Copy Number ID2 MYCN ID2 MYCN. Copy Number MYCN DDX1 ID2 KIDINS220 MBOAT2 ID2
|
|
|
- Gavin Wiggins
- 5 years ago
- Views:
Transcription
1 Copy Numer Copy Numer Copy Numer Copy Numer DIPG38 DIPG49 ID2 MYCN ID2 MYCN c DIPG01 d DIPG29 ID2 MYCN ID2 MYCN e STNG2 f MYCN DIPG01 Chr. 2 DIPG29 Chr. 1 MYCN DDX1 Chr. 2 ID2 KIDINS220 MBOAT2 ID2 Supplementry Figure 1 MYCN sugroup show recurrent structurl vrints involving high level mplifiction nd rerrngement of MYCN, ID2 nd KIDINS220 on chromosome 2p. SNP6.0 copy numer profiles of chromosome 2p focl, high-level mplifictions in () DIPG38, () DIPG49, (c) DIPG01 nd (d) DIPG29. These mplifictions lwys involve the genes MYCN, ID2 nd KIDINS220. CIRCOS plots of structurl vrints in (e) DIPG01 nd (f) DIPG29 s determine from WGS dt. Nture Genetics: doi: /ng.2936
2 Supplementry Figure 2 Event grph nd CIRCOS plot of chromothripsis in DIPG29. () The i-directed event grph for chromothripsis event in DIPG29. Red edges represent the genomic intervl of their respective nodes. Blue edges represent groups of discordnt red pirs supporting the sme rekpoint. Arc width is proportionl to the mximl likely copy count. () A CIRCOS plot of chromosome 1 nd 2 from MYCN group ptient, DIPG29. Only those clusters lrger thn 1000p re shown etween chr1 nd chr2. The width of ech rc is proportionl to the log of its estimted copy count. The highest estimted copy count is 61. Nture Genetics: doi: /ng.2936
3 MDM4 DDX-KIDINS220 DDX-MYCN LRRN2 300p 200p 100p 29N 29T 29N 29T KIDINS220 c Brekpoint Brekpoint DDX1 DDX1 KIDINS220 DDX1 MYCN MYCN MYCNOS Supplementry Figure 3 Structurl vrint vlidtion in DIPG29. () Structurl vrint spnning six rekpoints s predicted y discordnt red-pir mppings in DIPG29. () PCR vlidtion of DDX1-KIDINS220 (Left primer: TCTATGCCAGTGCTTTACTCCTT; Right Primer: CTGTTCCACCAAAGCCAAAT) nd DDX1-MYCN (Left Primer: TGAGCAGATTTTCTGTATATTTTCCA; Right Primer: GTCTCCCAGGCTGCAGTG) in tumour nd mtched norml show product nd only in tumor DNA. (c) Snger sequencing through rekpoints in DDX1-KIDINS220 nd DDX1-MYCN structurl vrints. Nture Genetics: doi: /ng.2936
4 Age of Dignosis Telomere Length Rtio (T : N) 3.5 p < ALT negtive ALT positive 14.0 p < ALT negtive ALT positive Supplementry Figure 4 DIPG ptients with ALT phenotype hve longer telomeres nd re dignosed t n older ge. All ALT positive DIPG ptients were found in the H3-K27M sugroup. By WGS, these ptients hd significntly longer telomeres; () 2.28 times longer thn their mtched norml vs. non-alt DIPG ptients which hd telomeres tht were 1.47 times shorter thn their mtched norml (p < ). () There ws significnt difference in ge of dignosis etween ALT negtive (5.89 ± 2.82 yers) vs. ALT positive (10.08 ± 3.61 yers); p <0.0001). Error rs represent the stndrd error of the men. Nture Genetics: doi: /ng.2936
5 Copy Numer Copy Numer DIPG57 DIPG06 KIAA1239 RHOH PDGFRA KIT PVT- 1 MYC GPR125 PDGFRA NMU RBPJ CCKAR TBCD19 Chr. 4 Chr. 8 PVT-1 RHOH KIAA1239 MYC Supplementry Figure 5 H3-H27M DIPG exhiit structurl vrints in PDGFRA nd PVT-1/MYC loci. H3-K27M DIPG ptient often show gins nd mplifictions s well s structurl vrints in () PDGFRA nd () PVT-1/MYC. Nture Genetics: doi: /ng.2936
6 K27M-H3.3 WT-H3.3 Empty vector DNA methyltion (n=102 proes) Gene expression (n = 102 genes) Empty vector WT-H3.3 K27M-H3.3 Empty vector WT-H3.3 K27M-H3.3 Numer of cells (x1000) Empty vector WT-H3.3 K27M-H3.3 NHA Empty vector WT-H3.3 K27M-H3.3 Empty vector WT-H3.3 K27M-H3.3 DAPI FLAG ß - tuulin FLAG -H3.3 c d H3K27me3 H3K27c Totl H3 ß - ctin e f DMEM NSC medi Bet vlues Fold chnge g h Nture Genetics: doi: /ng.2936
