3, str , doi: /pgs [COBISS.SI-ID ] 84

93 85

94 86

95 87

96 88

97 89

98 90

99 91

100 92

101 93

102 94

103 95

104 96

ALI JE DOLGOTRAJNA UPORABA ZAVIRALCEV PROTONSKE ČRPALKE VARNA?

ALI JE DOLGOTRAJNA UPORABA ZAVIRALCEV PROTONSKE ČRPALKE VARNA? ALI JE DOLGOTRAJNA UPORABA ZAVIRALCEV PROTONSKE ČRPALKE VARNA? Darja Logar, dr. med. Barbara Mazej Poredoš, dr. med. Ljubljana, 18. 10. 2012 Dandanes se izjemno povečuje poraba ZPČ, čemur smo priča tudi

More information

Antikoagulantno zdravljenje

Antikoagulantno zdravljenje Antikoagulantno zdravljenje (novosti s kongresa ASH 2010) Irena Umek Bricman Oddelek za interno medicino SB Slovenj Gradec Podčetrtek, 15.04.2010 Trajanje antikoagulantne terapije Priporočila: 8th ACCP

More information

HEMATURIJA PRI OTROCIH HAEMATURIA IN CHILDREN

HEMATURIJA PRI OTROCIH HAEMATURIA IN CHILDREN HEMATURIJA PRI OTROCIH HAEMATURIA IN CHILDREN - ABSTRACT - - UVOD IN OPREDELITEV POJMOV Hematurija je prisotnost krvi v urinu. - - - mesecev. Lahko je - - Hematurija je sicer lahko pomemben znak bolezni

More information

GINKGO BILOBA IN MISELNE SPOSOBNOSTI. Avtorji: Jelena Raković, Božica Ljušanin Grbavac 18. modularna skupina April 2015

GINKGO BILOBA IN MISELNE SPOSOBNOSTI. Avtorji: Jelena Raković, Božica Ljušanin Grbavac 18. modularna skupina April 2015 GINKGO BILOBA IN MISELNE SPOSOBNOSTI Avtorji: Jelena Raković, Božica Ljušanin Grbavac 18. modularna skupina April 2015 KLINIČNO VPRAŠANJE Ali uporaba standardiziranih pripravkov Ginkgo bilobe izboljšuje

More information

Uporaba mikofenolat mofe0la v zdravljenju SLE. Rok Ješe Klinični oddelek za revmatologijo UKC Ljubljana

Uporaba mikofenolat mofe0la v zdravljenju SLE. Rok Ješe Klinični oddelek za revmatologijo UKC Ljubljana Uporaba mikofenolat mofe0la v zdravljenju SLE Rok Ješe Klinični oddelek za revmatologijo UKC Ljubljana Mikofenolat mofe=l (MMF) 2- morfolinoe=lni ester mikofenolne kisline produkt plesni Penicillium brevicompactum

More information

Analiza preživetja. Izbrana poglavja iz biomedicinske informatike 2011/2012, LBM2. Asist. dr. Igor Locatelli, mag. farm.

Analiza preživetja. Izbrana poglavja iz biomedicinske informatike 2011/2012, LBM2. Asist. dr. Igor Locatelli, mag. farm. Analiza preživetja Izbrana poglavja iz biomedicinske informatike 2011/2012, LBM2 Asist. dr. Igor Locatelli, mag. farm. Ljubljana, 16. 12. 2011 Analiza preživetja Survival analysis Proučevanje (modeliranje)

More information

ALI SO PRIPRAVKI GLUKOZAMINA UČINKOVITI V TERAPIJI GONARTROZE?

ALI SO PRIPRAVKI GLUKOZAMINA UČINKOVITI V TERAPIJI GONARTROZE? ALI SO PRIPRAVKI GLUKOZAMINA UČINKOVITI V TERAPIJI GONARTROZE? SPECIALIZACIJA IZ DRUŽINSKE MEDICINE MODUL: NA DOKAZIH TEMELJEČA MEDICINA 16. SKUPINA AVTORJI: MIRJANA NINKOV MILA MRŠIĆ OLIVER ILIĆ OPIS

More information

Priporočila za zdravljenje primarne imunske trombocitopenije. Barbara Skopec

Priporočila za zdravljenje primarne imunske trombocitopenije. Barbara Skopec Priporočila za zdravljenje primarne imunske trombocitopenije Barbara Skopec ITP = Idiopatična trombocitopenična purpura ITP = primarna imunska trombocitopenija Rodeghiero F, et al. Blood 2009;113:2386

More information

1UVOD ULCEROZNI KOLITIS- KLINIČNI PRIMER ULCERATIVE COLITIS- CLINICAL CASE

1UVOD ULCEROZNI KOLITIS- KLINIČNI PRIMER ULCERATIVE COLITIS- CLINICAL CASE ULCEROZNI KOLITIS- KLINIČNI PRIMER ULCERATIVE COLITIS- CLINICAL CASE AVTOR / AUTHOR: Luka Vilč, mag.farm. JZ celjske lekar, Lekarna Gregorčičeva Gregorčičeva 5 3000 Celje NASLOV ZA DOPISOVANJE / CORRESPONDENCE:

More information

Tuberozna skleroza. Anamarija Meglič. Klinični oddelek za nefrologijo Pediatrična klinika, UKC Ljubljana

Tuberozna skleroza. Anamarija Meglič. Klinični oddelek za nefrologijo Pediatrična klinika, UKC Ljubljana Tuberozna skleroza Anamarija Meglič Klinični oddelek za nefrologijo Pediatrična klinika, UKC Ljubljana Strokovni sestanek Kranjska gora, 22. in 23. november 2013 Meglič A. Tuberozna skleroza (TS) TSC tuberous

