REMINDER: Fill out your course evaluation by Sunday. Also, CAOS and SATS extended to Sunday, December 8 23:50.

Size: px
Start display at page:

Download "REMINDER: Fill out your course evaluation by Sunday. Also, CAOS and SATS extended to Sunday, December 8 23:50."

Transcription

1 REMINDER: Fill out your course evaluation by Sunday. Also, CAOS and SATS extended to Sunday, December 8 23:50.

2 STA220 review session: Thursday December 5, 10:00 12:00, SS 2110 For more information:

3 A few highlights from the Final exam information page on Coursera: The exam consists of 35 multiple choice questions. Answers must be marked with pencil on a Scantron answer sheet. There are no penalties (negative marks) for wrong answers. The first 5 questions are each worth 2 marks and a blank response receives 0.4 marks for these questions. The remaining 30 questions are each worth 3 marks and a blank response receives 0.6 marks for these question. Practice Exams: There is a currently a link to online multiple choice practice problems. A practice exam (with R output) will be posted tomorrow morning. You should bring: A two sided, 8.5 by 11 inch, handwritten aid sheet, A calculator, Pencils and erasers for completing the Scantron answer sheet, Your University of Toronto student card. Extra office hours: The TAs will be holding lots of office hours leading up to the exam. The schedule is posted on the TA office hours page. Coverage: The exam covers the entire course. See the Content by Week page.

4 New optional videos posted:

5 A concept done poorly on CAOS: Suppose that it has been established that the mean body temperature of healthy adults is 37 degrees Celsius with a standard deviation of 0.5 degrees Celsius. I think the mean temperature is lower for university students. So I take a random sample of 100 students from my population, which is all students at the University of Toronto, and I found that the mean is 36.8 degrees Celsius. Which of the following is the most appropriate statistical conclusion? A. I cannot conclude that the mean body temperature for UofT students is less than 37 degrees because 36.8 degrees is less than one standard deviation from 37 degrees. B. I can conclude that UofT students have a lower mean body temperature because I have a simple random sample with a reasonably large sample size. C. I can conclude that UofT students have a lower mean body temperature because the difference between 37 and 36.8 degrees is much larger than the standard error.

6

7 A concept done poorly on CAOS: Suppose that a random sample of 60 resulted in a 90% confidence interval for the proportion of female students at the University of Toronto who have been vaccinated for HPV of (0.52, 0.76). How many of the following are correct interpretations of the confidence interval? A. We would expect 90% of all possible sample proportions from this population to be between 0.52 and B. 90% of the time the population proportion will be between 0.52 and C. The method used to construct the interval will produce an interval that includes the value of the population proportion about 90% of the time in repeated sampling. D. If 100 different random samples of size 60 from this population were each used to construct a 90% confidence interval, 90 of them will contain the value of the population proportion. E. The probability that the population proportion is between 0.52 and 0.76 is 0.90.

8 A concept done poorly on CAOS:

9 If there s no bias In sampling, the probability that subjects with a characteristic are chosen is the proportion of subjects in the population. In experiments, subjects with a characteristic are just as likely to be in one treatment group as another. So any differences among the treatment groups are just due to chance. (Ideally, the subjects in one treatment group have the same characteristics as subjects in the other treatment group.) How could you get more accuracy in your estimates? Does having only a sample, randomly chosen, from a population affect my ability to generalize to the population?

10 A concept done poorly on CAOS: What is extrapolation and why is it a problem in regression?

*Karle Laska s Sections: There is NO class Thursday or Friday! Have a great Valentine s Day weekend!

*Karle Laska s Sections: There is NO class Thursday or Friday! Have a great Valentine s Day weekend! STATISTICS 100 EXAM 1 Spring 2016 PRINT NAME (Last name) (First name) NETID: CIRCLE SECTION: L1 (Laska MWF 12pm) L2 (Laska Tues/Thurs 11am) Write answers in appropriate blanks. When no blanks are provided

More information

STA 3024 Spring 2013 EXAM 3 Test Form Code A UF ID #

STA 3024 Spring 2013 EXAM 3 Test Form Code A UF ID # STA 3024 Spring 2013 Name EXAM 3 Test Form Code A UF ID # Instructions: This exam contains 34 Multiple Choice questions. Each question is worth 3 points, for a total of 102 points (there are TWO bonus

More information

3.2A Least-Squares Regression

3.2A Least-Squares Regression 3.2A Least-Squares Regression Linear (straight-line) relationships between two quantitative variables are pretty common and easy to understand. Our instinct when looking at a scatterplot of data is to

More information

Card File Registry. Required Supplies:

Card File Registry. Required Supplies: Card File Registry Knowledge of patients above the individual level is important for any quality improvement effort in the office practice, and for informing decisions for the organization s strategic

More information

Why randomize? Rohini Pande Harvard University and J-PAL.