7 Supplementry Figure 6 K27M-H3.3 exhiits glol decrese in H3K27me3 when compred to WT-H3.3 in vitro nd in vivo. () Western lot of FLAG-tgged WT-H3.3 nd K27M-H3.3 revels oth clones expressing similr levels of protein. No expression ws detected in untrnsfected NHA nd NHA trnsfected with empty vector control. () Immunofluorescence stining of NHA shows nucler locliztion of FLAG-tgged WT-H3.3 nd K27M-H3.3 protein. (c) K27M-H3.3 expressing NHA cells hve decresed growth rte s compred to oth WT-H3.3 nd empty vector control (p < ). (d) By Western lot, H3K27me3 is decresed in K27M-H3.3 NHA s compred to WT-H3.3 nd empty vector NHA cells y 52% (p = 0.01). (e) Immortlized NHAs trnsfected with K27M-H3.3 show phenotypic chnges compred to empty vector nd WT-H3.3 control, forming cell clusters t high density when seeded in DMEM nd growing semi-dherently in neurl stem cell medi. (f) K27M-H3.3 NHAs hve different methyltion nd expression profiles s compred to controls. The ssocition of decresed H3K27me3 nd mutnt histone H3 is lso seen y immunohistochemicl stining of DIPG tissue micro-rry, where ptients with K27M-H3.3 (g) show decresed H3K27me3. DIPG ptients tht re WT-H3.3 (h) show more positive stining y IHC for H3K27me3. Nture Genetics: doi: /ng.2936
8 Empty vector K27M-H3.3 dherent K27M-H3.3 semi-dherent DAPI GFAP DAPI GFAP DAPI GFAP DAPI Nestin DAPI Nestin DAPI Nestin DAPI SOX2 DAPI SOX2 DAPI SOX2 DAPI TUJ1 DAPI TUJ1 DAPI TUJ1 DAPI O4 DAPI O4 DAPI O4 Supplementry Figure 7 K27M-H3.3 semi-dherent cells exhiit higher SOX2 expression. Immunofluorescence stining of empty vector, K27M-H3.3 dherent nd K27M-H3.3 semi-dherent inha revels incresed SOX2 expression in the semidherent cells ut no chnges in GFAP, Nestin, TUJ1 or O4. Imges were tken t 400X mgnifiction. Nture Genetics: doi: /ng.2936
9 (1) Chr. A (2) Chr. B c (2) Chr. A (1) Chr. Z Chr. B Supplementry Figure 8 Discordnt red-pir clustering. () Schemtic of discordnt red pirs supporting trnsloction event (1) nd clipped mppings nrrowing in rekpoint loction (2). () Red-pirs s viewed y trnslocted region ligned to tumor genome. (c) The spnning reds in the norml smple provide n expected rrivl count for the Poisson distriution when used to determine mximum likelihood copy counts. Nture Genetics: doi: /ng.2936
10 Nture Genetics: doi: /ng.2936
11 Nture Genetics: doi: /ng.2936
12 Nture Genetics: doi: /ng.2936
SUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
SUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
SUPPLEMENTARY INFORMATION
TM TM tip link horizontl top connectors 1 leucine-rich (21 %) otoncorin-like 1809 ntigenic peptides B D signl peptide hydrophoic segment proline/threonine-rich (79 %) Supplementry Figure 1. () The outer
Supplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
Acute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
SUPPLEMENTARY INFORMATION
. Norml Physiologicl Conditions. SIRT1 Loss-of-Function S1. Model for the role of SIRT1 in the regultion of memory nd plsticity. () Our findings suggest tht SIRT1 normlly functions in coopertion with YY1,
Alimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
Supplementary figure 1
Supplementry figure 1 Dy 8 post LCMV infection Vsculr Assoc. Prenchym Dy 3 post LCMV infection 1 5 6.7.29 1 4 1 3 1 2 88.9 4.16 1 2 1 3 1 4 1 5 1 5 1.59 5.97 1 4 1 3 1 2 21.4 71 1 2 1 3 1 4 1 5 1 5.59.22
SUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
Invasive Pneumococcal Disease Quarterly Report July September 2018
Invsive Pneumococcl Disese Qurterly Report July Septemer Introduction Since 17 Octoer 2008, invsive pneumococcl disese (IPD) hs een notifile to the locl Medicl Officer of Helth under the Helth Act 1956.