More information

TMA - pogled nefrologa

TMA - pogled nefrologa TMA - pogled nefrologa Andreja Marn Pernat Klinični oddelek za nefrologijo UKC Ljubljana Plazmafereza s svežo zmrznjeno plazmo metoda izbora za zdravljenje TTP/aHUS Brez plazmafereze s SZP je bila smrtnost

More information

Modul: Na izsledkih temelječa medicina. Veljko Ignjatović

Modul: Na izsledkih temelječa medicina. Veljko Ignjatović Modul: Na izsledkih temelječa medicina Veljko Ignjatović Opis problema: Ambulanto družinske medicine, večkrat na leto obišče gospa srednjih let, po poklicu uslužbenka v banki, zaradi suhega kašlja, hripavosti

More information

Glavni bioprodukti v letih od Vir:

Glavni bioprodukti v letih od Vir: Biofarmacevtiki Glavni bioprodukti v letih od 2005-2007 Vir: Vir: Ključne prioritete za trajnostno proizvodnjo Deleži biofarmacevtikov na tržišču proteinski terapevtiki leta 2006 Folikle stimulirajoči

More information

Predstavitev smernic za osteoporozo

Predstavitev smernic za osteoporozo Predstavitev smernic za osteoporozo mag. Suzana Kert, dr. med., spec. spl. med. Zdravstveni dom Maribor Katedra za DM MF Lj in Mb 16. modularna skupina (02.04.2014) 1 Viri http://www. endodiab.si/ priporocila/

More information

DEPRESIJA IN SLADKORNA BOLEZEN

DEPRESIJA IN SLADKORNA BOLEZEN Zdrav Vestn 2008; 77: 389 94 389 Pregledni prispevek/review article DEPRESIJA IN SLADKORNA BOLEZEN DEPRESSION AND DIABETES MELLITUS Simona Primožič, 1 Maja Ravnik-Oblak, 2 Rok Tavčar, 1 Mojca Zvezdana

More information

DEJAVNIKI TVEGANJA ZA PARODONTALNO BOLEZEN PRI PREBIVALCIH LJUBLJANE Risk factors for periodontal disease among residents of Ljubljana

DEJAVNIKI TVEGANJA ZA PARODONTALNO BOLEZEN PRI PREBIVALCIH LJUBLJANE Risk factors for periodontal disease among residents of Ljubljana skaleric_e_skaleric_e.qxd 27.10.2014 11:22 Page 28 Zobozdrav Vestn 2014; 69: 28--35 28 DEJAVNIKI TVEGANJA ZA PARODONTALNO BOLEZEN PRI PREBIVALCIH LJUBLJANE Risk factors for periodontal disease among residents

More information

Efficacy and Safety of Treatment for Pediatric IBD

Efficacy and Safety of Treatment for Pediatric IBD Efficacy and Safety of Treatment for Pediatric IBD Andrew B. Grossman MD Co-Director, Center for Pediatric Inflammatory Bowel Disease Associate Professor of Clinical Pediatrics Division of Gastroenterology,

More information

Prevalenca erektilnih motenj pri bolnikih s sladkorno boleznijo

Prevalenca erektilnih motenj pri bolnikih s sladkorno boleznijo Erektilne motnje Prim.doc.dr. Maja Ravnik-Oblak, dr.med., svetnica Univerzitetni klinični center Ljubljana, Klinični oddelek za endokrinologijo, diabetes in presnovne bolezni Uvod Erektilne motnje imajo

More information

How do I choose amongst medicines for inflammatory bowel disease. Maria T. Abreu, MD

How do I choose amongst medicines for inflammatory bowel disease. Maria T. Abreu, MD How do I choose amongst medicines for inflammatory bowel disease Maria T. Abreu, MD Overview of IBD Pathogenesis Bacterial Products Moderately Acutely Inflamed Chronic Inflammation = IBD Normal Gut Mildly

More information

Indications for use of Infliximab

Indications for use of Infliximab Indications for use of Infliximab Moscow, June 10 th 2006 Prof. Dr. Dr. Gerhard Rogler Klinik und Poliklinik für Innere Medizin I Universität Regensburg Case report 1989: Diagnosis of Crohn s disease of

More information

Refraktarna mikrocitna hipokromna anemija

Refraktarna mikrocitna hipokromna anemija Refraktarna mikrocitna hipokromna anemija Klinični oddelek za hematologijo, onkologijo in transplantacijo krvotvornih matičnih celic Pediatrična klinika UKC Ljubljana Simona Avčin, Maruša Debeljak, Janez

More information

Zdravljenje trajne KOPB Akutno poslabšanje KOPB

Zdravljenje trajne KOPB Akutno poslabšanje KOPB Prof. dr.stanislav Šuškovič Univerzitetna klinika za pljučne bolezni in alergijo Bolnišnica Golnik 4204 Golnik Zdravljenje trajne KOPB Akutno poslabšanje KOPB Golnik, 6.5.2011 ZDRAVLJENJE KOPB VZDRŽEVALNO

More information

KRONIČNA URTIKARIJA IN NJEN VPLIV NA KAKOVOST življenja BOLNIKOV

KRONIČNA URTIKARIJA IN NJEN VPLIV NA KAKOVOST življenja BOLNIKOV KRONIČNA URTIKARIJA IN NJEN VPLIV NA KAKOVOST življenja BOLNIKOV ChRONIC URTICARIA AND ITS INFLUENCE ON PATIENTS' QUALITY OF LIFE AVTOR / AUThOR: Urška Kramberger, univ. kozm. 1 Doc. dr. Nada Kecelj Leskovec,

More information

POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA

POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA 1. IME ZDRAVILA HYZAAR 100 mg/12,5 mg losartanum et hydrochlorothiazidum (kalii losartanas et hydrochlorothiazidum) 2. KAKOVOSTNA IN KOLIČINSKA SESTAVA HYZAAR 100

