SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
|
|
|
- Monica Stone
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes, Amy Mercado-Berton, Caroline Ong, Sonia Cohen, Linda Hu, Julie A. Blendy, Gregory C. Carlson, Steve J. Siegel, Michael E. Greenberg and Zhaolan (Joe) Zhou Figure S1 Supplementary Figure-1 (Goffin et al) genomic locus 3 4 Homologous recombination Targeting construct 3 loxp Neo loxp T158A 4 Cre-directed recombination T158A targeted locus 3 loxp T158A 4 loxp targeted locus loxp 3 4 Supplementary Figure 1: Generation of T158A and loxp knockin mice Targeting strategy to generate T158A and loxp knockin mice. The genomic region surrounding Mecp2 exons III and IV was targeted for homologous recombination using a construct in which the floxed neomycin positive selection cassette (Neo) was inserted in a non-conserved region of intron III. The location of the mutation in exon IV to create T158A is indicated. Since we were testing for the effects of a single nucleotide mutation, two lines of mice were generated: those with and those without the T158A mutation. Both lines contained floxed loxp sites. Following production of chimera, the Neo cassette was removed using EIIa-cre mice. The targeted alleles after cre-mediated removal of the Neo cassette are illustrated. 1
2 Body weight (g) Body weight (g) Figure S2 Supplementary Figure-2 (Goffin et al) a d b c Age (weeks) /+ T158A/ Age (weeks) Supplementary Figure 2: Characterization of T158A mice a. Stereotypical hindlimb clasping upon tail suspension in an Mecp2 mouse at 13 weeks of age versus an age-matched Mecp2 littermate. b. Body weights in male Mecp2 mice (n = 11; F 1,252 = 27.75, p<.1, two-way ANOVA) compared to WT littermates (n = 9). Points represent mean ± SEM. c. Body weights in female Mecp2 T158A/+ mice (n = 7; F 1,242 = , p<.1, two-way ANOVA) compared to Mecp2 +/+ littermates (n = 7). Points represent mean ± SEM. d. Normal gross brain anatomy in Mecp2 mice compared to Mecp2 mice. Sagittal sections were stained with an antibody against. 2
3 Figure S3 Supplementary Figure 3: Behavioral phenotypes of Mecp2 mice a. Locomotor activity measured in male mice using an open field assay at 11 and 3 weeks of age. Bars represent mean ± SEM (n = 6 for Mecp2 and n = 8 for Mecp2 ). * p-value <.5; two-tailed t-test with Bonferroni correction. b. Locomotor activity measured in female mice using an open field assay at 2 and 12 weeks of age. Bars represent mean ± SEM (n = 5 for Mecp2 +/+ and n = 5 for Mecp2 T158A/+ ). * p- value <.5; two-tailed t-test with Bonferroni correction. c. Percentage time spent freezing in Mecp2 (n = 33), Mecp2 (n = 16) and Mecp2 /y mice (n = 12) prior to, and subsequent to tone and shock on training day of fear conditioning procedure. Mecp2 /y mice freeze significantly more than WT or Mecp2 mice prior to experimentation obviating them from further analysis. Bars represent mean ± SEM. *** p-value <.1; two-tailed t-test with Bonferroni correction. 3
4 Figure S4. Supplementary Figure 4: mrna expression is not affected by T158A mutation mrna levels in Mecp2 mice (n = 3) at P, P3 or P9 compared to Mecp2 littermates (n = 3). Bars represent mean ± SEM. Statistics performed using one-sample t-tests. 4
5 Figure S5 Supplementary Figure 5: Mecp2-null mice exhibit alterations in auditory-evoked ERPs a. Representative EEG traces of awake, freely mobile mice. Scale bar corresponds to 1 second (horizontal) and 2 μa (vertical). b. Basal EEG power measurements in Mecp2 /y mice (n = 8) and Mecp2 littermates (n = 8). Bars represent mean ± SEM. * p-value <.5; two-tailed t-test with Bonferroni correction. Insets show β and high-γ mean amplitudes across EEG recordings. Scale bars represent one oscillation cycle (horizontal) and 2 μa (vertical). c. Grand average ERPs following 85-dB sound presentation. Traces represent mean amplitude (solid line) ± SEM (dashed lines). The characteristic polarity peaks P1, N1 and P2 are highlighted with straight lines with the length indicating latency range. Scale bar corresponds to 5 ms (horizontal) and 2 μa (on vertical). d. Latencies and e. amplitudes of ERP peaks. Bars represent mean ± SEM. * p-value <.5; two-tailed t-test with Bonferroni correction. 5