Supplementary Figure 1
Supplementry Figure 1 c d Wistr SHR Wistr AF-353 SHR AF-353 n = 6 n = 6 n = 28 n = 3 n = 12 n = 12 Supplementry Figure 1 Neurophysiologicl properties of petrosl chemoreceptive neurones in Wistr nd SH rts.
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
SUPPLEMENTARY INFORMATION
doi:0.08/nture0987 SUPPLEMENTARY FIGURE Structure of rbbit Xist gene. Exons re shown in boxes with romn numbers, introns in thin lines. Arrows indicte the locliztion of primers used for mplifiction. WWW.NATURE.COM/NATURE
Using Paclobutrazol to Suppress Inflorescence Height of Potted Phalaenopsis Orchids
Using Pcloutrzol to Suppress Inflorescence Height of Potted Phlenopsis Orchids A REPORT SUBMITTED TO FINE AMERICAS Linsey Newton nd Erik Runkle Deprtment of Horticulture Spring 28 Using Pcloutrzol to Suppress
PNEUMOVAX 23 is recommended by the CDC for all your appropriate adult patients at increased risk for pneumococcal disease 1,2 :
PNEUMOVAX 23 is recommended y the CDC for ll your pproprite dult ptients t incresed risk for pneumococcl disese 1,2 : Adults ged
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
Optimisation of diets for Atlantic cod (Gadus morhua) broodstock: effect of arachidonic acid on egg & larval quality
Optimistion of diets for Atlntic cod (Gdus morhu) roodstock: effect of rchidonic cid on egg & lrvl qulity Dr Gordon Bell, Ms. An Blnco, Dr Bill Roy, Dr Derek Roertson, Dr Jim Henderson nd Mr Richrd Prickett,
SUPPLEMENTARY INFORMATION
Supplementry Figure 1. Genertion of N- nd C-tgged cyclin D1 knock-in mice., N-tgged cyclin D1 gene trgeting construct, cyclin D1 genomic locus, cyclin D1 locus following homologous recomintion (trgeted
% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
Study of Stress Distribution in the Tibia During Stance Phase Running Using the Finite Element Method
Ksetsrt J. (Nt. Sci.) 48 : 729-739 (2014) Study of Stress Distriution in the Tii During Stnce Phse Running Using the Finite Element Method Thepwchr Ruchirh 1, Tumrong Puttpitukporn 1, * nd Siriporn Ssimontonkul
EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1
Swine Dy 2001 Contents EVALUATION OF DIFFERENT COPPER SOURCES AS A GROWTH PROMOTER IN SWINE FINISHING DIETS 1 C. W. Hstd, S. S. Dritz 2, J. L. Nelssen, M. D. Tokch, nd R. D. Goodbnd Summry Two trils were
Effects of physical exercise on working memory and prefrontal cortex function in post-stroke patients
Effects of physicl exercise on working memory nd prefrontl cortex function in post-stroke ptients M Moriy, C Aoki, K Sktni Grdute School of Helth Sciences Reserch, Mjor of Physicl Therpy, TeikyoHeisei
Comparison of three simple methods for the
J. clin. Pth. (1967), 2, 5 Comprison of three simple methods for the ssessment of 'free' thyroid hormone T. M. D. GIMLETTE1 From the Rdio-Isotope Lbortory, St. Thoms's Hospitl, London SYNOPSIS A dilysis
supplementary information
DOI: 10.1038/nc2089 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 H3K4me1 5 PN N1-2 PN H3K4me1 H3K4me1 H3K4me1 2-cell stge 2-c st cell ge Figure S1 Pttern of loclistion of H3K4me1 () nd () during zygotic development
PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
Check your understanding 3
1 Wht is the difference etween pssive trnsport nd ctive trnsport? Pssive trnsport is the movement of prticles not requiring energy. Movement of prticles in ctive trnsport uses energy. 2 A gs tp in the
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
Supplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
Supplementary Materials. Viral delivery of mir-196a ameliorates the SBMA phenotype via the silencing of CELF2
Supplementry Mterils Virl delivery of mir-96 meliortes the SBMA phenotype vi the silencing of CELF2 Yu Miyzki, Hiroki Adchi, Mshis Ktsuno, Mkoto Minmiym, Yue-Mei Jing, Zhe Hung, Hideki Doi, Shinjiro Mtsumoto,
