Dual-Genotype Diffuse Low-Grade Glioma: Is It Really Time to Abandon Oligoastrocytoma As a Distinct Entity?
|
|
- Jody Floyd
- 5 years ago
- Views:
Transcription
1 Journal of Neuropatholgy & Experimental Neurology Vol. 0, No. 0, 2017, pp. 1 5 doi: /jnen/nlx024 BRIEF REPORT Dual-Genotype Diffuse Low-Grade Glioma: Is It Really Time to Abandon Oligoastrocytoma As a Distinct Entity? Valeria Barresi, MD, PhD, Simona Lionti, MD, Laura Valori, BSc, Giovanna Gallina, PhD, Maria Caffo, MD, PhD, and Sabrina Rossi, MD, PhD Abstract We report a unique case of dual-genotype oligoastrocytoma characterized by IDH2 gene mutation. The tumor was resected from the temporal lobe of a 25-year-old man. At histological examination with hematoxylin and eosin stain, it showed distinct oligodendroglial and astrocytic areas. The former retained alpha-thalassaemia/ mental retardation X-linked (ATRX) immuno-expression and had absent staining for p53, while the latter had ATRX loss and p53 over-expression. Molecular analyses were separately assessed in the 2 tumor components. Gene sequencing disclosed IDH2 mutation in both, whereas oligodendroglial, but not astrocytic areas, had 1p/19q codeletion and telomerase reverse transcriptase promoter mutation. Distinction of dual-genotype oligoastrocytoma from oligodendroglioma and astrocytoma might be clinically relevant for prognosis and therapy. Because most studies that investigated the molecular phenotype of oligoastrocytomas have focused on IDH1 R132H mutated cases, we suggest further analyses on diffuse gliomas with heterogeneous (astrocytic and oligodendroglial) morphology before oligoastrocytoma is dismissed as a distinct nosological entity. Key Words: 1p/19q Codeletion, ATRX, IDH, Oligoastrocytoma, TERT. INTRODUCTION In the fourth edition of the World Health Organization (WHO) Classification of Tumours of the Central Nervous System, oligoastrocytoma was listed as a separate entity among the diffuse gliomas (1). In particular, it was defined as a diffusely infiltrating glioma composed of a conspicuous mixture of 2 distinct neoplastic cell types morphologically resembling the tumor cells of oligodendroglioma or diffuse astrocytoma (1). Thereafter, several studies showed that nearly all oligoastrocytomas are monoclonal tumors and that they can be classified as astrocytoma or oligodendroglioma on their biomolecular From the Department of Human Pathology, University of Messina, Messina, Italy (VB and SL); Department of Pathology, Treviso General Hospital, Treviso, Italy (LV, GG and SR); and Department of Neurosciences, University of Messina, Messina, Italy (MC) Send correspondence to: Valeria Barresi, MD, PhD, Department of Human Pathology, Polyclinic G. Martino, Pad D, Via Consolare Valeria, Messina, Italy; vbarresi@unime.it The authors have no duality or conflicts of interest to declare. profile (2 5). In detail, oligoastrocytomas with mutations in isocitrate dehydrogenase 1 and 2 (IDH1 and IDH2) genes and combined whole-arm losses of 1p and 19q (1p/19q codeletion) can be classified as oligodendrogliomas, while those with mutations in IDH1/IDH2, alpha-thalassaemia/mental retardation X-linked (ATRX) andp53 genes can be categorized as astrocytomas (2 5). For this reason, the most recent update of WHO classification states that the histopathological diagnosis of oligoastrocytoma should be reserved to tumors with ambiguous morphology when diagnostic molecular testing cannot be performed (so-called oligoastrocytoma not otherwise specified) or in the very rare instance of a dual-genotype oligoastrocytoma (6). Herein we describe a case of low-grade diffuse glioma composed of distinct areas with astrocytic and oligodendroglial morphology and that had different molecular signature. This case demonstrates that oligoastrocytoma is not just a tumor with ambiguous histology, but a rare neoplasia that represents a distinct nosological entity. MATERIALS AND METHODS Clinical history was obtained from retrospective review of the medical records. The whole surgical specimen was formalin-fixed and paraffin-embedded for histological examination. Four micrometer consecutive sections were cut from the paraffin blocks for microscopic examination with hematoxylin and eosin (H&E) stain, immunohistochemistry and fluorescent in situ hybridization (FISH) analysis. Through histological examination and immunohistochemistry, we identified tumor fragments with different morphology and immuno-phenotype (Fig. 1). Those fragments were dissected and collected separately for IDH1 and IDH2 sequencing and for telomerase reverse transcriptase (TERT) promoter mutational analysis. Similarly, 1p/19q FISH analysis was performed separately in areas with different morphology and immuno-phenotype. Immunohistochemistry Immunohistochemistry was performed using an automated Immunostainer (Dako Autostainer Link 48 Instruments; Dako, Glostrup, Denmark) and the following antibodies against olig-2 (clone 211F1.1, Cell Marque, Rocklin, CA; 1:100), glial fibrillary acidic protein (GFAP) (clone 6F2; VC 2017 American Association of Neuropathologists, Inc. All rights reserved. 1
2 Barresi et al J Neuropathol Exp Neurol Volume 0, Number 0, Month 2017 IDH1 and IDH2 were as follows: (1) initial denaturation step at 95 C for 5 minutes; (2) 40cyclesat95 C/30 seconds, 58 C/30 seconds, and 72 C/30 seconds; and (3) afinalstep at 72 C/5 minutes. We used the following primers: IDH1-F CCATCACTGCAGTTGTAGGTT; IDH1-R GCAAAAT CACATTATTGCCAAC; IDH2-F TGCAGTGGGACCACT ATTATC; IDH2-R GTGCCCAGGTCAGTGGAT. PCR conditions for TERT were as follows: (1) initial denaturation step at 95 C for 10 minutes; (2) 35cyclesat95 C/30 seconds, 60 C/30 seconds, and 72 C/1 minute; and (3) afinal step at 72 C/7 minutes. We used the following primers: TERT-F GTCCTGCCCCTTCACCTT and TERT-R GCACCT CGCGGTAGTGG. FIGURE 1. Pre-operative axial T2-weighted magnetic resonance imaging showing a hyperintense mass in the temporal lobe. Dako; 1:500), ATRX (Polyclonal; Life Science Sigma, St Louis, MO; 1:750), IDH1 R132H (clone H09, Dianova, Germany; 1:200), p53 (clone DO-7, Dako; 1:100) and Ki-67 (clone MIB-1, Dako; 1:100). FISH Formalin-fixed, paraffin-embedded tissue specimens were processed with LSI 1p36/19q13 Dual-Color Probe Sets (Vysis/Abbott, Molecular Europe, Wiesbaden, Germany) assays, following manufacturer-recommended