6 Figure S6 Supplementary Figure 6: Auditory-evoked ERPs are not affected in Mecp2 mice at P3 a. Representative EEG traces of awake, freely mobile mice. Scale bar corresponds to 1 second (horizontal) and 2 μa (vertical). b. Basal EEG power measurements in P3 Mecp2 mice (n = 7) and Mecp2 littermates (n = 8). Bars represent mean ± SEM. * p-value <.5; two-tailed t-test with Bonferroni correction. Insets show β and high-γ mean amplitudes across EEG recordings. Scale bars represent one oscillation cycle (horizontal) and 2 μa (vertical). c. Grand average ERPs following 85-dB sound presentation. Traces represent mean amplitude (solid line) ± SEM (dashed lines). The characteristic polarity peaks P1, N1 and P2 are highlighted with straight lines with the length indicating latency range. Scale bar corresponds to 5 ms (horizontal) and 2 μa (on vertical). d. Latencies and e. amplitudes of ERP peaks. Bars represent mean ± SEM. Statistics performed using two-tailed t-tests with Bonferroni correction. 6
7 Figure S7 Supplementary Figure 7: Auditory brainstem responses Auditory brain stem responses from P9 Mecp2, Mecp2 and Mecp2 /y mice. Mice were presented with 4, white-noise clicks (3 ms duration, 125 ms inter-stimulus interval) ranging from 85-dB to 55 db sound pressures. ABR responses decreased to a similar extent in all three genotypes with decreasing sound pressure. 7
8 Figure S8 Supplementary Figure 8: Oscillation changes occur for multiple cycles during ERPs EEG traces were band pass filtered in frequency ranges defined as δ (2-4 Hz), θ (4-8 Hz), α (8-12 Hz), β (12-3 Hz), γlow (3-5 Hz) and γhigh (7-14 Hz). The P1 peak consists primarily of oscillations in the β, low- and high-γ ranges. The N1 peak is composed primarily of α and β frequencies. The P2 peak is primarily composed of δ and θ frequencies. 8
9 Figure S9 Supplementary Figure 9: Quantification of event-related power and PLF changes a. Event-related power changes in Mecp2 mice and Mecp2 littermates at P9. b. Event-related power changes in Mecp2 /y mice and Mecp2 littermates at P9. c. Event-related power changes in Mecp2 mice and Mecp2 littermates at P3. d. Event-related PLF in Mecp2 mice and Mecp2 littermates at P9. e. Event-related PLF in Mecp2 /y mice and Mecp2 littermates at P9. f. Event-related PLF in Mecp2 mice and Mecp2 littermates at P3. Bars represent mean ± SEM. * p-value <.5, ** <.1 and *** <.1; two-tailed t-test with Bonferroni correction. 9
10 Figure S1 Supplementary Figure 1: Time-frequency analysis in Mecp2 /y mice a. Time-frequency plots showing event-related power in response to 85-dB white-noise clicks. Time is plotted on the abscissa (where t = at sound presentation) and frequency on the ordinate. Color represents mean power with warmer colors corresponding to an increased power and cooler colors representing decreased power compared to pre-stimulus baseline. b. Event-related power changes were separated into δ-, θ-, α-, β-, low γ- and high γ-frequency bands. Scale bars represent one oscillation cycle for the lowest frequency (longest duration cycle) in each band. Insets show traces on expanded time scale. Data are presented as mean power ± SEM. c. Time-frequency plots showing changes in phase locking factor (PLF) as a function of time and frequency. Color represents PLF with warmer colors corresponding to a higher PLF or lower circular variance in EEG phase across trials. d. PLF was separated into frequency bands. Data are presented as mean PLF ± SEM. 1