More information

Omic Approaches in Biomarker Discovery: New Perspectives in Cancer Diagnostics and Therapy

Omic Approaches in Biomarker Discovery: New Perspectives in Cancer Diagnostics and Therapy Omic Approaches in Biomarker Discovery: New Perspectives in Cancer Diagnostics and Therapy Strategies and approaches in looking for diagnostic / prognostic cancer markers Before-genomic versus post-genomic

More information

POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA

POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA 1. IME ZDRAVILA Sorel combo 50 mikrogramov/500 mikrogramov v 1 g mazilo 2. KAKOVOSTNA IN KOLIČINSKA SESTAVA En gram mazila vsebuje 50 mikrogramov kalcipotriola (v

More information

Zdravila s farmakološkim učinkom na srcu

Zdravila s farmakološkim učinkom na srcu Zdravila s farmakološkim učinkom na srcu Prof. dr. Mojca Kržan Inštitut za farmakologijo in eksperimentalno toksikologijo, Medicinska fakulteta, Univerza v Ljubljani Zdravila s farmakološkim učinkom na

More information

SPC (SI) Metoject 10 mg/ml; Date of latest revision:

SPC (SI) Metoject 10 mg/ml; Date of latest revision: POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA 1. IME ZDRAVILA Metoject 7,5 mg/0,75 ml raztopina za injiciranje v napolnjeni injekcijski brizgi Metoject 10 mg/1 ml raztopina za injiciranje v napolnjeni injekcijski

More information

GENETSKA IN FARMAKOGENETSKA ANALIZA IZBRANIH GENOV PRI BOLNIKIH Z ASTMO V SLOVENIJI

GENETSKA IN FARMAKOGENETSKA ANALIZA IZBRANIH GENOV PRI BOLNIKIH Z ASTMO V SLOVENIJI UNIVERZA V LJUBLJANI BIOTEHNIŠKA FAKULTETA Mateja ŢAVBI GENETSKA IN FARMAKOGENETSKA ANALIZA IZBRANIH GENOV PRI BOLNIKIH Z ASTMO V SLOVENIJI DOKTORSKA DISERTACIJA Ljubljana, 2016 UNIVERZA V LJUBLJANI BIOTEHNIŠKA

More information

VPLIV SOČASNE UPORABE MELOKSIKAMA IN DEKSAMETAZONA Z MIZOPROSTOLOM NA VSEBNOST PROSTAGLANDINOV, LEVKOTRIENOV IN TROMBOKSANOV V SERUMU PRI PSIH

VPLIV SOČASNE UPORABE MELOKSIKAMA IN DEKSAMETAZONA Z MIZOPROSTOLOM NA VSEBNOST PROSTAGLANDINOV, LEVKOTRIENOV IN TROMBOKSANOV V SERUMU PRI PSIH UNIVERZA V LJUBLJANI VETERINARSKA FAKULTETA Podiplomski študij biomedicine TINA ROŠKAR VPLIV SOČASNE UPORABE MELOKSIKAMA IN DEKSAMETAZONA Z MIZOPROSTOLOM NA VSEBNOST PROSTAGLANDINOV, LEVKOTRIENOV IN TROMBOKSANOV

More information

An Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease. David A. Schwartz, MD

An Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease. David A. Schwartz, MD An Update on the Biologic Treatment for Patients with Inflammatory Bowel Disease David A. Schwartz, MD Director, Inflammatory Bowel Disease Center Associate Professor of Medicine Vanderbilt University

More information

Cepljenje odraslih v Sloveniji. Prof. dr. Milan Čižman, dr. med. Klinika za infekcijske bolezni in vročinska stanja, UKCL

Cepljenje odraslih v Sloveniji. Prof. dr. Milan Čižman, dr. med. Klinika za infekcijske bolezni in vročinska stanja, UKCL Cepljenje odraslih v Sloveniji Prof. dr. Milan Čižman, dr. med. Klinika za infekcijske bolezni in vročinska stanja, UKCL Literatura http://www.ivz.si/cepljenje/strokovna_javnost/program _cepljenja?pi=18&_18_view=item&_18_newsid=2016

More information

Glukokortikoidi v nefrologiji II: indikacije in odmerjanje

Glukokortikoidi v nefrologiji II: indikacije in odmerjanje Glukokortikoidi v nefrologiji II: indikacije in odmerjanje Glucocorticoids in nephrology II: indications and dosage Jernej Pajek Klinični oddelek za nefrologijo, Univerzitetni klinični center Ljubljana,

More information

POMEN DOLOČANJA PROSTATNO SPECIFIČNEGA PROANTIGENA PRI BOLNIKIH S KARCINOMOM PROSTATE

POMEN DOLOČANJA PROSTATNO SPECIFIČNEGA PROANTIGENA PRI BOLNIKIH S KARCINOMOM PROSTATE UNIVERZA V LJUBLJANI FAKULTETA ZA FARMACIJO ANDREJA BANOVEC POMEN DOLOČANJA PROSTATNO SPECIFIČNEGA PROANTIGENA PRI BOLNIKIH S KARCINOMOM PROSTATE UNIVERZITETNI ŠTUDIJ FARMACIJE Ljubljana, 2013 UNIVERZA

More information

15. DIABETIČNA LEDVIČNA BOLEZEN Jelka Zaletel Vrtovec, Draženka Pongrac Barlovič

15. DIABETIČNA LEDVIČNA BOLEZEN Jelka Zaletel Vrtovec, Draženka Pongrac Barlovič 15. DIABETIČNA LEDVIČNA BOLEZEN Jelka Zaletel Vrtovec, Draženka Pongrac Barlovič Bolniki s sladkorno boleznijo tipa 2 sodijo med ljudi s povečanim tveganjem za kronično ledvično bolezen, najpogostejša