Why randomize? Rohini Pande Harvard University and J-PAL. Why randomize? Rohini Pande Harvard University and J-PAL www.povertyactionlab.org Agenda I. Background on Program Evaluation II. What is a randomized experiment? III. Advantages and Limitations of Experiments

More information

De Anza College Contemporary Nutrition N-10

De Anza College Contemporary Nutrition N-10 De Anza College Contemporary Nutrition N-10 Quarter: Spring 2019 (4 units) Location: S57; M/W 1:30-3:20 Instructor: Gigi Acker, MPH, RD Email: ackergeorgia@deanza.edu Phone: 650-303-8199 Office Location:

More information

UNIVERSITY of PENNSYLVANIA CIS 520: Machine Learning Midterm, 2016

UNIVERSITY of PENNSYLVANIA CIS 520: Machine Learning Midterm, 2016 UNIVERSITY of PENNSYLVANIA CIS 520: Machine Learning Midterm, 2016 Exam policy: This exam allows one one-page, two-sided cheat sheet; No other materials. Time: 80 minutes. Be sure to write your name and

More information

CC&S Session #4: Lesson Plan

CC&S Session #4: Lesson Plan CC&S Session #4: Lesson Plan Core Activities: Use parking lot to address questions/topics Complete Activity: Skin Cancer Flashcard Activity Supplies Needed: Session 4 handouts Flip Chart Markers Nametags

More information

De Anza College Contemporary Nutrition N-10

De Anza College Contemporary Nutrition N-10 De Anza College Contemporary Nutrition N-10 Quarter: Winter 2019 (4 units) Location: S57; M/W 11:30-1:20 Instructor: Gigi Acker, MPH, RD Office Hours: Monday 8:30-9:30 am & Wednesday 1:20-2:20 pm Website:

More information

DO NOT OPEN THIS BOOKLET UNTIL YOU ARE TOLD TO DO SO

DO NOT OPEN THIS BOOKLET UNTIL YOU ARE TOLD TO DO SO NATS 1500 Mid-term test A1 Page 1 of 8 Name (PRINT) Student Number Signature Instructions: York University DIVISION OF NATURAL SCIENCE NATS 1500 3.0 Statistics and Reasoning in Modern Society Mid-Term

More information

1.4 - Linear Regression and MS Excel

1.4 - Linear Regression and MS Excel 1.4 - Linear Regression and MS Excel Regression is an analytic technique for determining the relationship between a dependent variable and an independent variable. When the two variables have a linear

More information

De Anza College Contemporary Nutrition N-10

De Anza College Contemporary Nutrition N-10 De Anza College Contemporary Nutrition N-10 Quarter: Fall 2018 (4 units) Location: S57; M/W 11:30-1:20 Instructor: Gigi Acker, MPH, RD Office Hours: Wednesday 1:30-2:30 pm & Friday 8:30-9:30 am Website:

More information

UF#Stats#Club#STA#2023#Exam#1#Review#Packet# #Fall#2013#

UF#Stats#Club#STA#2023#Exam#1#Review#Packet# #Fall#2013# UF#Stats#Club#STA##Exam##Review#Packet# #Fall## The following data consists of the scores the Gators basketball team scored during the 8 games played in the - season. 84 74 66 58 79 8 7 64 8 6 78 79 77

More information

(a) 50% of the shows have a rating greater than: impossible to tell

(a) 50% of the shows have a rating greater than: impossible to tell q 1. Here is a histogram of the Distribution of grades on a quiz. How many students took the quiz? What percentage of students scored below a 60 on the quiz? (Assume left-hand endpoints are included in

More information

Midterm STAT-UB.0003 Regression and Forecasting Models. I will not lie, cheat or steal to gain an academic advantage, or tolerate those who do.

Midterm STAT-UB.0003 Regression and Forecasting Models. I will not lie, cheat or steal to gain an academic advantage, or tolerate those who do. Midterm STAT-UB.0003 Regression and Forecasting Models The exam is closed book and notes, with the following exception: you are allowed to bring one letter-sized page of notes into the exam (front and

More information

MATH CALCULUS & STATISTICS/BUSN - PRACTICE EXAM #2 - SUMMER DR. DAVID BRIDGE

MATH CALCULUS & STATISTICS/BUSN - PRACTICE EXAM #2 - SUMMER DR. DAVID BRIDGE MATH 2053 - CALCULUS & STATISTICS/BUSN - PRACTICE EXAM #2 - SUMMER 2006 - DR. DAVID BRIDGE MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. Find the

More information

I. Introduction and Data Collection B. Sampling. 1. Bias. In this section Bias Random Sampling Sampling Error

I. Introduction and Data Collection B. Sampling. 1. Bias. In this section Bias Random Sampling Sampling Error I. Introduction and Data Collection B. Sampling In this section Bias Random Sampling Sampling Error 1. Bias Bias a prejudice in one direction (this occurs when the sample is selected in such a way that

More information

What is the chance that during the next 6 class sessions, the students will see this sweater exactly 4 times?