protocols. Slides were examined by Olympus BX61 fluorescence microscope equipped with a 100 oil immersion objective and a triple band pass filter for simultaneous detection of Spectrum Orange, Spectrum Green, and DAPI signals; 200 nonoverlapping nuclei containing a minimum of 2 reference probe signals were counted. The ratio of 1p/1q and 19q/19p was calculated by dividing the number of orange and green signals. Counting was performed separately in tissue fragments showing different morphology (astrocytic vs oligodendroglial) and nuclear expression of ATRX (ATRX loss vs ATRX maintenance). Tumor fragments were considered to be deleted when the final ratio was <0.8; a target-to-reference probe signal ratio >0.8 indicated no allelic loss of target locus. Molecular Analyses Fragments with differential expression of nuclear ATRX were preliminarily identified and marked in the ATRX immunostained slide (Fig. 2). Thereafter, 5-mm-thick serial sections of those fragments were cut from the corresponding paraffin block, put on uncoated slides and separately dissected and collected in different tubes. Genomic DNA from each area was isolated for molecular analyses using the QIAamp DNA Mini Kit (Qiagen, Venlo, The Netherlands). All areas had at least 80% cellularity. IDH1, IDH2, and TERT were amplified by PCR and both strands were sequenced using the ABI PRISM 3500 Genetic Analyzer (Applied Biosystems). PCR conditions for 2 RESULTS A 25-year-old man referred to our hospital because of vomiting and headache persisting for 1 week. Past clinical history was unremarkable and it was negative for brain irradiation. There was no significant family history of brain tumors or other cancers, and there were no stigmata of neurofibromatosis or enchondromatosis present. Magnetic resonance imaging showed an infiltrating lesion in the right temporal lobe. The lesion was hypointense in T1 and hyperintense in T2 weighted images and it was not contrast-enhanced (Fig. 1). The radiological findings suggested low-grade glioma. The patient was submitted to craniotomy for surgical removal of the lesion and post-surgical RMI demonstrated complete surgical resection of the tumor. Surgical specimen consisted of several tissue fragments that were entirely paraffin embedded for histological examination. Microscopic evaluation with H&E stain revealed a glial tumor with low cellularity and mainly composed of cells with ovoid nuclei and mild nuclear atypia (astrocytic morphology) (Fig. 2A). However, some fragments had a different morphology and showed monotonous neoplastic cells with round, hyperchormatic, nuclei, and clear cytoplasmic halo and thin vessels with chicken-wire pattern (oligodendroglial morphology) (Fig. 2D). GFAP was diffusely expressed in the areas with astrocytic morphology, whereas it was overall negative in the fragments with oligodendroglial morphology. No immunohistochemical staining for IDH1 R132H was found in both the astrocytic and oligodendroglial components. However, ATRX and p53 immunostaining was different in the areas with astrocytic and oligodendroglial morphology. Indeed, the former were positive for p53 and negative for ATRX (Fig. 2B, C), while the latter were negative for p53 and positive for ATRX (Fig. 2E, F). FISH analyses correlated with ATRX expression. Specifically, in the areas which retained ATRX expression, 1p/1q and 19q/19p ratios were 0.54, and 0.55, which corresponds to 1p/19q codeletion (Fig. 2); on the other hand, in the areas with ATRX loss, 1p/1q was 0.89 and 19q/19p was 0.9, which indicates absence of 1p/19 codeletion (Fig. 3). Molecular analysis of IDH1/IDH2 genes revealed IDH2 gene mutation c.515g>t (p.arg172met) at codon 172 in both oligodendroglial and astrocytic areas. Molecular analysis of TERT promoter showed 124C>T (C228T) mutation in the oligondendroglial areas, and absence of mutation in the
3 J Neuropathol Exp Neurol Volume 0, Number 0, Month 2017 Dual-Genotype Oligoastrocytoma FIGURE 2. Areas with astrocytic morphology were composed of neoplastic cells with oval nuclei and mild nuclear atypia (A) (H&E stain; original magnification, 200); they showed ATRX nuclear loss (B) (ATRX stain; original magnification, 200) and p53 over-expression (C) (p53 stain; original magnification, 200). Areas with oligodendroglial morphology were composed of cells with uniform round nuclei (D) (H&E stain; original magnification, 200) that retained ATRX nuclear expression (E) (ATRX stain; original magnification, 200) and were negative for p53 (F) (p53 stain; original magnification, 200). astrocytic component. Proliferative index assessed through Ki- 67 staining was 2% in both astrocytic and oligodendroglial areas. No tumor recurrence was documented after 4 months follow-up. DISCUSSION In this study, we report on a case of so-called oligoastrocytoma dual-genotype, that is a diffuse glioma with distinct areas (mostly confined in different fragments) showing morphology and molecular signature of oligodendroglioma and astrocytoma. Interestingly, this case was resected from the temporal lobe of a male patient, similarly to 3 previous cases of dual-genotype oligoastrocytoma (7 9) (Table); however, further reports on this entity are needed to clarify whether the association with male sex and temporal location is coincidental or not. Differently from previously reported dual-genotype oligoastrocytomas (7, 8), ours was characterized by IDH2 and not by IDH1 gene mutation (Table). In gliomas, IDH2 mutations are rare as compared with IDH1 mutations, and they are mainly found in tumors with oligodendroglial morphology (10 12). In particular, IDH2 gene mutation c.515g>t, which was detected in this case, is found in only 0.8% 1.8% of gliomas (12). In our case, demonstration of the same IDH2 mutation in astrocytic and oligodendroglial areas suggests common clonal origin and successive differentiation into 2 distinct subclones, one characterized by 1p/19q codeletion and the other by ATRX loss and p53 mutation. This supports the hypothesis that IDH mutation is an early event in gliomagenesis (2). Then, 3 possible scenarios may happen: (1) acquisition of ATRX and p53 mutations and development of astrocytoma; (2) 1p/19q codeletion and origin of oligodendroglioma; (3) splitting into 2 subclones, one acquiring ATRX and p53 mutations and one 1p/19q codeletion, and