More information

2KLINIČNA SLIKA 1UVOD SHIZOFRENIJA PATOFIZIOLOGIJA, ETIOLOGIJA, EPIDEMIOLOGIJA SCHIZOPHRENIA PATHOPHYSIOLOGY, ETIOLOGY, EPIDEMIOLOGY POVZETEK POVZETEK

2KLINIČNA SLIKA 1UVOD SHIZOFRENIJA PATOFIZIOLOGIJA, ETIOLOGIJA, EPIDEMIOLOGIJA SCHIZOPHRENIA PATHOPHYSIOLOGY, ETIOLOGY, EPIDEMIOLOGY POVZETEK POVZETEK SHIZOFRENIJA PATOFIZIOLOGIJA, ETIOLOGIJA, EPIDEMIOLOGIJA SCHIZOPHRENIA PATHOPHYSIOLOGY, ETIOLOGY, EPIDEMIOLOGY AVTOR / AUTHOR: red. prof. dr. Blanka Kores Plesničar, dr. med., spec. psihiatrije, višja

More information

Ulcerative Colitis Therapy. Faculty Disclosure. Acknowledgements 28/11/2013. Amy Morse November 30/13

Ulcerative Colitis Therapy. Faculty Disclosure. Acknowledgements 28/11/2013. Amy Morse November 30/13 Ulcerative Colitis Therapy Amy Morse November 30/13 GI for GP s Jasper AB Faculty Disclosure Faculty: Amy Morse Relationships with commercial interests: Grants/Research Support: Therapeutic Fellowship

More information

NUTRIENT INTAKE VARIABILITY INDUCED BY PROCESSING OF FOOD DIARY DATA: A PILOT STUDY

NUTRIENT INTAKE VARIABILITY INDUCED BY PROCESSING OF FOOD DIARY DATA: A PILOT STUDY COBISS: 1.01 Agris category code: S40, Q04 NUTRIENT INTAKE VARIABILITY INDUCED BY PROCESSING OF FOOD DIARY DATA: A PILOT STUDY Tamara PUŠ 1, Ksenija PODGRAJŠEK 2, Marjan SIMČIČ 3 Received October 10, 2012;

More information

FARMACEVTSKI VESTNIK št. 5

FARMACEVTSKI VESTNIK št. 5 Farm Vestn 2014; 65: 331 394; UDK 615 CODEN FMVTA, SLO ISSN 0014-8229 december 2014, letnik 65 FARMACEVTSKI VESTNIK št. 5 OSREDNJA TEMA: BENIGNA HIPERPLAZIJA PROSTATE STROKOVNO GLASILO SLOVENSKE FARMACIJE

More information

Sladkorna bolezen je posledica pomanjkanja hormona inzulina ali pa njegovega zmanjšanega učinka (inzulinska rezistenca).

Sladkorna bolezen je posledica pomanjkanja hormona inzulina ali pa njegovega zmanjšanega učinka (inzulinska rezistenca). Sladkorna bolezen pri otrocih in mladostnikih - tip 1 Nataša Bratina*, Mojca Žerjav Tanšek, Nina Bratanič, Ciril Kržišnik, Magdalena Avbelj, Tadej Battelino Pediatrična klinika, Klinični oddelek za endokrinologijo,

More information

FITNESS AS DETERMINANTS OF BODY BALANCE IN ELDERLY MEN

FITNESS AS DETERMINANTS OF BODY BALANCE IN ELDERLY MEN Kinesiologia Slovenica, 12, 1, 39 47 (2006) Faculty of Sport, University of Ljubljana, ISSN 1318-2269 39 Janusz Maciaszek BODY COMPOSITION AND MOTOR FITNESS AS DETERMINANTS OF BODY BALANCE IN ELDERLY MEN

More information

XIV. Fajdigovi dnevi

XIV. Fajdigovi dnevi XIV. Fajdigovi dnevi Zbornik predavanj Kranjska Gora, 19. in 20. oktober 2012 Urednika: Zalika Klemenc-Ketiš, Aleksander Stepanovič Družinska medicina 2012, letnik 10, supplement 3 Kranjska Gora, oktober

More information

Smernice za zdravljenje s kanabinoidi in klinična pot zdravljenja s kanabinoidi

Smernice za zdravljenje s kanabinoidi in klinična pot zdravljenja s kanabinoidi Smernice za zdravljenje s kanabinoidi in klinična pot zdravljenja s kanabinoidi Avtor: prim. Josipina Ana Červek, dr. med. Ljubljana, december 2016 Onkološki inštitut Ljubljana 1 POVZETEK V onkologiji

More information

Obravnava bolnika z akutno okužbo sečil v ambulanti zdravnika družinske medicine

Obravnava bolnika z akutno okužbo sečil v ambulanti zdravnika družinske medicine 1 Obravnava bolnika z akutno okužbo sečil v ambulanti zdravnika družinske medicine mag. Suzana Kert, dr. med., spec. spl. med. Katedra za družinsko medicino Medicinska fakulteta Ljubljana in Maribor Zdravstveni

More information

Carefirst.+.V Family of health care plans

Carefirst.+.V Family of health care plans Carefirst.+.V Family of health care plans CVS care mark POLICY Document for ENTYVIO The overall objective of this policy is to support the appropriate and cost effective use of the medication, specific

More information

Novosti v obravnavi pljučne bolezni pri otrocih in mladostnikih s cistično fibrozo

Novosti v obravnavi pljučne bolezni pri otrocih in mladostnikih s cistično fibrozo Novosti v obravnavi pljučne bolezni pri otrocih in mladostnikih s cistično fibrozo Up-to-date management of lung disease in children and adolescents with cystic fibrosis Marina Praprotnik, 1 Ana Kotnik