What is the chance that during the next 6 class sessions, the students will see this sweater exactly 4 times? Name: Section: day/time) AMS5 - MIDTERM Thursday 5th February, 2009 A Normal Table is on the last page of this exam. 1. A professor has five different colored sweaters in his closet. During the day, his

More information

Lecture 12: more Chapter 5, Section 3 Relationships between Two Quantitative Variables; Regression

Lecture 12: more Chapter 5, Section 3 Relationships between Two Quantitative Variables; Regression Lecture 12: more Chapter 5, Section 3 Relationships between Two Quantitative Variables; Regression Equation of Regression Line; Residuals Effect of Explanatory/Response Roles Unusual Observations Sample

More information

Data Quality: Errors and fixes

Data Quality: Errors and fixes 75 Questions, 5 pages name (required) You must turn in this hard copy (with your name on it) and your scantron to receive credit for this exam. One answer and only one answer per question. Leaving a question

More information

about Eat Stop Eat is that there is the equivalent of two days a week where you don t have to worry about what you eat.

about Eat Stop Eat is that there is the equivalent of two days a week where you don t have to worry about what you eat. Brad Pilon 1 2 3 ! For many people, the best thing about Eat Stop Eat is that there is the equivalent of two days a week where you don t have to worry about what you eat.! However, this still means there

More information

(a) 50% of the shows have a rating greater than: impossible to tell

(a) 50% of the shows have a rating greater than: impossible to tell KEY 1. Here is a histogram of the Distribution of grades on a quiz. How many students took the quiz? 15 What percentage of students scored below a 60 on the quiz? (Assume left-hand endpoints are included

More information

Review for Test 2 STA 3123

Review for Test 2 STA 3123 Review for Test 2 STA 3123 I. What kind of design we should be considering for problems (1 18)? a. Independent samples z-test c. Test for two proportions b. Independent samples t-test d. Matched pairs

More information

Use the above variables and any you might need to construct to specify the MODEL A/C comparisons you would use to ask the following questions.

Use the above variables and any you might need to construct to specify the MODEL A/C comparisons you would use to ask the following questions. Fall, 2002 Grad Stats Final Exam There are four questions on this exam, A through D, and each question has multiple sub-questions. Unless otherwise indicated, each sub-question is worth 3 points. Question

More information

STT 200 Test 1 Green Give your answer in the scantron provided. Each question is worth 2 points.

STT 200 Test 1 Green Give your answer in the scantron provided. Each question is worth 2 points. STT 200 Test 1 Green Give your answer in the scantron provided. Each question is worth 2 points. For Questions 1 & 2: It is known that the distribution of starting salaries for MSU Education majors has

More information

11 questions to help you make sense of a case control study

11 questions to help you make sense of a case control study Critical Appraisal Skills Programme (CASP) making sense of evidence 11 questions to help you make sense of a case control study How to use this appraisal tool Three broad issues need to be considered when

More information

SUMMER 2011 RE-EXAM PSYF11STAT - STATISTIK

SUMMER 2011 RE-EXAM PSYF11STAT - STATISTIK SUMMER 011 RE-EXAM PSYF11STAT - STATISTIK Full Name: Årskortnummer: Date: This exam is made up of three parts: Part 1 includes 30 multiple choice questions; Part includes 10 matching questions; and Part

More information

Dr. Kelly Bradley Final Exam Summer {2 points} Name

Dr. Kelly Bradley Final Exam Summer {2 points} Name {2 points} Name You MUST work alone no tutors; no help from classmates. Email me or see me with questions. You will receive a score of 0 if this rule is violated. This exam is being scored out of 00 points.

More information

El CAMINO COLLEGE General Psychology

El CAMINO COLLEGE General Psychology El CAMINO COLLEGE General Psychology Psychology 5 - Course Syllabus Spring 2013 T&Th: 2:00 3:25PM Eddie Galván, M.S. 3 units; 3 hours lecture Recommended Preparation: eligibility for English 1A Credit,

More information

UNIT 2. Getting Started

UNIT 2. Getting Started UNIT 2 Getting Started My Advice (pg. 39) TO-GRAB Literally meaning grab NONE Related to nothing, none is more empathic WARNING Use this sign to say watch out Did you know? Pg. 39 ASL students are eager

More information

Syllabus Psy 371 Abnormal Psychology Spring :30 2:45 p.m. Tuesdays and Thursdays Physical Science Building 217

Syllabus Psy 371 Abnormal Psychology Spring :30 2:45 p.m. Tuesdays and Thursdays Physical Science Building 217 Syllabus Psy 371 Abnormal Psychology Spring 2009 1:30 2:45 p.m. Tuesdays and Thursdays Physical Science Building 217 Instructor: Elaine M. Heiby, Ph.D. (last name is pronounced high-bee ) Email: heiby@hawaii.edu