creation of oligodendroglial-astrocytic tumor (oligoastrocytoma), as in the present case. Interestingly, IDH2 somatic mutations were found in patients with enchondormatosis (Oliier-Maffucci syndrome) (13) and anaplastic astrocytoma was reported in a patient with enchondromatosis and IDH2 R172S mutation (14). Our patient had no clinical signs of enchondromatosis. However, the possibility of enchondromatosis due to constitutional mosaicism for IDH2 p.r172m mutation cannot be excluded, and that this tumor actually represents a collision of two separate gliomas due to this possible underlying glioma predisposition syndrome remains an alternative explanation for the findings. Wang et al (15) recently described low incidence (2.2%) of IDH2 gene mutations a in large series of diffuse gliomas (15). Interestingly, none of their IDH2 mutated cases had P53 or ATRX mutations (15); for this reason, they suggested that microenvironment in IDH2-mutated gliomas may not favor the development of other mutations (15). However, we do not agree with this assumption for several reasons. First, P53 mutation was previously reported in IDH2 mutated anaplastic astrocytoma (14). In addition, ATRX mutational analysis was not available in the majority of IDH2 mutant cases (13/18) (15). Finally, 10 out of the 18 IDH2-mutated gliomas in that series had ambiguous morphology and were classified as oligoastrocytomas 3
4 Barresi et al J Neuropathol Exp Neurol Volume 0, Number 0, Month 2017 FIGURE 3. Fragments with ATRX expression and those with loss of ATRX were identified and marked in green and red, respectively, so that molecular analyses were carried out separately in the 2 tumor components. Both tumor areas bore IDH2 mutation. Areas with retained ATRX expression, but not those with ATRX loss, had 1p/19q codeletion and TERT promoter mutation. TABLE. Clinicopathological and Molecular Features of Dual-Genotype Oligoastrocytoma in the Literature Dual-genotype oligoastrocytoma Age Gender Site IDH mutation 1p/19q status TERT promoter mutation Grade Recurrence Ou et al (10) 44 Male Temporal lobe NA 1p/19q codel (oligo)/ NA II Unknown del 1p (astro) Huse et al (8) 53 Female Frontal lobe IDH1 R132H 1p/19q codel (oligo)/ NA II (oligo)/iii (astro) Yes (2 months) GBM Wilcox et al (9) 30 Male Temporal lobe IDH1 R132H 1p/19q codel (oligo)/ C250T (oligo) III Unknown Wilcox et al (9) 57 Male Temporal lobe IDH1 R132H 1p/19q codel (oligo)/ NA II Yes (2 years) astrocytic Present case 25 Male Temporal lobe IDH2 R172M 1p/19q codel (oligo)/ C228T (oligo) II None (4 months) NA: not assessed. (15). However, whether P53 and ATRX analyses had been carried out separately in the 2 morphological components it is not specified (15). Therefore, we cannot exclude that accurate and specific investigation of the astrocytoma-like and oligodendroglioma-like areas in those tumors may lead to results equivalent to those found in the present case. Since virtually all 1p/19q codeleted tumors (oligodendrogliomas) exhibit TERT promoter mutation, while only IDH wild type, usually high-grade, astrocytic tumors have such 4 genetic alteration (16), we analyzed also TERT promoter mutation in our case. As expected for dual-genotype diffuse glioma, we observed TERT promoter mutation in oligodendroglial, but not in astrocytic areas. Noteworthy, TERT promoter mutation had been previously analyzed in only 1 case of dual-genotype oligoastrocytoma (Table); in that case, TERT promoter mutation was at highest levels in the oligodendroglial region, absent in the astrocytic region, and at intermediate levels in the mixed region (7).
5 J Neuropathol Exp Neurol Volume 0, Number 0, Month 2017 The most recent update of WHO classification (6) strongly discourages the histopathological diagnosis of oligoastrocytoma, due to the evidence that nearly all oligoastrocytomas can be categorized as astrocytomas or oligodendrogliomas on their biomolecular profile (3, 17). However, the present case and other previous rare cases of dual-genotype oligoastrocytoma (7 9) suggest that further studies are needed before the concept of oligoastrocytoma is definitively abandoned. In addition, we believe that the incidence of dual-genotype oligoastrocytoma might be currently underestimated. Indeed most studies on oligoastrocytoma were focused on morphologically ambiguous tumors with positive immunohistochemical staining for IDH1 R132H mutant protein (3, 5, 8). However, diffuse gliomas may also have other IDH1 mutations not detectable through immunohistochemistry and IDH2 mutations (12), as in the present case. In addition, a recent study demonstrated that more than a half of IDH2 mutations are found in gliomas with morphological features of oligoastrocytoma (15). Underrating of dual-genotype oligoastrocytoma might also depend on sampling biases. Indeed, in our case we did not observe tumor regions with admixed oligodendroglial and astrocytic neoplastic cells. Hence, it might happen that one of the components of a dual-genotype oligoastrocytoma is missed because of incomplete surgical removal or due to partial histological examination of the tumor. Finally, immunohistochemistry and molecular analyses are usually performed on only one tumor block in routine practice. Therefore, if ATRX immunohistochemistry that predicts 1p/19q codeletion with higher accuracy than morphology is performed on a slide containing only tumor fragments with homogeneous histological aspect, dual-genotype oligoastrocytoma might not be recognized. In conclusion, in this study we reported a unique IDH2 mutant dual-genotype oligoastrocytoma. Although further studies are warranted to clarify the biological behavior of this entity, we believe that the identification of an oligodendroglial, 1p/19q codeleted, component in an otherwise diffuse astrocytoma may be clinically relevant. Indeed, it is well known that 1p/19q codeletion is associated with longer overall survival (15) and with response to chemotherapy in patients with diffuse gliomas. On the other hand, demonstration of an astrocytic component in an otherwise oligodendroglial neoplasia may be predictive of higher recurrence risk (8). In the present case, clear distinction of astrocytic and oligodendroglial areas observed on H&E slides was possible by using ATRX staining. Indeed ATRX loss was found in the former, but not