Effect of 1-Methylcyclopropene on the Physiology and Yield of Cotton. Derrick Oosterhuis Eduardo Kawakami and Dimitra Loka University of Arkansas
Effect of 1-Methylcyclopropene on the Physiology nd Yield of Cotton Derrick Oosterhuis Edurdo Kwkmi nd Dimitr Lok University of Arknss Cotton Crop Gossypium hirsutum Unique out cotton Perennil grown s
Invasive Pneumococcal Disease Quarterly Report. July September 2017
Invsive Pneumococcl Disese Qurterly Report July September 2017 Prepred s prt of Ministry of Helth contrct for scientific services by Rebekh Roos Helen Heffernn October 2017 Acknowledgements This report
SUPPLEMENTARY INFORMATION
doi:1.138/nture17 Men tumour dimeter (mm) 2 Rg2-/- 2 1 2 2 1 Control IgG!-CD8!-CD4 1 2 3 1 2 3 c Men tumour dimeter (mm) 2 2 1 d Ifnr1-/- Rg2-/- 2 2 1 Ifngr1-/- d42m1!ic 1 2 3 Dys post trnsplnt 1 2 3 Supplementry
Supplementary Figure S1
Supplementry Figure S1 d MAP2 GFAP e MAP2 GFAP GFAP c f Clindin GFAP Supplementry Figure S1. Neuronl deth nd ltered strocytes in the rin of n ffected child. Neuron specific MAP2 ntiody stining in the hippocmpus
Feeding state and age dependent changes in melaninconcentrating hormone expression in the hypothalamus of broiler chickens
Supplementry Mterils Epub: No 2017_23 Vol. 65, 2018 https://doi.org/10.183/bp.2017_23 Regulr pper Feeding stte nd ge dependent chnges in melninconcentrting hormone expression in the hypothlmus of broiler
Single-Molecule Studies of Unlabelled Full-Length p53 Protein Binding to DNA
Single-Molecule Studies of Unlbelled Full-Length p53 Protein Binding to DNA Philipp Nuttll, 1 Kidn Lee, 2 Pietro Ciccrell, 3 Mrco Crminti, 3 Giorgio Ferrri, 3 Ki- Bum Kim, 2 Tim Albrecht 1* 1 Imperil College
Supplementary Information. Title: RAS-MAPK dependence underlies a rational polytherapy strategy in EML4-
Supplementry Informtion Title: RAS-MAPK dependence underlies rtionl polytherpy strtegy in EML4- ALK positive lung cncer Authors: Gorjn Hrustnovic, Victor Olivs, Evngelos Pzrentzos, Asmin Tulpule, Surh
SUPPLEMENTARY INFORMATION
doi:.3/nture93 d 5 Rttlesnke DRG (reds) Rttlesnke TG (reds) c 3 TRPV1 other TRPs 1 1 3 Non-pit snke TG (reds) SFig. 1 5 5 3 other TRPs TRPV1 1 1 3 Non-pit snke DRG (reds) 5 Antomy of the pit orgn nd comprison
SUPPLEMENTARY INFORMATION
doi:.38/nture72 Neurl correltes, computtion nd ehviourl impct of decision confidence Kepecs A., Uchid N., Zriwl H. nd Minen Z.F. Confidence estimtes in integrtor models of decision-mking Computing decision
Supplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
Defective Wnt-dependent cerebellar midline fusion in a mouse model of Joubert syndrome
correction notice Nt. Med. 17, 726 731 (2011) Defective Wnt-dependent cereellr midline fusion in mouse model of Jouert syndrome Mdeline A Lncster, Dipik J Gopl, Joon Kim, Shr N Sleem, Jennifer L Silhvy,
Supplementary Online Content
Supplementry Online Content Zulmn DM, Pl Chee C, Ezeji-Okoye SC, et l. Effect of n intensive outptient progrm to ugment primry cre for high-need Veterns Affirs ptients: rndomized clinicl tril. JAMA Intern
Lesions of prefrontal cortex reduce attentional modulation of neuronal responses. and synchrony in V4
Lesions of prefrontl ortex reue ttentionl moultion of neuronl responses n synhrony in V4 Georgi G. Gregoriou,, Anrew F. Rossi, 3 Leslie G Ungerleier, 4 Roert Desimone 5 Deprtment of Bsi Sienes, Fulty of
Diabetes mellitus secondary to pancreatic diseases (type 3c): The effect of smoking on the exocrine endocrine interactions of the pancreas
764062DVR0010.1177/1479164118764062Dibetes & Vsculr Disese ReserchŚliwińsk-Mossoń et l. reserch-rticle2018 Originl Article Dibetes mellitus secondry to pncretic diseses (type 3c): The effect of smoking
Heparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
Reduced expression of cytokeratin 4 and 13 is a valuable marker for histologic grading of esophageal squamous intraepithelial neoplasia
J Med Dent Sci 2012; 59: 17-28 Originl Article Reduced expression of cytokertin 4 nd 13 is vlule mrker for histologic grding of esophgel squmous intrepithelil neoplsi Mski Tkshim 1), Hiroshi Kwchi 1),
Non-invasive Diagnosis of Liver Clinical Condition by Real-time Tissue Elastography and Shear Wave Measurement : Get More Accessible by One Probe
XXXXXXXXXX Non-invsive Dignosis of Liver Clinicl Condition y Rel-time Tissue Elstogrphy nd Sher Wve Mesurement : Get More Accessile y One Proe Norihis Yd Mstoshi Kudo Deprtment of Gstroenterology nd Heptology,
ORIGINAL ARTICLE. Diagnostic Signs of Accommodative Insufficiency. PILAR CACHO, OD, ÁNGEL GARCÍA, OD, FRANCISCO LARA, OD, and M A MAR SEGUÍ, OD
1040-5488/02/7909-0614/0 VOL. 79, NO. 9, PP. 614 620 OPTOMETRY AND VISION SCIENCE Copyright 2002 Americn Acdemy of Optometry ORIGINAL ARTICLE Dignostic Signs of Accommodtive Insufficiency PILAR CACHO,
Supplementary Online Content
Supplementry Online Content Rieckmnn N, Kronish IM, Shpiro PA, Whng W, Dvidson KW. Serotonin reuptke inhibitor use, depression, nd long-term outcomes fter n cute coronry : prospective cohort study. JAMA
SUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
SUPPLEMENTARY INFORMATION
SUPPEMENTARY INFORMATION DOI: 1.138/ncb956 Norml CIS Invsive crcinom 4 months months b Bldder #1 Bldder # Bldder #3 6 months (Invsive crcinom) Supplementry Figure 1 Mouse model of bldder cncer. () Schemtic
SUPPLEMENTARY INFORMATION
DOI:.38/nc393 Nnog DAPI Nnog/DAPI c-jun DAPI c-jun/dapi c e Reltive expression to Gpdh mescs ( Feeder free) mescs ( Feeder) MEFs.5 MEFs ipscs ESCs..5 p=.24 p=.483 p=.22. JunB JunD Fos Fr Fr2 ATF2 ATF3
Original Article. T Akter 1, N Islam 2, MA Hoque 3, S Khanam 4, HA khan 5, BK Saha 6. Abstract:
Fridpur Med. Coll. J. 214;9(2):61-67 Originl Article Nebuliztion by Isotonic Mgnesium Sulphte Solution with Provide Erly nd Better Response s Compred to Conventionl Approch ( Plus Norml Sline) in Acute
WSU Tree Fruit Research and Extension Center, Wenatchee (509) ext. 265;
FINAL REPORT WTFRC Project # AH-1-5 WSU Project # 13C-355-3 Project title: PI: Orgniztion: Coopertors: of Sunburn in Apples with RAYNOX Lrry Schrder, Horticulturist WSU Tree Fruit Reserch nd Extension
General Microscopic Changes
Generl Microscopic Chnges 2 This chpter covers collection of microscopic chnges tht lck dignostic specificity ut occur in different specific diseses, s will ecome pprent in susequent chpters. Almost ll
Adipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
SUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
An Energy Efficient Seizure Prediction Algorithm
An Energy Efficient Seizure Prediction Algorithm Zhongnn Fng Electricl Engineering Stnford University zhongnn@stnford.edu Yun Yun Sttistics Stnford University yun@stnford.edu Andrew Weitz Bioengineering
Effect of fungicide timing and wheat varietal resistance on Mycosphaerella graminicola and its sterol 14 α-demethylation-inhibitorresistant
Effect of fungicide timing nd whet vrietl resistnce on Mycospherell grminicol nd its sterol 14 α-demethyltion-inhiitorresistnt genotypes Didierlurent L., Roisin-Fichter C., Snssené J., Selim S. Pltform
Fertility in Norwegian testicular cancer patients
DOI: 0.054/ bjoc.999.0989, vilble online t http://www.idelibrry.com on Fertility in Norwegin testiculr cncer ptients SD Fosså nd Ø Krvdl 2 The Norwegin Rdium Hospitl, Montebello, N-030 Oslo, Norwy; 2 The
8/1/2017. Correlating Radiomics Information with Clinical Outcomes for Lung SBRT. Disclosure. Acknowledgements
