Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
|
|
|
- Melina Tamsyn Stewart
- 6 years ago
- Views:
Transcription
1 Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor blocks were subject to PCR amplification, followed by sequencing by Quintara Bio (San Francisco, CA). Data files were analyzed by using SnapGene Viewer. Shown are representative DNA sequences from Patient 9393 with the R132S mutation in IDH1 and Patient 9898 with both WT IDH1 and WT IDH2 genes. The red boxes indicate DNA coding for amino acids 132 and 172 for IDH1 and IDH2, respectively.
2 Supplementary Figure 2. CD3 + CD8 + cells in WHO grade III glioma tissue by immunofluorescence. Merged immunofluorescence staining of CD3 (red), CD8 (yellow) and nuclei (blue) on FFPE tumor sections from WHO grade III IDH-WT (n=5) and IDH-MUT (n=5) glioma cases. Each panel represents an individual case. Red circles represent automated cell masks on CD3 + CD8 + double positive cells as determined by StrataQuest software. The middle panel of the MUT group also appears in the merged image for the representative MUT case in Figure 1A. Scale bar: 20 μm. Immunofluorescence microscopy was performed on a Zeiss Axio- Imager Z2 and X-Cite XLED1 High Power LED fluorescence source using a 20x/0.5 NA objective and Hamamatsu Orca-Flash 4.0 camera. Images were acquired with TissueFAXS software 4.2, and analyzed with StrataQuest software. 2
3 Supplementary Figure 3. CD3 + CD8 - cells/mm 2 in WHO grade III gliomas. (i)number of CD3 + CD8 - cells per area (mm 2 ) of tumor, calculated for each IDH-WT (n=6) and IDH-MUT (n=7) case using StrataQuest software. Each dot represents a value from a single patient and black lines represent the mean of samples in a group. P value was determined by a 2-sided, unpaired t-test. (ii) Representative staining showing the presence of a CD3 + CD4 + T-cell in a Grade III glioma sample. (iii) Positive control staining of a γδ TCR (Green) on a CD3 + T-cell (Red) in a tonsil section. Representative staining demonstrating absence of γδ staining on T-cells from evaluated IDH-WT (n=5 cases) and IDH-MUT (n=5 cases) grade III glioma sections. 3
4 Supplementary Figure 4. 2HG levels in GL261, NHA and SB28 models by LC-MS. Aliquots of 1x10 6 GL261 R132H, NHA R132H, and SB28 R132H cells were cultured for 24 hours with fresh media. Supernatant was collected and cells were re-suspended in 80% methanol and 20% deionized water for analysis. Samples were analyzed for 2HG on a Sciex API-5000 LC-MS/MS system. (Left panel) 2HG levels detected in GL261-WT or GL261-MUT lysate or supernatant with or without IDH-C35 (1 μm for 3 days). (Middle panel) 2HG levels in cell lysates or supernatant from NHA-WT or NHA-MUT cells. (Right panel) 2HG levels in supernatant from cultured SB28-WT or SB28-MUT cells. 4
5 Supplementary Figure 5. IFN-γ-inducible and chemokine-related genes in GL261 WT and GL261 R132H tumors. C57BL/6 mice received intracranial injections of 1x10 5 GL261 WT (WT) or GL261 R132H (MUT) glioma cells. Day 21 tumors were removed from mice and further assessed by RT-PCR for expression of Cxcl10 and Oas2. P values were determined by 2-tailed, unpaired t test. 5
6 Supplementary Figure 6. CXCL9 and CXCL10 levels in NHA WT /NHA R132H and SB28 WT /SB28 R132H cells. (Left) RT-PCR analysis of CXCL9 and CXCL10 on RNA derived from NHA R132H (NHA-MUT), SB28 R132H (SB28-MUT) NHA WT (NHA-WT) and SB28 WT (SB28- WT) cells. RNA levels were normalized to Gapdh and are shown relative to WT samples. (Right) CXCL10 ELISA performed on supernatant from NHA-WT and NHA-MUT cells stimulated with IFN-γ for 12 hours. Results shown are representative of at least 2 independent experiments. P values were determined by 2-tailed, unpaired t test. 6
7 Supplementary Figure 7. Expression levels of immune-related genes in IDH-WT and IDH- MUT cell lines. Amplification plots from RT-PCR analysis of GAPDH, CD8A, CD8B, GZMB, and IFNG in total RNA derived from NHA R132H (NHA-MUT), SB28 R132H (SB28-MUT) NHA WT (NHA-WT), SB28 WT (SB28-WT), GL261 R132H (GL261-MUT), and GL261 WT (WT) cells. RNA levels were normalized to GAPDH. NTC indicated no transcript control. 7
8 Supplementary Figure 8. Transwell migration of CD8 + T-cells towards SB28 WT /SB28 R132H CM. Chemotaxis of 1x10 6 CD8 + T-cells pre-stimulated for 48 hours with anti-cd3/anti-cd28 towards SB28 WT (IDH-WT) SB28 R132H (IDH-MUT) glioma cell CM generated in the absence or presence of IDH-C35. CM was diluted 1:1 with fresh media. Migrated cells were counted after 12 hours using a Countess TM automated cell counter. Results shown are representative of 2 independent experiments. P values were determined by 2-tailed, unpaired t test. 8
9 Supplementary Figure 9. Normalized expression levels of glioma stem cell-related genes in WHO grade III glioma-derived neurospheres. Expression levels of cancer stem cell-related genes in NCH612, NCH620, NCH551b, and NCH1681 cell lines based on microarray analyses. Data were normalized across all genes in each data set. Colored lines indicate the 50% percentile (considered as low or no expression) and the 90 and 95% percentile (highly expressed genes high expressed) probes (stated in the title). ILMN numbers adjacent to gene names indicate the unique probe evaluated for each gene. 9