in the latter. Therefore, we suggest evaluating ATRX expression in all the histological slides of tumors with heterogeneous astrocytic and oligodendroglial morphology in order to identify tumor fragments to submit to following molecular analyses. Dual-Genotype Oligoastrocytoma Finally, in our opinion, more extensive studies including IDH1/IDH2 and TERT promoter sequencing are warranted in morphologically heterogeneous tumors before definitely dismissing oligoastrocytoma as a distinct entity. References 1. von Deimling A, Refeinberger G, Kros JM, et al. Oligoastrocytoma. In: Luois DN, Oghaki H, Wiestler OD, Cavenee WK, eds. WHO Classification of Tumors of the Central Nervous System. Lyon: IARC Press; 2007: Jiao Y, Killela PJ, Reitman ZJ, et al. Frequent ATRX, CIC, FUBP1 and IDH1 mutations refine the classification of malignant gliomas. Oncotarget 2012;3: Sahm F, Reuss D, Koelsche C, et al. Farewell to oligoastrocytoma: in situ molecular genetics favor classification as either oligodendroglioma or astrocytoma. Acta Neuropathol 2014;128: Wiestler B, Capper D, Sill M, et al. Integrated DNA methylation and copy-number profiling identify three clinically and biologically relevant groups of anaplastic glioma. Acta Neuropathol 2014;128: Hewer E, Vajtai I, Dettmer MS, et al. Combined ATRX/IDH1 immunohistochemistry predicts genotype of oligoastrocytomas. Histopathology 2016;68: Louis DN, Perry A, Reifenberger G, et al. The 2016 World Health Organization Classification of tumors of the central nervous system: a summary. Acta Neuropathol 2016;131: Huse JT, Diamond EL, Wang L, et al. Mixed glioma with molecular features of composite oligodendroglioma and astrocytoma: a true oligoastrocytoma?. Acta Neuropathol 2015;129: Wilcox P, Li CC, Lee M, et al. Oligoastrocytomas: throwing the baby out with the bathwater? Acta Neuropathol 2015;129: Qu M, Olofsson T, Sigurdardottir S, et al. Genetically distinct astrocytic and oligodendroglial components in oligoastrocytomas. Acta Neuropathol 2007;113: Hartmann C, Meyer J, Balss J, et al. Type and frequency of IDH1 and IDH2 mutations are related to astrocytic and oligodendroglial differentiation and age: a study of 1,010 diffuse gliomas. Acta Neuropathol 2009; 118: Yan H, Parsons DW, Jin G, et al. IDH1 and IDH2 mutations in gliomas. N Engl J Med 2009;360: Waitkus MS, Diplas BH, Yan H. Isocitrate dehydrogenase mutations in gliomas. Neuro Oncol 2016;18: Pansuriya TC, van Eijk R, d Adamo P, et al. Somatic mosaic IDH1 and IDH2 mutations are associated with enchondroma and spindle cell hemangioma in Ollier disease and Maffucci syndrome. Nat Genet 2011;43: Moriya K, Kaneko MK, Liu X, et al. IDH2 and TP53 mutations are correlated with gliomagenesis in a patient with Maffucci syndrome. Cancer Sci 2014;105: Wang HY, Tang K, Liang TY, et al. The comparison of clinical and biological characteristics between IDH1 and IDH2 mutations in gliomas. J Exp Clin Cancer Res 2016;35: Arita H, Narita Y, Fukushima S, et al. Upregulating mutations in the TERT promoter commonly occur in adult malignant gliomas and are strongly associated with total 1p19q loss. Acta Neuropathol 2013;126: Brat DJ, Verhaak RG, Aldpe KD, et al. Comprehensive, integrative genomic analysis of diffuse lower-grade gliomas. N Engl J Med 2015;372:
Case Presentation: USCAP Jason T. Huse, MD, PhD Assistant Member Department of Pathology Memorial Sloan Kettering Cancer Center
Case Presentation: USCAP 2016 Jason T. Huse, MD, PhD Assistant Member Department of Pathology Memorial Sloan Kettering Cancer Center Case History 53 year old female with a long standing history of migraines
More informationThe New WHO Classification and the Role of Integrated Molecular Profiling in the Diagnosis of Malignant Gliomas
The New WHO Classification and the Role of Integrated Molecular Profiling in the Diagnosis of Malignant Gliomas Stefan Prokop, MD Neuropathology Fellow Hospital of the University of Pennsylvania Background
More informationClassification of Diffuse Gliomas: Progress, Pearls and Pitfalls. Rob Macaulay Neuropathologist, MCC October 21, 2017
Classification of Diffuse Gliomas: Progress, Pearls and Pitfalls Rob Macaulay Neuropathologist, MCC October 21, 2017 Objectives Explain why the designation high grade glioma is preferable to GBM for intraoperative
More informationMorphological features and genetic alterations
Morphological features and genetic alterations Tutor : Audrey Rousseau Caget Lise: Université d Angers Iorio Vittoria: Seconda Università degli studi di Napoli Manaila Roxana: Iuliu Hatieganu University
More informationGliomas in the 2016 WHO Classification of CNS Tumors
Gliomas in the 2016 WHO Classification of CNS Tumors Hindi N Al-Hindi, MD, FCAP Consultant Neuropathologist and Head Section of Anatomic Pathology Department of Pathology and Laboratory Medicine King Faisal
More informationWHO 2016 CNS Tumor Classification Update. DISCLOSURES (Arie Perry, MD) PATTERN RECOGNITION. Arie Perry, M.D. Director, Neuropathology
WHO 2016 CNS Tumor Classification Update Arie Perry, M.D. Director, Neuropathology DISCLOSURES (Arie Perry, MD) I have no financial relationships to disclose. - and - I will not discuss off label use or
More informationIDH1 R132H/ATRX Immunohistochemical validation
IDH1 R132H/ATRX Immunohistochemical validation CIQC/DSM 2016 12 June 2016 0835-0905 Stephen Yip, M.D., Ph.D., FRCPC University of British Columbia Disclosure Statement I have nothing to disclose I will
More information2017 Diagnostic Slide Session Case 3
2017 Diagnostic Slide Session Case 3 Andrew Gao, MD Lili-Naz Hazrati, MD, PhD Cynthia Hawkins, MD, PhD Hospital for Sick Children and University of Toronto, Toronto, Canada Disclosures: none Clinical History
More informationDisclaimers. Molecular pathology of brain tumors. Some aspects only. Some details are inevitably personal opinions
Molecular pathology of brain tumors Disclaimers Some aspects only H.K. Ng The Chinese University of Hong Kong Some details are inevitably personal opinions Free ppt : http://www.acp.cuhk.edu.hk/hkng Why
More informationAnaplastic Pilocytic Astrocytoma: The fusion of good and bad
Anaplastic Pilocytic Astrocytoma: The fusion of good and bad Alexandrina Nikova 1, Charalampos-Chrysovalantis Chytoudis-Peroudis 2, Penelope Korkolopoulou 3 and Dimitrios Kanakis 4 Abstract 5 Pilocytic