Correlting Rdiomics Informtion with Clinicl Outcomes for Lung SBRT Fng-Fng Yin, PhD Duke University Medicl Center AAPM 2017 Denver CO Disclosure This reserch is prtilly funded by reserch grnt from Vrin
The Dynamics of Varicella-Zoster Virus Epithelial Keratitis in Herpes Zoster Ophthalmicus
Chpter 2 The Dynmics of Vricell-Zoster Virus Epithelil Kertitis in Herpes Zoster Ophthlmicus The morphology of n individul VZV lesion reflects sequence of events triggered y the virus impct on cornel epithelil
SUPPLEMENTARY INFORMATION
doi:.38/nture73 Glucose SSP THF Methyl- THF Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA Cycle Glucose p53 p Purines 3- PG PHGDH PSAT PSPH Glycine SHMT GSH Lctte Pyruvte ROS TCA
SUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
SUPPLEMENTARY INFORMATION
doi:0.08/nture078 RNse VifHA VifHA βctin 6 Cell lyste IP: ntiha MG VifHA VifHA β ctin 6 7 Cell lyste IP: ntiha Supplementry Figure. Effect of RNse nd MG tretment on the Vif interction., RNse tretment does
Efficacy of Pembrolizumab in Patients With Advanced Melanoma With Stable Brain Metastases at Baseline: A Pooled Retrospective Analysis
Efficcy of Pembrolizumb in Ptients With Advnced Melnom With Stble Brin Metstses t Bseline: A Pooled Retrospective Anlysis Abstrct 1248PD Hmid O, Ribs A, Dud A, Butler MO, Crlino MS, Hwu WJ, Long GV, Ancell
Meat and Food Safety. B.A. Crow, M.E. Dikeman, L.C. Hollis, R.A. Phebus, A.N. Ray, T.A. Houser, and J.P. Grobbel
Met nd Food Sfety Needle-Free Injection Enhncement of Beef Strip Loins with Phosphte nd Slt Hs Potentil to Improve Yield, Tenderness, nd Juiciness ut Hrm Texture nd Flvor B.A. Crow, M.E. Dikemn, L.C. Hollis,
Time trends in repeated spirometry in children
Eur Resplr J 199, 6, 55:H559 Time trends in repeted spirometry in children G. Hoek*t, B. Brunekreef* Time trends in repeted spirometry in children. G. Hoek, B. Brunekreef. BSTRCT: In study on cute helth
Visualization of Stent Lumen in MR Imaging: Relationship with Stent Design and RF Direction
0 66 0 Visuliztion of Stent Lumen in MR Imging: Reltionship with Stent Design nd RF Direction,*,c d e f f c d e 0 66 ʼ ʼ ʼʼ ʼʼ ʼ ʼ ʼ ʼ ʼ ʼ ʼ ʼʼ ʼ June 0 Visuliztion of Stent Lumen in MR Imging Stent Stent
*** *** *** *** T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. T-cells T-ALL. Relative ATP content. Relative ATP content RLU RLU
RLU Events 1 1 1 Luciferin (μm) T-cells T-ALL 1 1 Time (min) T-cells T-ALL 1 1 1 1 DCF-DA Reltive ATP content....1.1.. T-cells T-ALL RLU 1 1 T-cells T-ALL Luciferin (μm) 1 1 Time (min) c d Control e DCFH-DA
PROVEN ANTICOCCIDIAL IN NEW FORMULATION
PROVEN ANTICOCCIDIAL IN NEW FORMULATION Coxidin 100 microgrnulte A coccidiosttic dditive for roilers, chickens rered for lying nd turkeys Contins 100 g of monensin sodium per kg Aville s homogenous grnules
Optimal sites for orthodontic mini-implant placement assessed by cone beam computed tomography
Originl Article Optiml sites for orthodontic mini-implnt plcement ssessed by cone bem computed tomogrphy Mon Mohmed Slh Fyed ; Pwel Pzer b ; Christos Ktsros c ABSTRACT Objectives: To determine (1) the
The Effects of Small Sized Rice Bowl on Carbohydrate Intake and Dietary Patterns in Women with Type 2 Diabetes
Originl Article doi: 10.4093/kdj.2010.34.3.166 pissn 1976-9180 eissn 2093-2650 The Effects of Smll Sized Rice Bowl on Crbohydrte Intke nd Dietry Ptterns in Women with Type 2 Dibetes Hee-Jung Ahn 1, *,
Low-pass whole-genome sequencing in clinical cytogenetics: a validated approach
Americn College of Medicl Genetics nd Genomics Originl Reserch Article Low-pss whole-genome sequencing in clinicl cytogenetics: vlidted pproch Zirui Dong, MSc 3, Jun Zhng, MD 4, Ping Hu, PhD 5, Hixio Chen,
Geographical influence on digit ratio (2D:4D): a case study of Andoni and Ikwerre ethnic groups in Niger delta, Nigeria.