11 Figure S11 Supplementary Figure 11: Time-frequency analysis in P3 Mecp2 mice a. Time-frequency plots showing event-related power in response to an 85-dB white noise clicks. Time is plotted on the abscissa (where t = at sound presentation) and frequency on the ordinate. Color represents mean power with warmer colors corresponding to an increased power and cooler colors representing decreased power compared to pre-stimulus baseline. b. Event-related power changes were separated into δ-, θ-, α-, β-, low γ- and high γ-frequency bands. Scale bars represent one oscillation cycle for the lowest frequency (longest duration cycle) in each band. Insets show traces on expanded time scale. Data are presented as mean power ± SEM. c. Changes in phase locking factor (PLF) as a function on time and frequency. Color represents PLF with warmer colors corresponding to a higher PLF or lower circular variance in EEG phase across trials. d. PLF was separated into frequency bands. Data are presented as mean PLF ± SEM. 11
12 Figure S12 Supplementary Figure 12: Auditory-evoked ERPs in Mecp2 and Mecp2 mice a. Heat maps showing ERPs recorded following presentation of 25 white-noise clicks (1 ms duration, 85- db sound pressure, 4 second interstimulus intervals). Time is shown on the abscissa and trial number on the ordinate with the color representing EEG amplitude (μv). b. Grand average ERPs for Mecp2 mice at P3 and P9. Traces represent mean amplitude ± SEM. Scale bar corresponds to 5 ms (horizontal) and 2 μa (on vertical). c. Grand average ERPs for Mecp2 mice at P3 and P9. Traces represent mean amplitude ± SEM. Scale bar corresponds to 5 ms (horizontal) and 2 μa (on vertical). 12
13 +/+ T158A/+ Control RTT T158M loxp/y loxp/y loxp/y Figure S13 Fig. 1b Total T158 Sin3a Total T158 Sin3a Sin3a 1 15 Sin3a Fig. 4a Fig. 4b P2 P3 P9 Kidney Liver Lung Heart H H3 15 H3 Fig. 4c Fig. 4d Fig. 5c Input IgG Sin3a 25 5 NeuN 15 H3 37 (n.s.) 75 5 HDAC1 Supplementary Figure 13: Full-length pictures of the blots presented in the main figures. To examine proteins of interest on the same sample, blots in figures 4 and 5 were cut first and then probed with indicated antibodies. 14
14 Figure S14 Supplementary Figure 14: EEG electrode placement in hippocampus Representative 1 μm brain section with Nissl staining showing electrode placement in hippocampus. 13
15 Figure S15 Phase (radians) Amplitude (μv) Phase (radians) Amplitude (μv) Phase (radians) Amplitude (μv) 2 δ 2 α θ 2 β γlow 2 γhigh Time (s) Time (s) Supplementary Figure 15: EEG analysis using Hilbert transform Time-frequency analysis was calculated using Hilbert transform to generate instantaneous amplitude and phase measurement. Traces show 1 second raw EEG trace in gray from P9 Mecp2 (WT) mice with the trace filtered at δ (2-4 Hz), θ (4-8 Hz), α (8-12 Hz), β (12-3 Hz), γlow (3-5 Hz) and γhigh (7-14 Hz) frequencies and shown in black. Amplitude envelope calculated from Hilbert transform is shown in red. Phase calculation is shown underneath with values expressed in radians. 15
16 Supplementary Video 1: Motor deficits in Mecp2 mice Example video shows locomotor deficits in male Mecp2 (starts at bottom left), Mecp2 (starts at top right) and Mecp2 /y mice (starts at top left) at 11 weeks of age. Both Mecp2 and Mecp2 /y mice show decreased locomotor activity and aberrant gait with splaying of hind limbs upon movement. 16
Cellular origins of auditory event-related potential deficits in Rett syndrome
B r i e f com m u n i c at i o n s npg 214 Nature America, Inc. All rights reserved. Cellular origins of auditory event-related potential deficits in Rett syndrome Darren Goffin 1, Edward S Brodkin 2,
Supplementary Figure 1
8w Pia II/III IV V VI PV EYFP EYFP PV EYFP PV d PV EYFP Supplementary Figure a Spike probability x - PV-Cre d Spike probability x - RS RS b e Spike probability Spike probability.6......8..... FS FS c f
Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms
Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,
Supplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
mtorc2 controls actin polymerization required for consolidation of long-term memory
CORRECTION NOTICE Nat. Neurosci.; doi:1.138/nn.3351 mtorc2 controls actin polymerization required for consolidation of long-term memory Wei Huang, Ping Jun Zhu, Shixing Zhang, Hongyi Zhou, Loredana Stoica,
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