More informationMOLECULAR DIAGNOSTICS OF GLIOMAS
MOLECULAR DIAGNOSTICS OF GLIOMAS Arie Perry, M.D. Director, Neuropathology Division DIFFUSE GLIOMAS Cell types Astrocytomas (A) Oligodendrogliomas (O) Mixed oligoastrocytoma (MOA) Three WHO grades: II,
More informationCNS pathology Third year medical students. Dr Heyam Awad 2018 Lecture 12: CNS tumours 2/3
CNS pathology Third year medical students Dr Heyam Awad 2018 Lecture 12: CNS tumours 2/3 Pilocytic astrocytoma Relatively benign ( WHO grade 1) Occurs in children and young adults Mostly: in the cerebellum
More information5-hydroxymethylcytosine loss is associated with poor prognosis for
5-hydroxymethylcytosine loss is associated with poor prognosis for patients with WHO grade II diffuse astrocytomas Feng Zhang 1,*, Yifan Liu 2, Zhiwen Zhang 1, Jie Li 1, Yi Wan 3, Liying Zhang 1, Yangmei
More informationMolecular Classification Defines 4 Prognostically Distinct Glioma Groups Irrespective of Diagnosis and Grade
J Neuropathol Exp Neurol Copyright Ó 2015 by the American Association of Neuropathologists, Inc. Vol. 74, No. 3 March 2015 pp. 241Y249 ORIGINAL ARTICLE Molecular Classification Defines 4 Prognostically
More informationDetection of IDH1 mutation in human gliomas: comparison of immunohistochemistry and sequencing
DOI.7/s4--3-7 ORIGINAL ARTICLE Detection of IDH mutation in human gliomas: comparison of immunohistochemistry and sequencing Shingo Takano Wei Tian Masahide Matsuda Tetsuya Yamamoto Eiichi Ishikawa Mika
More informationDiagnostic implications of IDH1-R132H and OLIG2 expression patterns in rare and challenging glioblastoma variants
& 2012 USCAP, Inc. All rights reserved 0893-3952/12 $32.00 1 Diagnostic implications of IDH1-R132H and OLIG2 expression patterns in rare and challenging glioblastoma variants Nancy M Joseph 1, Joanna Phillips
More informationCharacterizing invading glioma cells based on IDH1-R132H and Ki-67 immunofluorescence
DOI 10.1007/s10014-013-0172-y ORIGINAL ARTICLE Characterizing invading glioma cells based on IDH1-R132H and Ki-67 immunofluorescence Hemragul Sabit Mitsutoshi Nakada Takuya Furuta Takuya Watanabe Yutaka
More informationPr D.Figarella-Branger Service d Anatomie Pathologique et de Neuropathologie, La Timone, Marseille UMR 911 Inserm, Université d Aix-Marseille
Novelties in the WHO 2016 classification of brain tumours Pr D.Figarella-Branger Service d Anatomie Pathologique et de Neuropathologie, La Timone, Marseille UMR 911 Inserm, Université d Aix-Marseille The
More informationNeuropathology Evening Session: Case 3
Neuropathology Evening Session: Case 3 Christine E. Fuller, MD Cincinnati Children s Hospital Medical Center Disclosure of Relevant Financial Relationships USCAP requires that all faculty in a position
More informationExamining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to.
Stratified Medicine Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to. Looking in detail at cancer cells and their genetic make up. Permit
More informationIntegrating molecular markers into the World Health Organization classification of CNS tumors: a survey of the neuro-oncology community
Integrating molecular markers into the World Health Organization classification of CNS tumors: a survey of the neuro-oncology community The Harvard community has made this article openly available. Please
More informationA clinical perspective on neuropathology and molecular genetics in brain tumors
A clinical perspective on neuropathology and molecular genetics in brain tumors M.J. van den Bent Erasmus MC Cancer Institute Rotterdam, the Netherlands Disclosures Member speakersbureau: MSD Consultancy:
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationRapid recurrence of a malignant meningioma: case report
Romanian Neurosurgery Volume XXXI Number 2 2017 April-June Article Rapid recurrence of a malignant meningioma: case report Oguz Baran, Sima Sayyahmeli, Taner Tanriverdi, Pamir Erdincler TURKEY DOI: 10.1515/romneu-2017-0027
More informationAssessment performed on Friday, September 18, 2015, at Vancouver General Hospital
Assessors report for ciqc Run 49: ATRX (June 2015) Assessors: S Yip and J Won (recorder) Assessment performed on Friday, September 18, 2015, at Vancouver General Hospital Background The combined application
More informationDako IT S ABOUT TIME. Interpretation Guide. Agilent Pathology Solutions. ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis)
INTERPRETATION Dako Agilent Pathology Solutions IQFISH Interpretation Guide ALK, ROS1 and RET IQFISH probes (Dako Omnis) MET IQFISH probe (Dako Omnis) IT S ABOUT TIME For In Vitro Diagnostic Use ALK, ROS1,
More informationHER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer
P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color
More informationWHO 2016 CNS TUMOR CLASSIFICATION UPDATE. Arie Perry, M.D. Director, Neuropathology
WHO 2016 CNS TUMOR CLASSIFICATION UPDATE Arie Perry, M.D. Director, Neuropathology DISCLOSURES (Arie Perry, MD) I have no financial relationships to disclose. - and - I will not discuss off label use or
More informationCNS SESSION 3/8/ th Multidisciplinary Management of Cancers: A Case based Approach
CNS SESSION Chair: Ruben Fragoso, MD/PhD UC Davis Fellow: Michael Cardenas, MD UC Davis Panel: Gordon Li, MD Stanford Seema Nagpal, MD Stanford Jennie Taylor, MD UCSF HPI: 46 yo right handed woman who
More informationHER2 FISH pharmdx TM Interpretation Guide - Breast Cancer
P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment
More information성균관대학교삼성창원병원신경외과학교실신경종양학 김영준. KNS-MT-03 (April 15, 2015)
성균관대학교삼성창원병원신경외과학교실신경종양학 김영준 INTRODUCTIONS Low grade gliomas (LGG) - heterogeneous group of tumors with astrocytic, oligodendroglial, ependymal, or mixed cellular histology - In adults diffuse, infiltrating
More information21/03/2017. Disclosure. Practice Changing Articles in Neuro Oncology for 2016/17. Gliomas. Objectives. Gliomas. No conflicts to declare
Practice Changing Articles in Neuro Oncology for 2016/17 Disclosure No conflicts to declare Frances Cusano, BScPharm, ACPR April 21, 2017 Objectives Gliomas To describe the patient selection, methodology
More informationDNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas
Paul et al. Clinical Epigenetics (2017) 9:32 DOI 10.1186/s13148-017-0331-9 RESEARCH Open Access DNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas Yashna Paul, Baisakhi