Journl of Applied Biosciences 27: 1736-1741 ISSN 1997 5902 Geogrphicl influence on digit rtio (2D:4D): cse study of Andoni nd Ikwerre ethnic groups in Niger delt, Nigeri. Gwunirem, Isrel U 1 nd Ihemelndu,
Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET
Supplemental Figure Legends Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Multiple unsupervised analyses were performed on human HT-1v4 expression array (Illumina) data from
Extraction and Some Functional Properties of Protein Extract from Rice Bran
Ksetsrt J. (Nt. Sci.) 40 : 209-214 (2006) Extrction nd Some Functionl Properties of Protein Extrct from Rice Brn Chockchi Theerkulkit*, Siree Chiseri nd Siriwt Mongkolknchnsiri ABSTRACT Rice brn protein
Serum nesfatin-1 levels are decreased in pregnant women newly diagnosed with gestational diabetes
originl rticle Serum nesftin-1 levels re decresed in pregnnt women newly dignosed with gesttionl dibetes Esr Nur Ademoglu 1, Suheyl Gorr 2, Muge Keskin 3, Ayse Crlioglu 4, Rifki Ucler 5, Husmettin Erdmr
Shinhaeng Cho, Youngmoon Goh, Chankyu Kim, Haksoo Kim, Jong Hwi Jeong, Young Kyung Lim, Se Byeong Lee, Dongho Shin
Originl Article PMP Progress in Medicl Physics 28(4), Decemer 217 https://doi.org/1.14316/pmp.217.28.4.144 pissn 28-444, eissn 28-443 Dosimetric Impct of Ti Mesh on Proton Bem Therpy Shinheng Cho, Youngmoon
Input from external experts and manufacturer on the 2 nd draft project plan Stool DNA testing for early detection of colorectal cancer
Input externl experts nd mnufcturer on the 2 nd drft project pln Stool DNA testing for erly detection of colorectl cncer (Project ID:OTJA10) All s nd uthor s replies on the 2nd drft project pln Stool DNA
SUPPLEMENTARY INFORMATION
DOI: 1.138/nc286 Figure S1 e f Medium DMSO AktVIII PP242 Rp S6K1-I Gr1 + + + + + + Strvtion + + + + + IB: Akt-pT38 IB: Akt K-pT389 K IB: Rptor Gr1 shs6k1-a shs6k1-b shs6k1-c shrictor shrptor Gr1 c IB:
Common genetic variation in the melatonin receptor 1B gene (MTNR1B) is associated with decreased early-phase insulin response
Dietologi (2009) 52:1537 1542 DOI 10.1007/s00125-009-1392-x ARTICLE Common genetic vrition in the meltonin receptor 1B gene (MTNR1B) is ssocited with decresed erly-phse insulin response C. Lngenerg & L.
Identical twins with borderline lepromatous leprosy mimicking extensive alopecia areata: A rare presentation
Lepr Rev (2018) 89, 301 305 CASE REPORT Identicl twins with orderline lepromtous leprosy mimicking extensive lopeci ret: A rre presenttion RUBINA JASSI*, KRISHNA DEB BURMAN**, BHAVYA SWARNKAR** & RADHIKA
Characteristics of hip involvement in patients with ankylosing spondylitis in Korea
ORIGINAL ARTICLE Koren J Intern Med 2017;32:158-164 Chrcteristics of hip involvement in ptients with nkylosing spondylitis in Kore Hyemin Jeong, Yeong Hee Eun, In Young Kim, Hyungjin Kim, Jejoon Lee, Eun-Mi
SUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
DOI: 10.1038/nc2331 PCre;Ros26R 12 h induction 48 h induction Vegfr3 i EC c d ib4 24 h induction VEGFR3 e Fold chnge 1.0 0.5 P < 0.05 Vegfr3 i EC Vegfr3 Figure S1 Cre ctivtion leds to genetic deletion
Consumer perceptions of meat quality and shelf-life in commercially raised broilers compared to organic free range broilers
Consumer perceptions of met qulity nd shelf-life in commercilly rised roilers compred to orgnic free rnge roilers C.Z. ALVARADO 1 *, E. WENGER 2 nd S. F. O KEEFE 3 1 Texs Tech University, Box 42141 Luock,
Safety and Tolerability of Subcutaneous Sarilumab and Intravenous Tocilizumab in Patients With RA
Sfety nd Tolerbility of Subcutneous Srilumb nd Intrvenous Tocilizumb in Ptients With RA Pul Emery, 1 Jun Rondon, 2 Anju Grg, 3 Hubert vn Hoogstrten, 3 Neil M.H. Grhm, 4 Ming Liu, 4 Nncy Liu, 3 Jnie Prrino,