More information

Ivanovski, Novak, Vidmar/ Rehabilitacija - letn. XVI, št. 2 (2017) Univerzitetni rehabilitacijski inštitut Republike Slovenije Soča, Ljubljana 2

Ivanovski, Novak, Vidmar/ Rehabilitacija - letn. XVI, št. 2 (2017) Univerzitetni rehabilitacijski inštitut Republike Slovenije Soča, Ljubljana 2 ZAPLETI V ČASU REHABILITACIJE PO ZLOMIH V PREDELU KOLKA IN NJIHOVA POVEZANOST Z IZIDOM REHABILITACIJE COMPLICATIONS DURING REHABILITATION AFTER HIP FRACTURE AND THEIR ASSOCIATION WITH REHABILITATION OUTCOME

More information

Pharmacotherapy of Inflammatory Bowel Disorder

Pharmacotherapy of Inflammatory Bowel Disorder PHARMACY / MEDICAL POLICY 5.01.563 Pharmacotherapy of Inflammatory Bowel Disorder Effective Date: Feb. 14, 2018 Last Revised: April 1, 2018 Replaces: Extracted from 5.01.550 RELATED MEDICAL POLICIES: 11.01.523

More information

Prikaz dveh primerov zastrupitve z ogljikovim monoksidom Carbon monoxide intoxication: A report of two cases

Prikaz dveh primerov zastrupitve z ogljikovim monoksidom Carbon monoxide intoxication: A report of two cases Prikaz dveh primerov zastrupitve z ogljikovim monoksidom Carbon monoxide intoxication: A report of two cases Avtor / Author Emina Hajdinjak 1, Andrej Markota 2, Alenka Strdin Košir 2, Simona Kirbiš 2,3

More information

19. DIABETIČNA LEDVIČNA BOLEZEN

19. DIABETIČNA LEDVIČNA BOLEZEN 19. DIABETIČNA LEDVIČNA BOLEZEN Jelka Zaletel, Draženka Pongrac Barlovič, Radovan Hojs Bolniki s sladkorno boleznijo tipa 2 imajo povečano tveganje za kronično ledvično bolezen, pri čemer je najpogostejša

More information

Farmakogenetika in osebna medicina

Farmakogenetika in osebna medicina Farmakogenetika in osebna medicina - od genetskega testiranja do klinične prakse prof. dr. Vita Dolžan, dr. med. Laboratorij za farmakogenetiko, Inštitut za biokemijo Medicinska fakulteta, Univerza v Ljubljani

More information

INFLIXIMAB Remicade (infliximab), Inflectra (infliximab-dyyb), Ixifi* (infliximabqbtx), Renflexis (infliximab-abda)

INFLIXIMAB Remicade (infliximab), Inflectra (infliximab-dyyb), Ixifi* (infliximabqbtx), Renflexis (infliximab-abda) Pre - PA Allowance None Prior-Approval Requirements Diagnoses Patient must have ONE of the following: 6 years of age or older 1. Moderate to severe Crohn s disease (CD) a. Patient has fistulizing disease

More information

BAKTERIOCINI IZVEDLJIVA ALTERNATIVA ANTIBIOTIKOM?

BAKTERIOCINI IZVEDLJIVA ALTERNATIVA ANTIBIOTIKOM? UNIVERZITETNI DOKTORSKI ŠTUDIJ BIOMEDICINA SEMINAR pri predmetu Temeljna medicinska mikrobiologija Petra Raspor Lainšček, dr. vet. med BAKTERIOCINI IZVEDLJIVA ALTERNATIVA ANTIBIOTIKOM? MODERATOR SEMINARJA

More information

NAVODILO ZA UPORABO. Liskantin 250 mg tablete primidon

NAVODILO ZA UPORABO. Liskantin 250 mg tablete primidon NAVODILO ZA UPORABO Liskantin 250 mg tablete primidon Pred začetkom jemanja natančno preberite navodilo! Navodilo shranite. Morda ga boste želeli ponovno prebrati. Če imate dodatna vprašanja, se posvetujte

More information

RAZPOREDITEV GENOTIPOV VIRUSA HEPATITISA C V SLOVENIJI V LETIH

RAZPOREDITEV GENOTIPOV VIRUSA HEPATITISA C V SLOVENIJI V LETIH UNIVERZA V LJUBLJANI BIOTEHNIŠKA FAKULTETA ENOTA MEDODDELČNEGA ŠTUDIJA MIKROBIOLOGIJE Gregor ZUPAN RAZPOREDITEV GENOTIPOV VIRUSA HEPATITISA C V SLOVENIJI V LETIH 2003-2006 DIPLOMSKO DELO Univerzitetni

More information

Potek bolezni pri bolnicah s HER-2 pozitivnim rakom dojk

Potek bolezni pri bolnicah s HER-2 pozitivnim rakom dojk Potek bolezni pri bolnicah s HER-2 pozitivnim rakom dojk D. Ribnikar, Š. Fink, S. Frković Grazio, H. Lešničar, A. Sadikov in T. Čufer Uvod Rak dojke je najpogostejša maligna bolezen pri ženskah. Tako kot

More information

ANALIZA AVTOMATSKEGA SISTEMA ZA SPREMLJANJE INTERAKCIJ MED ZDRAVILI

ANALIZA AVTOMATSKEGA SISTEMA ZA SPREMLJANJE INTERAKCIJ MED ZDRAVILI ANALIZA AVTOMATSKEGA SISTEMA ZA SPREMLJANJE INTERAKCIJ MED ZDRAVILI ANALYSIS OF THE AUTOMATED DRUG-DRUG INTERACTION SYSTEM AVTORJI / AUTHORS: 1, Sabina Šoštarić, mag. farm., Pieter Cornu, PharmD, Alain