More information

Dr. Allen Back. Sep. 30, 2016

Dr. Allen Back. Sep. 30, 2016 Dr. Allen Back Sep. 30, 2016 Extrapolation is Dangerous Extrapolation is Dangerous And watch out for confounding variables. e.g.: A strong association between numbers of firemen and amount of damge at

More information

Intro to Survey Design and Issues. Sampling methods and tips

Intro to Survey Design and Issues. Sampling methods and tips Intro to Survey Design and Issues Sampling methods and tips Making Inferences What is a population? All the cases for some given area or phenomenon. One can conduct a census of an entire population, as

More information

1st4sport Level 3 Certificate in Coaching Strength and Conditioning for Sport (QCF)

1st4sport Level 3 Certificate in Coaching Strength and Conditioning for Sport (QCF) Developed in Partnership with the Rugby Football Union 1st4sport Level 3 Certificate in Coaching Strength and Conditioning for Sport (QCF) Training Programme Planning and Assessment Booklet Learner name

More information

Experimental design. Basic principles

Experimental design. Basic principles This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this

More information

T M S C A M I D D L E S C H O O L N U M B E R S E N S E R E G I O N A L T E S T M A R C H 9,

T M S C A M I D D L E S C H O O L N U M B E R S E N S E R E G I O N A L T E S T M A R C H 9, st Score: nd Score: rd Score: Final Score Name: School: SS/ID Number: City: Grade: 5 6 7 8 Classification: A A A 4A 5A T M S C A M I D D L E S C H O O L N U M B E R S E N S E R E G I O N A L T E S T M

More information

Inferences: What inferences about the hypotheses and questions can be made based on the results?

Inferences: What inferences about the hypotheses and questions can be made based on the results? QALMRI INSTRUCTIONS QALMRI is an acronym that stands for: Question: (a) What was the broad question being asked by this research project? (b) What was the specific question being asked by this research

More information

CHAPTER 6. Experiments in the Real World

CHAPTER 6. Experiments in the Real World CHAPTER 6 Experiments in the Real World EQUAL TREATMENT FOR ALL SUBJECTS The underlying assumption of randomized comparative experiments is that all subjects are handled equally in every respect except

More information

CRITICAL APPRAISAL SKILLS PROGRAMME Making sense of evidence about clinical effectiveness. 11 questions to help you make sense of case control study

CRITICAL APPRAISAL SKILLS PROGRAMME Making sense of evidence about clinical effectiveness. 11 questions to help you make sense of case control study CRITICAL APPRAISAL SKILLS PROGRAMME Making sense of evidence about clinical effectiveness 11 questions to help you make sense of case control study General comments Three broad issues need to be considered

More information

Further Mathematics. Written Examination 2 October/November

Further Mathematics. Written Examination 2 October/November Further Mathematics Written Examination 2 October/November Introduction Further Mathematics Examination 2 is designed to assess students ability to understand and communicate mathematical ideas, and to

More information

BIOLOGY. Monday 14 Nov 2016

BIOLOGY. Monday 14 Nov 2016 BIOLOGY Monday 14 Nov 2016 Entry Task What is Bromothymol Blue (BTB)? An indicator solution that measures the ph of a solution, changing colors when the solution becomes acidic. How was BTB used during

More information

AP Stats Review for Midterm

AP Stats Review for Midterm AP Stats Review for Midterm NAME: Format: 10% of final grade. There will be 20 multiple-choice questions and 3 free response questions. The multiple-choice questions will be worth 2 points each and the

More information

Unit 2. Getting Started

Unit 2. Getting Started Unit 2 Getting Started TO-GRAB Literally meaning grab NONE Related to nothing, none is more empathic WARNING Use this sign to say watch out My Advice (pg. 39) Did you know? Pg. 39 ASL students are eager

More information

Evaluating Effective Messaging for HPV Vaccination Promotion. Jaleen Sims, MPH, MSIV Central Mississippi Health Service, Inc Jackson, MS

Evaluating Effective Messaging for HPV Vaccination Promotion. Jaleen Sims, MPH, MSIV Central Mississippi Health Service, Inc Jackson, MS Evaluating Effective Messaging for HPV Vaccination Promotion Jaleen Sims, MPH, MSIV Central Mississippi Health Service, Inc Jackson, MS Introduction Areas of interest: sexual health, adolescent health,

More information

10 Nov of 6 Bio301D Exam 3

10 Nov of 6 Bio301D Exam 3 name (required) Language of evaluation: falsifiability, irrelevant, consistent, support, null,... 1. (5pts) Which of the following options are true? MTF A) We discussed a newspaper article on pet psychics.