Rates of weight change for black and white Americans over a twenty year period
Interntionl Journl of Obesity (2003) 27, 498 504 & 2003 Nture Publishing Group All rights reserved 0307-0565/03 $25.00 www.nture.com/ijo PAPER Rtes of weight chnge for blck nd white Americns over twenty
SUPPLEMENTARY INFORMATION
DOI:.3/nc37 This Supplementry Informtion file ws updted with new reference (ref. 3) on Decemer WWW.NATURE.COM/NATURECELLBIOLOGY Mcmilln Pulishers Limited. All rights reserved logfc SUPPLEMENTARY INFORMATION
Metabolic syndrome as a risk factor for high-ocular tension
Interntionl Journl of Oesity (2010) 1 9 & 2010 Mcmilln Pulishers Limited All rights reserved 0307-0565/10 $32.00 www.nture.com/ijo ORIGINAL ARTICLE Metolic syndrome s risk fctor for high-oculr K Imi 1,
ARTICLE. E. Pavlova 1, N. Atanassova 1, C. McKinnell 2, R.M. Sharpe 2 1 Institute of Experimental Morphology, Pathology and Anthropology with Museum,
DOI:.554/5YRTIMB..3 OPPOSITE MODELS OF EXPRESSION OF ANDROGEN RECEPTOR (AR) AND RETINOIC ACID RECEPTOR-α (RAR-α) IN THE ONSET OF MALE GERM CELL DEVELOPMENT IN HORMONALLY MANIPULATED RATS E. Pvlov, N. Atnssov,
Diagnostic Accuracy of Mini-Mental Status Examination and Revised Hasegawa Dementia Scale for Alzheimer s Disease
Originl Reserch Article Dement Geritr Cogn Disord 2005;19:324 330 DOI: 10.1159/000084558 Accepted: Novemer 1, 2004 Pulished online: Mrch 22, 2005 Dignostic Accurcy of Mini-Mentl Sttus Exmintion nd Revised
SUPPLEMENTARY INFORMATION
doi:1.13/nture173 Supplementry Text: Wheel-running ctivity hs secondry effects on ehvior Previous studies utilized wheel-running ctivity to ssy the influence the cycles on circdin rhythms 1, 2. Since wheel
Ultrasound Energy in Phacoemulsification: A Comparative Analysis of Phaco-Chop and Stop-and-Chop Techniques According to the Degree of Nuclear Density
c l i n c i l s c i e n c e Ultrsound Energy in Phcoemulsifiction: A Comprtive Anlysis of Phco-Chop nd Stop-nd-Chop Techniques According to the Degree of Nucler Density Jung Hyun Prk, MD; Sng Mok Lee,
Supplementary Fig. 1. Aortic micrornas are differentially expressed in PFM v. GFM.
Reltive expression 5 1 15 2-5 5 (n = 3) (n = 3) GFM nd PFM PFM GFM mmu-mir-145 mmu-mir-143 mmu-mir-72 mmu-mir-22 mmu-mir-27 mmu-mir-125-5p mmu-mir-23 mmu-mir-29 mmu-mir-126-3p mmu-let-7d mmu-let-7c mmu-mir-199-3p
Incidence and influence of GB virus C and hepatitis C virus infection in patients undergoing bone marrow transplantation
Bone Mrrow Trnsplnttion, (1998) 21, 1131 1135 1998 Stockton Press All rights reserved 0268 3369/98 $12.00 http://www.stockton-press.co.uk/mt Incidence nd influence of GB virus C nd heptitis C virus infection
Paper-based skin patch for the diagnostic screening of cystic fibrosis
Electronic Supplementry Mteril (ESI) for ChemComm. This journl is The Royl Society of Chemistry 2015 Supplementry informtion Pper-bsed skin ptch for the dignostic screening of cystic fibrosis Xun Mu,*
Original Article. Heon-Mook Park a ; Yang-Ku Lee b ; Jin-Young Choi c ; Seung-Hak Baek d
Originl Article Mxillry incisor inclintion of skeletl Clss III ptients treted with extrction of the upper first premolrs nd two-jw surgery Conventionl orthognthic surgery vs surgery-first pproch Heon-Mook
Roughage Type & Level & Grain Processing Interactions with Distiller s s Grains Diets. Matt May High Plains Bio Fuels Co-Product Nutrition Conference
Roughge Type & Level & Grin Processing Interctions with Distiller s s Grins Diets Mtt My High Plins Bio Fuels Co-Product Nutrition Conference Why do we flke grin? Stem-flked corn (SFC) vs. dry-rolled rolled