More information

O pravilni in varni uporabi zdravil Imunski sistem

O pravilni in varni uporabi zdravil Imunski sistem 13. Dan slovenskih lekarn 26. september 2017 O pravilni in varni uporabi zdravil Imunski sistem LEKARNIŠKA ZBORNICA SLOVENIJE 29 25 13. Dan slovenskih lekarn 26. september 2017 O pravilni in varni uporabi

More information

September 12, 2015 Millie D. Long MD, MPH, FACG

September 12, 2015 Millie D. Long MD, MPH, FACG Update on Biologic Therapy in 2015 September 12, 2015 Millie D. Long MD, MPH, FACG Assistant Professor of Medicine Inflammatory Bowel Disease Center University of North Carolina-Chapel Hill Outline Crohn

More information

New discoveries in prostate cancer pathogenesis. Novosti pri patogenezi raka prostate

New discoveries in prostate cancer pathogenesis. Novosti pri patogenezi raka prostate New discoveries in prostate cancer pathogenesis Novosti pri patogenezi raka prostate Gregor Mikuž Institute of Pathology, Medical University Innsbruck, Austria Background. Through PSA screening the rate

More information

Nuklearno medicinske preiskave možganov

Nuklearno medicinske preiskave možganov Nuklearno medicinske preiskovalne metode Nuklearno medicinske preiskave možganov Marko Grmek Nuklearno medicinske preiskave možganov PET/CT možganov z 18 F-FDG Perfuzijska scintigrafija možganov (SPECT

More information

TALASEMIJE PRI OTROCIH V SLOVENIJI V LETIH OD 2001 DO 2011

TALASEMIJE PRI OTROCIH V SLOVENIJI V LETIH OD 2001 DO 2011 TALASEMIJE PRI OTROCIH V SLOVENIJI V LETIH OD 2001 DO 2011 Aleksandra Zorko Brodnik, dr.med., UKC Maribor prim. Majda Benedik Dolničar, dr. med., UKC Ljubljana Olimje, 13.4.2012 MOTNJE V SINTEZI HEMOGLOBINA

More information

CURRENT DIAGNOSTICS AND TREATMENT OF TENDINOPATHY

CURRENT DIAGNOSTICS AND TREATMENT OF TENDINOPATHY SODOBNA DIAGNOSTIKA IN ZDRAVLJENJE TENDINOPATIJ CURRENT DIAGNOSTICS AND TREATMENT OF TENDINOPATHY Martin Zorko, dr. med. UKC Ljubljana, Klinični inštitut za medicino dela, prometa in športa, Center za

More information

Pharmacotherapy of Inflammatory Bowel Disorder

Pharmacotherapy of Inflammatory Bowel Disorder PHARMACY / MEDICAL POLICY 5.01.563 Pharmacotherapy of Inflammatory Bowel Disorder Effective Date: May 1, 2018 Last Revised: April 18, 2018 Replaces: Extracted from 5.01.550 RELATED MEDICAL POLICIES: 11.01.523

More information

Zaščitni pleiotropni učinki statinov

Zaščitni pleiotropni učinki statinov Zaščitni pleiotropni učinki statinov Beneficial Pleiotropic Effects of Statins Mojca Lunder,1, 2 Lovro Žiberna,1 Gorazd Drevenšek,1 Mišo Šabovič2 1 Inštitut za farmakologijo in eksperimentalno toksikologijo,

More information

Navodilo za uporabo. Mofenstra 4 mg zrnca montelukast. za otroke, stare 6 mesecev do 5 let

Navodilo za uporabo. Mofenstra 4 mg zrnca montelukast. za otroke, stare 6 mesecev do 5 let Navodilo za uporabo Mofenstra 4 mg zrnca montelukast za otroke, stare 6 mesecev do 5 let Pred uporabo natančno preberite navodilo, preden vaš otrok začne jemati zdravilo, ker vsebuje za vas pomembne podatke!

More information

Immune Modulating Drugs Prior Authorization Request Form

Immune Modulating Drugs Prior Authorization Request Form Patient: HPHC member ID #: Requesting provider: Phone: Servicing provider: Diagnosis: Contact for questions (name and phone #): Projected start and end date for requested Requesting provider NPI: Fax:

More information

Pomen humanih virusov papiloma pri odkrivanju in preprečevanju raka materničnega vratu - kje smo danes

Pomen humanih virusov papiloma pri odkrivanju in preprečevanju raka materničnega vratu - kje smo danes Pomen humanih virusov papiloma pri odkrivanju in preprečevanju raka materničnega vratu - kje smo danes Marjetka Uršič Vrščaj 1, Sonja Bebar 1, Andrej Možina 2, Stelio Rakar 2, Iztok Takač 3, Vida Stržinar

More information

Medical Therapy for Pediatric IBD: Efficacy and Safety

Medical Therapy for Pediatric IBD: Efficacy and Safety Medical Therapy for Pediatric IBD: Efficacy and Safety Betsy Maxwell, MD Assistant Professor of Clinical Pediatrics Division of Gastroenterology, Hepatology, and Nutrition Pediatric IBD: Defining Remission

More information

DODATEK I POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA

DODATEK I POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA DODATEK I POVZETEK GLAVNIH ZNAČILNOSTI ZDRAVILA 1 1. IME ZDRAVILA BYDUREON 2 mg prašek in topilo za suspenzijo s podaljšanim sproščanjem za injiciranje 2. KAKOVOSTNA IN KOLIČINSKA SESTAVA Ena viala vsebuje

More information

PETRA JANČAR DIPLOMSKA NALOGA

PETRA JANČAR DIPLOMSKA NALOGA UNIVERZA V LJUBLJANI FAKULTETA ZA FARMACIJO PETRA JANČAR DIPLOMSKA NALOGA Univerzitetni program farmacije Ljubljana, 2008 UNIVERZA V LJUBLJANI FAKULTETA ZA FARMACIJO PETRA JANČAR ANALIZA UČINKOVITOSTI