More information

CHAPTER 8 Estimating with Confidence

CHAPTER 8 Estimating with Confidence CHAPTER 8 Estimating with Confidence 8.1 Confidence Intervals: The Basics The Practice of Statistics, 5th Edition Starnes, Tabor, Yates, Moore Bedford Freeman Worth Publishers Confidence Intervals: The

More information

The Practice of Statistics 1 Week 2: Relationships and Data Collection

The Practice of Statistics 1 Week 2: Relationships and Data Collection The Practice of Statistics 1 Week 2: Relationships and Data Collection Video 12: Data Collection - Experiments Experiments are the gold standard since they allow us to make causal conclusions. example,

More information

Title: A new statistical test for trends: establishing the properties of a test for repeated binomial observations on a set of items

Title: A new statistical test for trends: establishing the properties of a test for repeated binomial observations on a set of items Title: A new statistical test for trends: establishing the properties of a test for repeated binomial observations on a set of items Introduction Many studies of therapies with single subjects involve

More information

DIPLOMA IN GYNECOLOGICAL ENDOSCOPY TRAINING (MIS 1 & MIS 2) 13TH 17TH March, 2019

DIPLOMA IN GYNECOLOGICAL ENDOSCOPY TRAINING (MIS 1 & MIS 2) 13TH 17TH March, 2019 DIPLOMA IN GYNECOLOGICAL ENDOSCOPY TRAINING (MIS 1 & MIS 2) 13TH 17TH March, 2019 Day 1-13th March, Wednesday 08:30 09:00 AM Registration and Attendance 09:00 AM 09:45 AM Anatomy is the mother and exposure

More information

REVIEW PROBLEMS FOR FIRST EXAM

REVIEW PROBLEMS FOR FIRST EXAM M358K Sp 6 REVIEW PROBLEMS FOR FIRST EXAM Please Note: This review sheet is not intended to tell you what will or what will not be on the exam. However, most of these problems have appeared on or are very

More information

L I V E W E L L, W O R K W E L L

L I V E W E L L, W O R K W E L L October 2017 I N S I D E T H I S I S S U E B R E A S T C A N C E R A W A R E N E S S 1 O P E N 2 E N R O L L M E N T F L U S H O T 3 C L I N I C S Facts about Breast Cancer in the United States One in

More information

Extrapolating health risks

Extrapolating health risks 27 Questions, 5 pages name (required) Extrapolating health risks 1-5 (3pts each) For each of the problems below, indicate which type(s) of extrapolations are present, if any. You are asked for the shape

More information

Lesson 11.1: The Alpha Value

Lesson 11.1: The Alpha Value Hypothesis Testing Lesson 11.1: The Alpha Value The alpha value is the degree of risk we are willing to take when making a decision. The alpha value, often abbreviated using the Greek letter α, is sometimes

More information

MATH : Design and Analysis of Clinical Trials

MATH : Design and Analysis of Clinical Trials MATH 654-102: Design and Analysis of Clinical Trials MID-TERM EXAM Spring, 2012 (Time allowed: TWO AND HALF HOURS) INSTRUCTIONS TO STUDENTS: 1. This test contains FIVE questions and comprises SIX printed

More information

UNIVERSITY OF TORONTO SCARBOROUGH Department of Computer and Mathematical Sciences Midterm Test February 2016

UNIVERSITY OF TORONTO SCARBOROUGH Department of Computer and Mathematical Sciences Midterm Test February 2016 UNIVERSITY OF TORONTO SCARBOROUGH Department of Computer and Mathematical Sciences Midterm Test February 2016 STAB22H3 Statistics I, LEC 01 and LEC 02 Duration: 1 hour and 45 minutes Last Name: First Name:

More information

Go the Extra Smile! How did you hear about Smile for a Lifetime?

Go the Extra Smile! How did you hear about Smile for a Lifetime? APPLICATION FORM Please print all pages and assure all fields are completed and each item below is included with this application. [ ] Applicant Questionnaire [ ] Copy of Report Card or Transcript [ ]

More information

Client Care Counseling Critique Assignment Osteoporosis

Client Care Counseling Critique Assignment Osteoporosis Client Care Counseling Critique Assignment Osteoporosis 1. Describe the counselling approach or aspects of different approaches used by the counsellor. Would a different approach have been more appropriate

More information

UNIVERSITY of PENNSYLVANIA CIS 520: Machine Learning Final, Fall 2014

UNIVERSITY of PENNSYLVANIA CIS 520: Machine Learning Final, Fall 2014 UNIVERSITY of PENNSYLVANIA CIS 520: Machine Learning Final, Fall 2014 Exam policy: This exam allows two one-page, two-sided cheat sheets (i.e. 4 sides); No other materials. Time: 2 hours. Be sure to write

More information

Examining Relationships Least-squares regression. Sections 2.3

Examining Relationships Least-squares regression. Sections 2.3 Examining Relationships Least-squares regression Sections 2.3 The regression line A regression line describes a one-way linear relationship between variables. An explanatory variable, x, explains variability

More information

PSYC 1001 EFG. Come to the PASS workshop with your mock exam complete. During the workshop you can work with other students to review your work.