Dopamine in Ube3a m-/p+ mice. Online Supplemental Material
Online Supplemental Material S1 Supplemental Figure 1. Schematic of rate-dependent intracranial self-stimulation (ICSS) (A) Mice implanted with monopolar stimulating electrodes to the medial forebrain
Supplementary Figure 1
Supplementary Figure 1 Miniature microdrive, spike sorting and sleep stage detection. a, A movable recording probe with 8-tetrodes (32-channels). It weighs ~1g. b, A mouse implanted with 8 tetrodes in
Lack of GPR88 enhances medium spiny neuron activity and alters. motor- and cue- dependent behaviors
Lack of GPR88 enhances medium spiny neuron activity and alters motor- and cue- dependent behaviors Albert Quintana, Elisenda Sanz, Wengang Wang, Granville P. Storey, Ali D. Güler Matthew J. Wanat, Bryan
Supplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
Nature Medicine: doi: /nm.4084
Supplementary Figure 1: Sample IEDs. (a) Sample hippocampal IEDs from different kindled rats (scale bar = 200 µv, 100 ms). (b) Sample temporal lobe IEDs from different subjects with epilepsy (scale bar
Ube3a is required for experience-dependent maturation of the neocortex
Ube3a is required for experience-dependent maturation of the neocortex Koji Yashiro, Thorfinn T. Riday, Kathryn H. Condon, Adam C. Roberts, Danilo R. Bernardo, Rohit Prakash, Richard J. Weinberg, Michael
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Theta sequences are essential for internally generated hippocampal firing fields.
Theta sequences are essential for internally generated hippocampal firing fields. Yingxue Wang, Sandro Romani, Brian Lustig, Anthony Leonardo, Eva Pastalkova Supplementary Materials Supplementary Modeling
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior
Supplementary Figure 1 Trial structure for go/no-go behavior a, Overall timeline of experiments. Day 1: A1 mapping, injection of AAV1-SYN-GCAMP6s, cranial window and headpost implantation. Water restriction
Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons
Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),
Supplementary Material for
Supplementary Material for Selective neuronal lapses precede human cognitive lapses following sleep deprivation Supplementary Table 1. Data acquisition details Session Patient Brain regions monitored Time
Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
Supplemental Information. A Visual-Cue-Dependent Memory Circuit. for Place Navigation
Neuron, Volume 99 Supplemental Information A Visual-Cue-Dependent Memory Circuit for Place Navigation Han Qin, Ling Fu, Bo Hu, Xiang Liao, Jian Lu, Wenjing He, Shanshan Liang, Kuan Zhang, Ruijie Li, Jiwei
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
Probe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Hippocampal recordings. a. (top) Post-operative MRI (left, depicting a depth electrode implanted along the longitudinal hippocampal axis) and co-registered preoperative MRI (right)
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
CROSSMODAL PLASTICITY IN SPECIFIC AUDITORY CORTICES UNDERLIES VISUAL COMPENSATIONS IN THE DEAF "
Supplementary Online Materials To complement: CROSSMODAL PLASTICITY IN SPECIFIC AUDITORY CORTICES UNDERLIES VISUAL COMPENSATIONS IN THE DEAF " Stephen G. Lomber, M. Alex Meredith, and Andrej Kral 1 Supplementary
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
Supplemental Information. Differential Effects of EGFL6 on Tumor. versus Wound Angiogenesis
Cell Reports, Volume 21 Supplemental Information Differential Effects of EGFL6 on Tumor versus Wound Angiogenesis Kyunghee Noh, Lingegowda S. Mangala, Hee-Dong Han, Ningyan Zhang, Sunila Pradeep, Sherry
Supplementary Figure 1
Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
The BEACH protein LRBA is Required for Hair Bundle Maintenance in Cochlear Hair
The BEACH protein LRBA is Required for Hair Bundle Maintenance in Cochlear Hair Cells and for Hearing Short title: LRBA is Required for Hair Bundle Maintenance in Cochlear Hair Cells Christian Vogl 1,*,
Supporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol.