More informationClinical significance of genetic analysis in glioblastoma treatment
Clinical significance of genetic analysis in glioblastoma treatment Department of Neurosurgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan Koji Yoshimoto Can we get prognostic
More informationCorporate Medical Policy
Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas
More informationClassification based on mutations of TERT promoter and IDH characterizes subtypes in grade II/III gliomas
Neuro-Oncology Neuro-Oncology 18(8), 1099 1108, 2016 doi:10.1093/neuonc/now021 Advance Access date 7 March 2016 Classification based on mutations of TERT promoter and IDH characterizes subtypes in grade
More informationSPECIAL SLIDE SEMINAR CASE 3
SPECIAL SLIDE SEMINAR CASE 3 Tihana Džombeta, MD Leo Pažanin, MD, PhD Department of Pathology, School of Medicine, University of Zagreb Department of Pathology, Clinical Hospital Centre Sestre milosrdnice
More informationAnna Maria Buccoliero Department of Biomedicine, Careggi Hospital Florence
PEDIATRIC RHABDOID MENINGIOMA Anna Maria Buccoliero Department of Biomedicine, Careggi Hospital Florence CLINICAL HISTORY A 3-year-old boy, with a recent history of seizures, was admitted to the Neurosurgery
More informationBeyond the World Health Organization grading of infiltrating gliomas: advances in the molecular genetics of glioma classification
Beyond the World Health Organization grading of infiltrating gliomas: advances in the molecular genetics of glioma classification Krishanthan Vigneswaran, Emory University Stewart Neill, Emory University
More informationCharacterization of morphologically benign biologically aggressive meningiomas
Characterization of morphologically benign biologically aggressive meningiomas Original Article Shalinee Rao, N. Sadiya, Saraswathi Doraiswami, D. Prathiba Department of Pathology, Sri Ramachandra Medical
More informationR1601 Essential Immunohistochemical and Molecular Markers for General CNS Glial Tumors
October 22, 2018 12:00-1:00 PM Background The World Health Organization Classification of tumors of the Central Nervous System has recently been revised. There is now greater emphasis on molecular phenotype
More informationImmunohistochemical Classification of Primary and Secondary Glioblastomas
The Korean Journal of Pathology 2013; 47: 541-548 ORIGINAL ARTICLE Immunohistochemical Classification of Primary and Secondary Glioblastomas Kyu Sang Lee Gheeyoung Choe 1 Kyung Han Nam 1 An Na Seo 1 Sumi
More informationIT S ABOUT TIME. IQFISH pharmdx Interpretation Guide THREEHOURSTHIRTYMINUTES. HER2 IQFISH pharmdxtm. TOP2A IQFISH pharmdxtm
I N T E R P R E TAT I O N IQFISH pharmdx Interpretation Guide TM HER2 IQFISH pharmdxtm TOP2A IQFISH pharmdxtm Breast carcinoma (FFPE) stained with HER2 IQFISH pharmdx Breast carcinoma (FFPE) stained with
More informationBAH1 - Primary Glioblastoma
BAH1 - Primary Glioblastoma R frontal tumour for frozen section. No known primary. Contrast enhancing lesion. Cholecystectomy. FROZEN SECTION REPORT Right frontal tumour: The specimen consists of multiple
More informationGenomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
More informationPRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES
PRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES CENTRAL NERVOUS SYSTEM LOW GRADE GLIOMAS CNS Site Group Low Grade Gliomas Author: Dr. Norm Laperriere 1. INTRODUCTION 3 2. PREVENTION 3 3. SCREENING
More informationOriginal Article Glioblastoma with primitive neuronal component: report of a case and review of literature
Int J Clin Exp Med 2017;10(9):13458-13462 www.ijcem.com /ISSN:1940-5901/IJCEM0054665 Original Article Glioblastoma with primitive neuronal component: report of a case and review of literature Jing Liu
More informationDiagnostic application of SNParrays to brain cancers
Diagnostic application of SNParrays to brain cancers Adriana Olar 4/17/2018 No disclosures 55 yo M, focal motor seizure T2 T1-post C DIAGNOSIS BRAIN, LEFT FRONTAL LOBE, BIOPSY: - DIFFUSE GLIOMA, OLIGODENDROGLIAL
More informationSupporting Information
Supporting Information Santagata et al. 10.1073/pnas.1404724111 Extended Description of Fig. 4A Intraoperative MS allows for significant advances in the frequency of intraoperative tissue sampling as well
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationDetection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell lung Cancer (NSCLC) By CISH Technique
Cancer and Clinical Oncology; Vol. 7, No. 1; 2018 ISSN 1927-4858 E-ISSN 1927-4866 Published by Canadian Center of Science and Education Detection of Anaplastic Lymphoma Kinase (ALK) gene in Non-Small Cell
More informationIsocitrate dehydrogenase mutation is associated with tumor location and magnetic resonance imaging characteristics in astrocytic neoplasms
ONCOLOGY LETTERS 7: 1895-1902, 2014 Isocitrate dehydrogenase mutation is associated with tumor location and magnetic resonance imaging characteristics in astrocytic neoplasms SONGTAO QI 1*, LEI YU 1*,
More informationRadioterapia no Tratamento dos Gliomas de Baixo Grau
Radioterapia no Tratamento dos Gliomas de Baixo Grau Dr. Luis Souhami University Montreal - Canada Low Grade Gliomas Relatively rare Heterogeneous, slow growing tumors WHO Classification Grade I Pilocytic
More informationApplications of molecular neuro-oncology - a review of diffuse glioma integrated diagnosis and emerging molecular entities
Wood et al. Diagnostic Pathology (2019) 14:29 https://doi.org/10.1186/s13000-019-0802-8 REVIEW Applications of molecular neuro-oncology - a review of diffuse glioma integrated diagnosis and emerging molecular
More informationPitfalls in the diagnosis of well-differentiated hepatocellular lesions
2013 Colorado Society of Pathology Pitfalls in the diagnosis of well-differentiated hepatocellular lesions Sanjay Kakar, MD University of California, San Francisco Outline Hepatocellular adenoma: new WHO
More informationNeurocytoma a Rare Intraventricular Tumor
Neurocytoma a Rare Intraventricular Tumor J. A. Mallick,S. A. Ali ( Department of Oncology, Liaquat National Postgraduate Medical Centre, Karachi. ) Introduction Central neurocytoma was first recognized
More informationGeneral: Brain tumors are lesions that have mass effect distorting the normal tissue and often result in increased intracranial pressure.