More information

Personalized Medicine in IBD

Personalized Medicine in IBD Personalized Medicine in IBD Anita Afzali MD, MPH Assistant Professor of Medicine Director, Inflammatory Bowel Diseases Program University of Washington Harborview Medical Center CCFA April 2 nd, 2016

More information

AKUTNO ŠEPANJE PRI OTROKU THE ACUTELY LIMPING CHILD

AKUTNO ŠEPANJE PRI OTROKU THE ACUTELY LIMPING CHILD 192 Slov Pediatr 2011; 18: 192-198 Pregledni članek / Review article AKUTNO ŠEPANJE PRI OTROKU THE ACUTELY LIMPING CHILD A. Močnik 1, M. Bec 2 (1) Splošna bolnišnica Jesenice, Jesenice (2) Pediatrična

More information

Self-reported chronic conditions in student population in Slovenia

Self-reported chronic conditions in student population in Slovenia Chronic conditions in student population Self-reported chronic conditions in student population in Slovenia Prisotnost kroničnih bolezni pri slovenskih študentih Zalika Klemenc-Ketiš,¹ Žiga Hladnik,² Danica

More information

Epitelijski rak jajčnikov, rak jajcevodov, primarni peritonealni serozni karcinom (PPSC)

Epitelijski rak jajčnikov, rak jajcevodov, primarni peritonealni serozni karcinom (PPSC) Epitelijski rak jajčnikov, rak jajcevodov, primarni peritonealni serozni karcinom (PPSC) Priporočila za sistemsko zdravljenje Erik Škof, Olga Cerar Uvod Epitelijski rak jajčnikov velja za enega najbolj

More information

1OPIS KLINIČNEGA ZAMENJAVA / UKINJANJE TERAPIJE S PSIHOFARMAKI PRIMERA

1OPIS KLINIČNEGA ZAMENJAVA / UKINJANJE TERAPIJE S PSIHOFARMAKI PRIMERA ZAMENJAVA / UKINJANJE TERAPIJE S PSIHOFARMAKI ZAMENJAVA / UKINJANJE TERAPIJE S PSIHOFARMAKI AVTOR / AUTHOR: Ana Banović, mag. farm. 1 Vanja Božič, dr. med., spec. psihiatrije 2 Cvetka Bačar Bole, mag.

More information

AGREEMENT OF PRACTICE IN A SPINAL ORTHOTICS OUTPATIENT

AGREEMENT OF PRACTICE IN A SPINAL ORTHOTICS OUTPATIENT USKLAJENOST DELA V AMBULANTI ZA SPINALNO ORTOTIKO S SMERNICAMI ZDRUŽENJA ZA ZDRAVLJENJE BOLNIKOV S SKOLIOZO (SOSORT) AGREEMENT OF PRACTICE IN A SPINAL ORTHOTICS OUTPATIENT CLINIC WITH THE SOSORT GUIDELINES

More information

HARVARD PILGRIM HEALTH CARE RECOMMENDED MEDICATION REQUEST GUIDELINES

HARVARD PILGRIM HEALTH CARE RECOMMENDED MEDICATION REQUEST GUIDELINES Generic Brand HICL GCN Exception/Other GOLIMUMAB SIMPONI 22533, 22536, 34697, 35001 ROUTE = SUBCUTANE. GUIDELINES FOR USE INITIAL CRITERIA (NOTE: FOR RENEWAL CRITERIA SEE BELOW) 1. Is the request for a

More information

Farmakogenetika v klinični farmakokinetiki

Farmakogenetika v klinični farmakokinetiki Variabilnost v farmakokinetiki Farmakogenetika v klinični farmakokinetiki Igor Locatelli genetski polimorfizem telesna masa bolezenska stanja starost interakcije Interindividualna variabilnost v FK in/ali

More information

Policy #: 061 Latest Review Date: October 2013

Policy #: 061 Latest Review Date: October 2013 Name of Policy: TNF Antagonists and Other Biologics Policy #: 061 Latest Review Date: October 2013 Category: Pharmacy Policy Grade: A Background/Definitions: As a general rule, benefits are payable under

More information

Zdravila in samozdravljenje

Zdravila in samozdravljenje 9. simpozij Sekcije farmacevtov javnih lekarn Lekarna, Od zdravila k človeku Zdravila in samozdravljenje klinični primeri - sklop II 1 Boštjan Martinc, mag. farm., 2 Maja Dobravc, mag. farm. 1 JZ Lekarna

More information

} ZDRUŽENJE PNEVMOLOGOV SLOVENIJE. Zbornik sestanka: Simpozij o kašlju

} ZDRUŽENJE PNEVMOLOGOV SLOVENIJE. Zbornik sestanka: Simpozij o kašlju } ZDRUŽENJE PNEVMOLOGOV SLOVENIJE Zbornik sestanka: Simpozij o kašlju Ljubljana, Medicinska fakulteta 10. maj 2008 Izdajatelj Združenje pnevmologov Slovenije Urednik zbornika Nadja Triller Matjaž Turel

More information

Farmakoterapija koronarne bolezni

Farmakoterapija koronarne bolezni Farmakoterapija koronarne bolezni Jurij Fürst F Zavod za zdravstveno zavarovanje Slovenije Oddelek za zdravila Univerza v Ljubljani Fakulteta za farmacijo Teme epidemiologija dejavniki tveganja za aterosklerozo

More information

3. DIAGNOZA SLADKORNE BOLEZNI

3. DIAGNOZA SLADKORNE BOLEZNI 3. DIAGNOZA SLADKORNE BOLEZNI Maja Ravnik Oblak Mnogo bolnikov s presnovnim sindromom, mejno bazalno glikemijo, moteno toleranco za glukozo in sladkorno boleznijo je neodkritih. Presnovni sindrom, mejna