Supplementary Figures 1-11 Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol. (a), Voltage-clamp recordings from CA1 pyramidal neurons
Nature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between
Fig. S1. Weight of embryos during development. Embryos are collected at different time points (E12.5, E14.5, E16.5 and E18.5) from matings between Myod +/ or Myod / females and Myod +/ ;Igf2 +/ males and
Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC
1 2 1 3 Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC 4 5 6 7 (a) Reconstructions of LII/III GIN-cells with somato-dendritic compartments in orange and axonal arborizations
Twenty subjects (11 females) participated in this study. None of the subjects had
SUPPLEMENTARY METHODS Subjects Twenty subjects (11 females) participated in this study. None of the subjects had previous exposure to a tone language. Subjects were divided into two groups based on musical
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal
Lack of cadherins Celsr2 and Celsr3 impairs ependymal ciliogenesis, leading to fatal hydrocephalus Fadel TISSIR, Yibo QU, Mireille MONTCOUQUIOL, Libing ZHOU, Kouji KOMATSU, Dongbo SHI, Toshihiko FUJIMORI,
The following describes general use of ELIOS device
General use of the device The following describes general use of ELIOS device 1. Introduction of graphical user interface Presence indicator of SD card Charging indicator General Informations Screen title
Supplementary materials for: Executive control processes underlying multi- item working memory
Supplementary materials for: Executive control processes underlying multi- item working memory Antonio H. Lara & Jonathan D. Wallis Supplementary Figure 1 Supplementary Figure 1. Behavioral measures of
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Nature Neuroscience: doi: /nn.4642
Supplementary Figure 1 Recording sites and example waveform clustering, as well as electrophysiological recordings of auditory CS and shock processing following overtraining. (a) Recording sites in LC
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09667 A critical role for IGF-II in memory consolidation and enhancement Dillon Y. Chen, Sarah A. Stern, Ana Garcia-Osta, Bernadette Saunier-Rebori, Gabriella Pollonini, Dhananjay Bambah-Mukku,
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
EE 4BD4 Lecture 11. The Brain and EEG
EE 4BD4 Lecture 11 The Brain and EEG 1 Brain Wave Recordings Recorded extra-cellularly from scalp (EEG) Recorded from extra-cellularly from surface of cortex (ECOG) Recorded extra-cellularly from deep
But, what about ASSR in AN?? Is it a reliable tool to estimate the auditory thresholds in those category of patients??
1 Auditory Steady State Response (ASSR) thresholds have been shown to be highly correlated to bh behavioral thresholds h in adults and older children with normal hearing or those with sensorineural hearing
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
Beyond Blind Averaging: Analyzing Event-Related Brain Dynamics. Scott Makeig. sccn.ucsd.edu
Beyond Blind Averaging: Analyzing Event-Related Brain Dynamics Scott Makeig Institute for Neural Computation University of California San Diego La Jolla CA sccn.ucsd.edu Talk given at the EEG/MEG course
Supplementary Figure 1. Identification of the type II spiral ganglion neurons (SGN) via immunofluorescence of peripherin protein (PRPH).
Supplementary Figure 1. Identification of the type II spiral ganglion neurons (SGN) via immunofluorescence of peripherin protein (PRPH). (a), (b), PRPH immunolabelling of cryosections from post-natal day
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/3/e1600955/dc1 Supplementary Materials for Flexible and stretchable nanowire-coated fibers for optoelectronic probing of spinal cord circuits Chi Lu, Seongjun
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
Lateralized hippocampal oscillations underlie distinct aspects of human spatial memory and navigation. Jacobs et al.
Lateralized hippocampal oscillations underlie distinct aspects of human spatial memory and navigation Jacobs et al. Supplementary Information Lateralized hippocampal oscillations underlie distinct aspects
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
Supplementary Information
Supplementary Information D-Serine regulates cerebellar LTD and motor coordination through the 2 glutamate receptor Wataru Kakegawa, Yurika Miyoshi, Kenji Hamase, Shinji Matsuda, Keiko Matsuda, Kazuhisa
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu
Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary
Two distinct mechanisms for experiencedependent
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0150-0 In the format provided by the authors and unedited. Two distinct mechanisms for experiencedependent homeostasis Michelle C.