PSYC 1001 EFG. Come to the PASS workshop with your mock exam complete. During the workshop you can work with other students to review your work. It is most beneficial to you to write this mock midterm UNDER EXAM CONDITIONS. This means: Complete the midterm in 50 mins Work on your own. Keep your notes and textbook closed. Attempt every question.

More information

Guidelines for the Westmead PTA scale

Guidelines for the Westmead PTA scale Guidelines for the Westmead PTA scale N.E.V. Marosszeky, L. Ryan, E.A. Shores, J. Batchelor & J.E. Marosszeky Dept. of Rehabilitation Medicine, Westmead Hospital Dept. of Psychology, Macquarie University

More information

Designed Experiments have developed their own terminology. The individuals in an experiment are often called subjects.

Designed Experiments have developed their own terminology. The individuals in an experiment are often called subjects. When we wish to show a causal relationship between our explanatory variable and the response variable, a well designed experiment provides the best option. Here, we will discuss a few basic concepts and

More information

Choosing Life: Empowerment, Action, Results! CLEAR Menu Sessions. Health Care 3: Partnering In My Care and Treatment

Choosing Life: Empowerment, Action, Results! CLEAR Menu Sessions. Health Care 3: Partnering In My Care and Treatment Choosing Life: Empowerment, Action, Results! CLEAR Menu Sessions Health Care 3: Partnering In My Care and Treatment This page intentionally left blank. Session Aims: Partnering In My Care and Treatment

More information

The t-test: Answers the question: is the difference between the two conditions in my experiment "real" or due to chance?

The t-test: Answers the question: is the difference between the two conditions in my experiment real or due to chance? The t-test: Answers the question: is the difference between the two conditions in my experiment "real" or due to chance? Two versions: (a) Dependent-means t-test: ( Matched-pairs" or "one-sample" t-test).

More information

Lecture 6B: more Chapter 5, Section 3 Relationships between Two Quantitative Variables; Regression

Lecture 6B: more Chapter 5, Section 3 Relationships between Two Quantitative Variables; Regression Lecture 6B: more Chapter 5, Section 3 Relationships between Two Quantitative Variables; Regression! Equation of Regression Line; Residuals! Effect of Explanatory/Response Roles! Unusual Observations! Sample

More information

Phil 12: Logic and Decision Making (Winter 2010) Directions and Sample Questions for Final Exam. Part I: Correlation

Phil 12: Logic and Decision Making (Winter 2010) Directions and Sample Questions for Final Exam. Part I: Correlation Phil 12: Logic and Decision Making (Winter 2010) Directions and Sample Questions for Final Exam Part I: Correlation A. Answer the following multiple-choice questions 1. To make a prediction from a new

More information

Practical Performance and Personal Exercise Programme (PEP)

Practical Performance and Personal Exercise Programme (PEP) 7 Practical Performance and Personal Exercise Programme (PEP) When you have worked through this chapter, you will have developed knowledge and understanding of: what is required for the practical performance

More information

2.75: 84% 2.5: 80% 2.25: 78% 2: 74% 1.75: 70% 1.5: 66% 1.25: 64% 1.0: 60% 0.5: 50% 0.25: 25% 0: 0%

2.75: 84% 2.5: 80% 2.25: 78% 2: 74% 1.75: 70% 1.5: 66% 1.25: 64% 1.0: 60% 0.5: 50% 0.25: 25% 0: 0% Capstone Test (will consist of FOUR quizzes and the FINAL test grade will be an average of the four quizzes). Capstone #1: Review of Chapters 1-3 Capstone #2: Review of Chapter 4 Capstone #3: Review of

More information

Data Triangulation: Use of Health Facility Immunization Reporting Tools

Data Triangulation: Use of Health Facility Immunization Reporting Tools Data Triangulation: Use of Health Facility Immunization Reporting Tools Ensuring and improving data quality is a priority for the immunization program (EPI). Immunization coverage data reporting, completeness

More information

Introduction; Study design

Introduction; Study design ; Study design Patrick Breheny January 12 Patrick Breheny STA 580: Biostatistics I 1/43 What is statistics? What is biostatistics, and why is it important? The statistical framework Statistics is the science

More information

Increasing HPV Vaccination Rates in NYS. Jim Kirkwood NYSDOH, Bureau of Immunization

Increasing HPV Vaccination Rates in NYS. Jim Kirkwood NYSDOH, Bureau of Immunization Increasing HPV Vaccination Rates in NYS Jim Kirkwood NYSDOH, Bureau of Immunization 1 National Estimated Vaccination Coverage Levels among Adolescents 13 17 Years, National Immunization Survey Teen, 2006

More information

EPIDEMIOLOGY-BIOSTATISTICS EXAM Midterm 2004 PRINT YOUR LEGAL NAME:

EPIDEMIOLOGY-BIOSTATISTICS EXAM Midterm 2004 PRINT YOUR LEGAL NAME: EPIDEMIOLOGY-BIOSTATISTICS EXAM Midterm 2004 PRINT YOUR LEGAL NAME: Instructions: This exam is 20% of your course grade. The maximum number of points for the course is 1,000; hence, this exam is worth