More information

UNIVERZA V LJUBLJANI FAKULTETA ZA FRAMACIJO SANJA FEMIĆ

UNIVERZA V LJUBLJANI FAKULTETA ZA FRAMACIJO SANJA FEMIĆ UNIVERZA V LJUBLJANI FAKULTETA ZA FRAMACIJO SANJA FEMIĆ IDENTIFIKACIJA PRENAŠALCEV RALOKSIFENA IN NJEGOVIH METABOLITOV TER BAZEDOKSIFENA NA MEMBRANAH CELIC TRANSFECIRANIH S PRENAŠALNIMI PROTEINI IDENTIFICATION

More information

Outline. Biologic Drugs in Inflammatory Bowel Disease Dr. Jason Etzel MD The Vancouver Clinic. Biologic Drugs. Biologic Drugs. Biologic Drugs Anti-TNF

Outline. Biologic Drugs in Inflammatory Bowel Disease Dr. Jason Etzel MD The Vancouver Clinic. Biologic Drugs. Biologic Drugs. Biologic Drugs Anti-TNF Outline Biologic Drugs in Inflammatory Bowel Disease Dr. Jason Etzel MD The Vancouver Clinic Types of biologic drugs How do they work? How effective are they? Safety/Toxicity concerns with biologics Biologic

More information

1UVOD INTERAKCIJE ANTIEPILEPTIČNIH ZDRAVIL KLINIČNI PRIMER ANTI-EPILEPTIC DRUGS INTERACTIONS - CLINICAL CASE

1UVOD INTERAKCIJE ANTIEPILEPTIČNIH ZDRAVIL KLINIČNI PRIMER ANTI-EPILEPTIC DRUGS INTERACTIONS - CLINICAL CASE INTERAKCIJE ANTIEPILEPTIČNIH ZDRAVIL KLINIČNI PRIMER ANTI-EPILEPTIC DRUGS INTERACTIONS - CLINICAL CASE AVTOR / AUTHOR: Valerija Zabavnik, mag. farm., spec. Splošna bolnišnica Murska Sobota NASLOV ZA DOPISOVANJE

More information

11. KORONARNA BOLEZEN Bojan Vrtovec

11. KORONARNA BOLEZEN Bojan Vrtovec 11. KORONARNA BOLEZEN Bojan Vrtovec Koronarna bolezen je napogostejši vzrok zbolevnosti in umrljivosti bolnikov s sladkorno boleznijo tipa 2. Ker gre za zelo ogroženo populacijo, so priporočila za obravnavo

More information

Prehranska ogroženost bolnikov revmatohematološkega

Prehranska ogroženost bolnikov revmatohematološkega Prehranska ogroženost bolnikov revmatohematološkega odseka Dr. Irena Sedej, univ.dipl.inž.živ.teh., klinična dietetičarka 40. Strokovno srečanje MSBZT Slovenije v hemato-onkologiji Podčetrtek, 8. oktober

More information

Emerging g therapies for IBD: A practical approach to positioning. Sequential Therapies for IBD

Emerging g therapies for IBD: A practical approach to positioning. Sequential Therapies for IBD Emerging g therapies for IBD: A practical approach to positioning Stephen B. Hanauer, MD Sequential Therapies for IBD Disease Severity at Presentation Severe Anti-TNF +/IS Cyclosporine (UC) Colectomy (UC)

More information

RAK PROSTATE. CIP - Kataložni zapis o publikaciji Narodna in univerzitetna knjižnica, Ljubljana

RAK PROSTATE. CIP - Kataložni zapis o publikaciji Narodna in univerzitetna knjižnica, Ljubljana RAK PROSTATE RAK PROSTATE Avtorji Simona Borštnar, Dejan Bratuš, Tanja Čufer, Andrej Kmetec, Borut Kragelj, Franc Kramer, Zdenka Ovčak, Sandi Poteko, Boris Sedmak, Boštjan Šeruga, Bojan Štrus Odgovorni

More information

Ob 40. obletnici ustanovitve Slovenskega združenja za gastroenterologijo in hepatologijo

Ob 40. obletnici ustanovitve Slovenskega združenja za gastroenterologijo in hepatologijo Uvodnik / Editorial Ob 40. obletnici ustanovitve Slovenskega združenja za gastroenterologijo in hepatologijo Letos mineva 40 let, odkar je bilo v Rogaški Slatini ustanovljeno strokovno združenje slovenskih

More information

Plodna sposobnost žensk po kirurškem zdravljenju endometrioze

Plodna sposobnost žensk po kirurškem zdravljenju endometrioze Plodna sposobnost žensk po kirurškem zdravljenju endometrioze Martina Ribič-Pucelj Klinični center, Ginekološka klinika Ljubljana Univerza v Ljubljani, Medicinska fakulteta Kjučne besede: endometrioza,

More information

UNIVERZA V MARIBORU FAKULTETA ZA ZDRAVSTVENE VEDE OBRAVNAVA BOLNIKA S PSORIATIČNIM ARTRITISOM NA BIOLOŠKIH ZDRAVILIH.

UNIVERZA V MARIBORU FAKULTETA ZA ZDRAVSTVENE VEDE OBRAVNAVA BOLNIKA S PSORIATIČNIM ARTRITISOM NA BIOLOŠKIH ZDRAVILIH. UNIVERZA V MARIBORU FAKULTETA ZA ZDRAVSTVENE VEDE OBRAVNAVA BOLNIKA S PSORIATIČNIM ARTRITISOM NA BIOLOŠKIH ZDRAVILIH (Diplomsko delo) Maribor, 2015 Barbara Muhič UNIVERZA V MARIBORU FAKULTETA ZA ZDRAVSTVENE

More information