III. Comprehensive. Efficient. Auditory EP Testing
V I III Comprehensive. Efficient. Auditory EP Testing Fast, Flexible and User-Friendly Efficient workflow = Focus on the patient The intuitive software and streamlined interpretation with normative data
Effect of intensity increment on P300 amplitude
University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 2004 Effect of intensity increment on P300 amplitude Tim Skinner University of South Florida Follow this and
SUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided into five regions: cortex, hippocampus,
Supplemental material Supplemental method RNA extraction, reverse transcription, and real-time PCR The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic density. Hippocampal neurons were transfected with mir124 (containing DsRed) or DsRed as a control. 2 d after transfection,
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g)
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) In four mice, cre-dependent expression of the hyperpolarizing opsin Arch in pyramidal cells
Neural Recording Methods
Neural Recording Methods Types of neural recording 1. evoked potentials 2. extracellular, one neuron at a time 3. extracellular, many neurons at a time 4. intracellular (sharp or patch), one neuron at
Quick Guide - eabr with Eclipse
What is eabr? Quick Guide - eabr with Eclipse An electrical Auditory Brainstem Response (eabr) is a measurement of the ABR using an electrical stimulus. Instead of a traditional acoustic stimulus the cochlear
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in
Supplementary Information on TMS/hd-EEG recordings: acquisition and preprocessing
Supplementary Information on TMS/hd-EEG recordings: acquisition and preprocessing Stability of the coil position was assured by using a software aiming device allowing the stimulation only when the deviation
Imtiyaz et al., Fig. S1
. Imtiyaz et al., Fig. S1 1. 1.1 1% O.1.5 Lin/Sca-1/IL-7Rα GMPs.17 MPs.3 Days 3% O.1 MEPs.35 D3 Days 1, N, N, H, H 1 1 Days Supplemental Figure S1. Macrophage maturation, proliferation and survival are
Sum of Neurally Distinct Stimulus- and Task-Related Components.
SUPPLEMENTARY MATERIAL for Cardoso et al. 22 The Neuroimaging Signal is a Linear Sum of Neurally Distinct Stimulus- and Task-Related Components. : Appendix: Homogeneous Linear ( Null ) and Modified Linear
REVIEWERS' COMMENTS: Reviewer #1 (Remarks to the Author):
Editorial Note: this manuscript has been previously reviewed at another journal that is not operating a transparent peer review scheme. This document only contains reviewer comments and rebuttal letters
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool
IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Targeting of the attenuated diphtheria toxin (adta) into the melanopsin locus. a,
doi: 1.138/nature6829 a DTA HSV- TK PGK-Neo Targeting construct b kb.85.65 L WT adta/+ adta/ adta Melanopsin (Opn 4) Genomic Locus 1 kb.4 Supplementary Figure 1: Targeting of the attenuated diphtheria
Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
Nature Neuroscience: doi: /nn Supplementary Figure 1. Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites.
Supplementary Figure 1 Neuron class-specific arrangements of Khc::nod::lacZ label in dendrites. Staining with fluorescence antibodies to detect GFP (Green), β-galactosidase (magenta/white). (a, b) Class
Provisional guidelines for using Auditory Steady State Responses (ASSR) in babies. July 2009
5 NEWBORN HEARING SCREENING AND ASSESSMENT Provisional guidelines for using Auditory Steady State Responses (ASSR) in babies 10 Suggested parameter values for recording frequency-specific ASSR using Natus
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Awake-behaving recordings in mice during fear conditioning. Eric H. Chang, Ph.D. Goldsmith Postdoctoral Fellow
Awake-behaving recordings in mice during fear conditioning Eric H. Chang, Ph.D. Goldsmith Postdoctoral Fellow Weill Cornell Medical College Burke Cornell Medical Research Institute White Plains, NY Noldus
Behavioral generalization
Supplementary Figure 1 Behavioral generalization. a. Behavioral generalization curves in four Individual sessions. Shown is the conditioned response (CR, mean ± SEM), as a function of absolute (main) or
Supplementary Figure 1. Basic properties of compound EPSPs at
Supplementary Figure 1. Basic properties of compound EPSPs at hippocampal CA3 CA3 cell synapses. (a) EPSPs were evoked by extracellular stimulation of the recurrent collaterals and pharmacologically isolated