1 Lecture Objectives Know the histologic features of the most common tumors of the CNS. Know the differences in behavior of the different tumor types. Be aware of the treatment modalities in the various
More informationRecent reports have shown that many oligodendroglial
Allelic Losses in Oligodendroglial and Oligodendroglioma-like Neoplasms Analysis Using Microsatellite Repeats and Polymerase Chain Reaction Mahlon D. Johnson, MD, PhD; Cindy L. Vnencak-Jones, PhD; Steven
More informationResearch Article Isocitrate Dehydrogenase-1 Mutations as Prognostic Biomarker in Glioblastoma Multiforme Patients in West Bohemia
BioMed Research International, Article ID 735659, 5 pages http://dx.doi.org/10.1155/2014/735659 Research Article Isocitrate Dehydrogenase-1 Mutations as Prognostic Biomarker in Glioblastoma Multiforme
More informationPRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES
PRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES CENTRAL NERVOUS SYSTEM ANAPLASTIC GLIOMAS CNS Site Group Anaplastic Gliomas Author: Dr. Norm Laperriere Date: February 20, 2018 1. INTRODUCTION
More informationUnderstanding general brain tumor pathology, Part I: The basics. Craig Horbinski, M.D., Ph.D. Department of Pathology University of Kentucky
Understanding general brain tumor pathology, Part I: The basics Craig Horbinski, M.D., Ph.D. Department of Pathology University of Kentucky plan of attack what IS a pathologist, anyway? what s so special
More informationFive Most Common Problems in Surgical Neuropathology
Five Most Common Problems in Surgical Neuropathology If the brain were so simple that we could understand it, we would be so simple that we couldn t Emerson Pugh What is your greatest difficulty in neuropathology?
More informationThe 2016 WHO classification of central nervous system tumors: what neurologists need to know
REVIEW C URRENT OPINION The 2016 WHO classification of central nervous system tumors: what neurologists need to know John C. DeWitt a,, Andreas Mock a,b,c,, and David N. Louis a Purpose of review The 2016
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationWHO 2016 CNS What have we learnt for the future?
WHO 2016 CNS What have we learnt for the future? H.K. Ng Free ppt at http://www.acp.cuhk.edu.hk/hkng Louis DN & Ellison DW et al., 2016 H K, how can we cope with the new molecular requirements in the WHO?
More informationOligodendroglioma: imaging findings, radio-pathological correlation and evolution
Oligodendroglioma: imaging findings, radio-pathological correlation and evolution Poster No.: C-2104 Congress: ECR 2013 Type: Authors: Keywords: DOI: Scientific Exhibit A. Hernandez Castro, M. D. Monedero
More informationI have no conflicts of interest in relation to this presentation. Vogel FS & Burger PC 3/28/2016
IF THIS IS NOT GLIOBLASTOMA, THEN WHAT IS IT? Murat Gokden, MD Department of Pathology/Neuropathology University of Arkansas for Medical Sciences Little Rock, AR mgokden@uams.edu I have no conflicts of
More informationTitle. CitationBrain Tumor Pathology, 34(4): Issue Date Doc URL. Rights. Type. Additional There Information.
Title Diencephalic pediatric low-grade glioma harboring th sequential biopsy specimens Ishi, Yukitomo; Hatanaka, Kanako C.; Yamaguchi, Shig Author(s) Terasaka, Shunsuke; Houkin, Kiyohiro CitationBrain
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Eckel-Passow JE, Lachance DH, Molinaro AM, et al. Glioma groups
More informationSupplemental Information. Molecular, Pathological, Radiological, and Immune. Profiling of Non-brainstem Pediatric High-Grade
Cancer Cell, Volume 33 Supplemental Information Molecular, Pathological, Radiological, and Immune Profiling of Non-brainstem Pediatric High-Grade Glioma from the HERBY Phase II Randomized Trial Alan Mackay,
More informationGiant cell tumor of bone (GCTB) accounts for 5% of all primary. Isocitrate dehydrogenase mutation is frequently observed in giant cell tumor of bone
Isocitrate dehydrogenase mutation is frequently observed in giant cell tumor of bone Mika Kato Kaneko, 1,5 Xing Liu, 1,2,5 Hiroharu Oki, 1,2 Satoshi Ogasawara, 1 Takuro Nakamura, 1 Noriko Saidoh, 1 Yuta
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome! Estimated genetic constitution! Size of average chromosome
More informationTumors of the Nervous System
Tumors of the Nervous System Peter Canoll MD. PhD. What I want to cover What are the most common types of brain tumors? Who gets them? How do they present? What do they look like? How do they behave? 1
More informationMalignant Transformation of a Dysembryoplastic Neuroepithelial Tumor (DNET) Characterized by Genome-Wide Methylation Analysis
J Neuropathol Exp Neurol Vol. 75, No. 4, April 2016, pp. 358 365 doi: 10.1093/jnen/nlw007 ORIGINAL ARTICLE Malignant Transformation of a Dysembryoplastic Neuroepithelial Tumor (DNET) Characterized by Genome-Wide
More informationGamsızkan M, Kantarcıoglu CS, Yılmaz I, Yalcinkaya U, Sungur MA, Buyucek S, Onal B
Tykhe, from Konuralp/Duzce TERT promoter mutation and HER2 gene amplification in malignant peripheral nerve sheath tumours: is there a molecular signature playing role in malignant transformation? Gamsızkan
More informationOligodendrogliomas & Oligoastrocytomas
Oligodendrogliomas & Oligoastrocytomas ABOUT THE AMERICAN BRAIN TUMOR ASSOCIATION Founded in 1973, the American Brain Tumor Association (ABTA) was the first national nonprofit organization dedicated solely
More informationCase Report Xanthomatous meningioma: a case report with review of the literature
Int J Clin Exp Pathol 2013;6(10):2242-2246 www.ijcep.com /ISSN:1936-2625/IJCEP1308033 Case Report Xanthomatous meningioma: a case report with review of the literature Mitsuaki Ishida 1, Tadateru Fukami
More informationPathological spectrum in recurrences of glioblastoma multiforme
pathologica 2015;107:1-8 Original article Pathological spectrum in recurrences of glioblastoma multiforme G. MARUCCI 1, P.V. FABBRI 1, L. MORANDI 1, D. DE BIASE 2, E. DI OTO 1, G. TALLINI 2, C. STURIALE
More informationATRX and IDH1 R132H immunohistochemistry with subsequent copy number analysis and IDH