More information

Part 1. Online Session: Math Review and Math Preparation for Course 5 minutes Introduction 45 minutes Reading and Practice Problem Assignment

Part 1. Online Session: Math Review and Math Preparation for Course 5 minutes Introduction 45 minutes Reading and Practice Problem Assignment Course Schedule PREREQUISITE (Pre-Class) Advanced Education Diagnostic Test 10 minutes Excel 2007 Exercise SECTION 1. (Completed before face-to-face sections begin) (2 hours) Part 1. Online Session: Math

More information

To measure progress, I recommend initially testing yourself. Here are three tests you can do before beginning your training:

To measure progress, I recommend initially testing yourself. Here are three tests you can do before beginning your training: South fayette High School Girls Soccer Summer Conditioning Pre-season is designed to add additional fitness to an already high level. It is NOT designed to take unfit players to competition fitness in

More information

Practice First Midterm Exam

Practice First Midterm Exam Practice First Midterm Exam Statistics 200 (Pfenning) This is a closed book exam worth 150 points. You are allowed to use a calculator and a two-sided sheet of notes. There are 9 problems, with point values

More information

Exam Schedule Matrix: Spring 2017

Exam Schedule Matrix: Spring 2017 Final examinations are held at the end of each term in accordance with the published scheduling matrix. INSTRUCTORS: Room assignments for non-standard course meetings, exam conflicts or makeup exams will

More information

Learn to use informal measures of probability.

Learn to use informal measures of probability. 10-1 Probability Learn to use informal measures of probability. 10-1 Probability Insert Lesson Title Here experiment outcome event probability equally likely impossible certain Vocabulary 10-1 Probability

More information

Chapter 14. Inference for Regression Inference about the Model 14.1 Testing the Relationship Signi!cance Test Practice

Chapter 14. Inference for Regression Inference about the Model 14.1 Testing the Relationship Signi!cance Test Practice Chapter 14 Inference for Regression Our!nal topic of the year involves inference for the regression model. In Chapter 3 we learned how to!nd the Least Squares Regression Line for a set of bivariate data.

More information

Chapter 1 Review Questions

Chapter 1 Review Questions Chapter 1 Review Questions 1.1 Why is the standard economic model a good thing, and why is it a bad thing, in trying to understand economic behavior? A good economic model is simple and yet gives useful

More information

Sampling for Success. Dr. Jim Mirabella President, Mirabella Research Services, Inc. Professor of Research & Statistics

Sampling for Success. Dr. Jim Mirabella President, Mirabella Research Services, Inc. Professor of Research & Statistics Sampling for Success Dr. Jim Mirabella President, Mirabella Research Services, Inc. Professor of Research & Statistics Session Objectives Upon completion of this workshop, participants will be able to:

More information

PSY 205 Module 3 Supplement. Comparing Correlation, Ex post facto, and Experimental Approaches to Research

PSY 205 Module 3 Supplement. Comparing Correlation, Ex post facto, and Experimental Approaches to Research PSY 205 Module 3 Supplement Comparing Correlation, Ex post facto, and Experimental Approaches to Research As you have seen in this module, there are many ways to do research in psychology. Now let s carefully

More information

CLDDV 173: Autism: Overview and Treatment (3 Units) Section: 5962 Monday: 6:00 pm 9:05 pm Muir 163 Fall 2015

CLDDV 173: Autism: Overview and Treatment (3 Units) Section: 5962 Monday: 6:00 pm 9:05 pm Muir 163 Fall 2015 CLDDV 173: Autism: Overview and Treatment (3 Units) Section: 5962 Monday: 6:00 pm 9:05 pm Muir 163 Fall 2015 Instructor: Debbie Laffranchini Office: 157 D Email: laffranchinid@mjc.edu Website: http://laffranchinid.faculty.mjc.edu

More information

Voluntary Services News

Voluntary Services News Spring Edition 2018 Sheffield: A Beacon for Youth Volunteering! Did you know that the NHS will be 70 this year? As part of the celebrations Sheffield has been chosen as a Beacon Area for the NHS70 #iwill

More information

Review+Practice. May 30, 2012

Review+Practice. May 30, 2012 Review+Practice May 30, 2012 Final: Tuesday June 5 8:30-10:20 Venue: Sections AA and AB (EEB 125), sections AC and AD (EEB 105), sections AE and AF (SIG 134) Format: Short answer. Bring: calculator, BRAINS

More information

Chapter 12. The One- Sample

Chapter 12. The One- Sample Chapter 12 The One- Sample z-test Objective We are going to learn to make decisions about a population parameter based on sample information. Lesson 12.1. Testing a Two- Tailed Hypothesis Example 1: Let's