Acta Neuropathol (2015) 129:133 146 DOI 10.1007/s00401-014-1370-3 ORIGINAL PAPER ATRX and IDH1 R132H immunohistochemistry with subsequent copy number analysis and IDH sequencing as a basis for an integrated
More informationNeuro-Oncology Practice
Neuro-Oncology Practice Neuro-Oncology Practice 3(3), 164 172, 2016 doi:10.1093/nop/npv061 Advance Access date 28 January 2016 Genotyping low-grade gliomas among Hispanics Andrés Felipe Cardona, Leonardo
More informationHistopathological Study and Categorisation of Brain Tumors
Histopathological Study and Categorisation of Brain Tumors Ruchira Wadhwa 1*, Purvi Patel 2, Hansa Goswami 3 1 Third Year Resident, 2 Assistant Professor, 3 Professor and Head, Department of Pathology,
More informationMolecular diagnostics of gliomas: state of the art
Acta Neuropathol (2010) 120:567 584 DOI 10.1007/s00401-010-0736-4 REVIEW Molecular diagnostics of gliomas: state of the art Markus J. Riemenschneider Judith W. M. Jeuken Pieter Wesseling Guido Reifenberger
More informationModeling origin and natural evolution of low-grade gliomas
Modeling origin and natural evolution of low-grade gliomas Mathilde Badoual Paris Diderot University, IMNC lab 2nd HTE workshop: Mathematical & Computer Modeling to study tumors heterogeneity in its ecosystem,
More informationKarl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
Expanding on WHO guideline compliant molecular testing of central nervous system tumors by low density whole genome sequencing. Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
More informationIDH1 mutant malignant astrocytomas are more amenable to surgical resection and have a survival benefit associated with maximal surgical resection
Neuro-Oncology Neuro-Oncology 16(1), 81 91, 2014 doi:10.1093/neuonc/not159 Advance Access date 4 December 2013 IDH1 mutant malignant astrocytomas are more amenable to surgical resection and have a survival
More informationThree Hours Thirty Minutes
INTERPRETATION HER2 IQFISH pharmdx TM Interpretation Guide Three Hours Thirty Minutes it s about time Breast carcinoma (FFPE) stained with HER2 IQFISH pharmdx Gastric cancer (FFPE) stained with HER2 IQFISH
More informationDiffusion Restriction Precedes Contrast Enhancement in Glioblastoma Multiforme
Diffusion Restriction Precedes Contrast Enhancement in Glioblastoma Multiforme Adil Bata 1, Jai Shankar 2 1 Faculty of Medicine, Class of 2017 2 Department of Diagnostic Radiology, Division of Neuroradiology,
More informationAmerican Journal of. Medical Case Reports. CAM5.2 Expression in Metastatic Tumours of CNS: A Diagnostic Tool
American Journal of American Journals of Medical Case Reports http://ivyunion.org/index.php/ajmcr/index Medical Case Reports Mathur SK et al. American Journal of Medical Case Reports 2014, 2:1-8 Vol 2,
More informationp53 expression in invasive pancreatic adenocarcinoma and precursor lesions
Malaysian J Pathol 2011; 33(2) : 89 94 ORIGINAL ARTICLE p53 expression in invasive pancreatic adenocarcinoma and precursor lesions NORFADZILAH MY MBBCH,* Jayalakshmi PAILOOR MPath, FRCPath,* RETNESWARI
More informationAstroblastoma: Radiologic-Pathologic Correlation and Distinction from Ependymoma
AJNR Am J Neuroradiol 23:243 247, February 2002 Case Report Astroblastoma: Radiologic-Pathologic Correlation and Distinction from Ependymoma John D. Port, Daniel J. Brat, Peter C. Burger, and Martin G.
More informationMolDX: Chromosome 1p/19q deletion analysis
MolDX: Chromosome 1p/19q deletion analysis CGS Administrators, LLC Jump to Section... Please Note: This is a Proposed LCD. Proposed LCDs are works in progress and not necessarily a reflection of the current
More informationPROPOSED/DRAFT Local Coverage Determination (LCD): MolDX: Chromosome 1p/19q deletion analysis (DL36483)
moldx: Chromosome 1p/19q deletion analysis (DL36483) Page 1 of 8 PROPOSED/DRAFT Local Coverage Determination (LCD): MolDX: Chromosome 1p/19q deletion analysis (DL36483) Close Section Navigation
More informationEnterprise Interest None
Enterprise Interest None Heterogeneous chromosomal profiles in a unique series of DIPG in children and young adults European Congress of Pathology Amsterdam, 6 th September 2017 Charlotte Dufour, Romain
More informationCase Report Mixed granular cell astrocytoma and fibrosarcoma of the brain: a case report
Int J Clin Exp Pathol 2014;7(7):4473-4478 www.ijcep.com /ISSN:1936-2625/IJCEP0000671 Case Report Mixed granular cell astrocytoma and fibrosarcoma of the brain: a case report Kun Yao 1, Haixiang Wang 2,
More informationMutation-specific IDH1 antibody differentiates oligodendrogliomas and oligoastrocytomas from other brain tumors with oligodendroglioma-like morphology
DOI 10.1007/s00401-010-0770-2 ORIGINAL PAPER Mutation-specific IDH1 antibody differentiates oligodendrogliomas and oligoastrocytomas from other brain tumors with oligodendroglioma-like morphology David
More informationATRX loss refines the classification of anaplastic gliomas and identifies a. subgroup of IDH mutant astrocytic tumors with better prognosis
Wiestler et al. 1 ATRX loss refines the classification of anaplastic gliomas and identifies a subgroup of IDH mutant astrocytic tumors with better prognosis Benedikt Wiestler 1,4, David Capper 2,5, Tim
More informationUNDERSTANDING MOLECULAR TESTING IN BRAIN TUMORS: HOW CLINICALLY USEFUL IS IT?
UNDERSTANDING MOLECULAR TESTING IN BRAIN TUMORS: HOW CLINICALLY USEFUL IS IT? Seema Nagpal, MD Stanford University Stanford, CA Goals: 1. Describe the most commonly used tests in glioma, including MGMT,
More informationBcl-2 and p53 protein expression in all grades of astrocytomas
Southern Adventist Univeristy KnowledgeExchange@Southern Senior Research Projects Southern Scholars 11-1994 Bcl-2 and p53 protein expression in all grades of astrocytomas Robyn L. Castleberg Follow this
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/17/3271 holds various files of this Leiden University dissertation. Author: Verbeke, Sofie Lieve Jozef Title: Primary vascular tumours of bone: towards a new
More information