More information

TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5

TGTTAGATTCAGAGTCGCTAGCTAGCTAGCTATATTCTCGTATAGACTATCGTAGCGC-3 3 -ACAATCTAAGTCTCAGCGATCGATCGATCGATATAAGAGCATATCTGATAGCATCGCG-5 LS1a Problem Set #5 Due Friday 11/3 by noon in your TF s drop box on the 2 nd floor of the Science Center All questions including (*extra*) ones must be answered 1. If you recall from last week, nerve

More information

Choosing Life: Empowerment, Action, Results! CLEAR Menu Sessions. Substance Use Risk 5: Drugs, Alcohol, and HIV

Choosing Life: Empowerment, Action, Results! CLEAR Menu Sessions. Substance Use Risk 5: Drugs, Alcohol, and HIV Choosing Life: Empowerment, Action, Results! CLEAR Menu Sessions Substance Use Risk 5: This page intentionally left blank. Session Aims: (70 Minutes) To understand the health consequences of drugs and

More information

8.2 Warm Up. why not.

8.2 Warm Up. why not. Binomial distributions often arise in discrimination cases when the population in question is large. The generic question is If the selection were made at random from the entire population, what is the

More information

Stepwise method Modern Model Selection Methods Quantile-Quantile plot and tests for normality

Stepwise method Modern Model Selection Methods Quantile-Quantile plot and tests for normality Week 9 Hour 3 Stepwise method Modern Model Selection Methods Quantile-Quantile plot and tests for normality Stat 302 Notes. Week 9, Hour 3, Page 1 / 39 Stepwise Now that we've introduced interactions,

More information

What s Really True? Discovering the Fact and Fiction of Autism

What s Really True? Discovering the Fact and Fiction of Autism What s Really True? Discovering the Fact and Fiction of Autism Beth MacLehose Dempsey Middle School, Delaware, Ohio In collaboration with Catherine Rice, National Center on Birth Defects and Developmental

More information

By Timothy Park, and for the Family and Community Medicine Clerkship at the Uptown Square Clinic in good ol New Orleans, LA

By Timothy Park, and for the Family and Community Medicine Clerkship at the Uptown Square Clinic in good ol New Orleans, LA By Timothy Park, and for the Family and Community Medicine Clerkship at the Uptown Square Clinic in good ol New Orleans, LA Generally, it is a combination of primary, secondary, and tertiary prevention

More information

Chapter 5: Field experimental designs in agriculture

Chapter 5: Field experimental designs in agriculture Chapter 5: Field experimental designs in agriculture Jose Crossa Biometrics and Statistics Unit Crop Research Informatics Lab (CRIL) CIMMYT. Int. Apdo. Postal 6-641, 06600 Mexico, DF, Mexico Introduction

More information

Cancer Clear & Simple Session 4

Cancer Clear & Simple Session 4 Cancer Clear & Simple Session 4 Ground Rules 1. Listen to different ideas without put- downs. 2. No interrup6ons while someone is talking. 3. Everyone has the right to speak. 4. What other people say is

More information

Linear Regression in SAS

Linear Regression in SAS 1 Suppose we wish to examine factors that predict patient s hemoglobin levels. Simulated data for six patients is used throughout this tutorial. data hgb_data; input id age race $ bmi hgb; cards; 21 25

More information

VCE VET SPORT AND RECREATION

VCE VET SPORT AND RECREATION Victorian Certificate of Education 2013 SUPERVISOR TO ATTACH PROCESSING LABEL HERE STUDENT NUMBER Letter Figures Words VCE VET SPORT AND RECREATION Written examination Friday 15 November 2013 Reading time:

More information

DATA is derived either through. Self-Report Observation Measurement

DATA is derived either through. Self-Report Observation Measurement Data Management DATA is derived either through Self-Report Observation Measurement QUESTION ANSWER DATA DATA may be from Structured or Unstructured questions? Quantitative or Qualitative? Numerical or

More information

Chapter 8: Estimating with Confidence

Chapter 8: Estimating with Confidence Chapter 8: Estimating with Confidence Section 8.1 The Practice of Statistics, 4 th edition For AP* STARNES, YATES, MOORE Introduction Our goal in many statistical settings is to use a sample statistic

More information

Advanced/Advanced Subsidiary. You must have: Mathematical Formulae and Statistical Tables (Blue)

Advanced/Advanced Subsidiary. You must have: Mathematical Formulae and Statistical Tables (Blue) Write your name here Surname Other names Pearson Edexcel International Advanced Level Centre Number Statistics S3 Advanced/Advanced Subsidiary Candidate Number Thursday 22 May 2014 Morning Time: 1 hour

More information

3. For a $5 lunch with a 55 cent ($0.55) tip, what is the value of the residual?

3. For a $5 lunch with a 55 cent ($0.55) tip, what is the value of the residual? STATISTICS 216, SPRING 2006 Name: EXAM 1; February 21, 2006; 100 points. Instructions: Closed book. Closed notes. Calculator allowed. Double-sided exam. NO CELL PHONES. Multiple Choice (3pts each). Circle

More information