10 Cxcl10 Expression (normalized to Gapdh) Relative to IDH-WT tumor tissue 10 8 ** MUT + IDH-C35 + VAC + VAC + IDH-C35 Supplementary Figure 10 Combination therapy of GL261-MUT tumor bearing mice with GAA vaccine and IDH-C35 enhances Cxcl10 expression. RT-PCR analysis of tumor tissue from day 21 treated GL261-MUT tumor-bearing mice. Mice were treated with mock vaccine and vehicle (MUT; n=2), mock vaccine and IDH-C35 (+IDH-C35; n=3), GAA vaccine and vehicle (+VAC; n=2), or GAA vaccine + IDH-C35 (VAC + IDH-C35; n=3). One way ANOVA analysis was performed with a Dunnett multiple correction test. **P<
11 Supplementary Figure 11. No difference in CD3 + CD8 - T-cells between GL261-WT and GL261-MUT mice between treatment groups. Flow cytometric analyses of tumor-infiltrating CD3 + CD8 - cells as a percentage of total CD45 + cells. Analyzed cells were gated on live lymphocytes. One way ANOVA with Dunnet s multiple correction test was performed. No significant differences were observed in any condition. ns=p>
12 Supplementary Figure 12. Methylation of STAT1 promoter CpG sites in IDH-WT and IDH-MUT TCGA cases. 450k Methylation data from LGG patients were downloaded from the TCGA (tcga-data.nci.nih.gov). Mean β values from TCGA IDH-WT (WT; n=58) and IDH-MUT (MUT; n=149) cases. Each bar represents the mean β values from a single CpG methylation site in the STAT1 promotor compared between IDH-WT and IDH-MUT cases. P values were determined by 2-tailed, paired t test. 12
13 Supplementary Figure 13. Mutation counts in in IDH-WT and IDH-MUT TCGA cases. Higher numbers of mutations in IDH-MUT TCGA cases compared with IDH-WT TCGA cases. Data were downloaded from the TCGA data portal (UCSC Automated Mutation Calling, Level 2, downloaded November 4, 2015) from which the number of mutations was counted per sample. Mutation counts were compared between IDH-WT and IDH-MUT cases. Each dot represents mutation counts from a single patient. Black bars and error bars represent mean values and standard deviations, respectively. P values were determined by 2-tailed, unpaired t test. 13
14 Supplementary Figure 14. STAT1 signaling and CXCL10 levels in 2HG-treated BV2 microglia cells. (i) Western blot was performed on protein lysates from BV2 microglia cells treated with 1 mm 2HG for 3 days with or without 10 ng/ml IFN-γ for 12 hours. STAT1, pstat1 and IRF1 levels were determined relative to β-actin by ImageJ software. (ii) CXCL10 protein expression levels in CM from IFN-γ-treated BV2 cells were assessed by Quantikine ELISA (P=0.0093). Results shown are representative of 2 independent experiments. P values were determined by 2-tailed, unpaired t test. 14
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Isocitrate dehydrogenase mutations suppress STAT1 and CD8 + T cell accumulation in gliomas
Isocitrate dehydrogenase mutations suppress STAT1 and CD8 + T cell accumulation in gliomas Gary Kohanbash, 1 Diego A. Carrera, 1 Shruti Shrivastav, 1 Brian J. Ahn, 2 Naznin Jahan, 1 Tali Mazor, 1 Zinal
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
Supplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
Supplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
SUPPLEMENTAL INFORMATIONS
1 SUPPLEMENTAL INFORMATIONS Figure S1 Cumulative ZIKV production by testis explants over a 9 day-culture period. Viral titer values presented in Figure 1B (viral release over a 3 day-culture period measured
Supplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
Supporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Supplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge
a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
SUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
Supporting Information
Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were
(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
Nature Immunology: doi: /ni eee Supplementary Figure 1
eee Supplementary Figure 1 Hyphae induce NET release, but yeast do not. (a) NET release by human peripheral neutrophils stimulated with a hgc1 yeast-locked C. albicans mutant (yeast) or pre-formed WT C.
Nature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
Nature Medicine: doi: /nm.3922
Title: Glucocorticoid-induced tumor necrosis factor receptor-related protein co-stimulation facilitates tumor regression by inducing IL-9-producing helper T cells Authors: Il-Kyu Kim, Byung-Seok Kim, Choong-Hyun
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Supplementary Figures
Supplementary Figures Supplementary Fig. 1. Galectin-3 is present within tumors. (A) mrna expression levels of Lgals3 (galectin-3) and Lgals8 (galectin-8) in the four classes of cell lines as determined
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
Supplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide
Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins
Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Dual Targeting Nanoparticle Stimulates the Immune
Dual Targeting Nanoparticle Stimulates the Immune System to Inhibit Tumor Growth Alyssa K. Kosmides, John-William Sidhom, Andrew Fraser, Catherine A. Bessell, Jonathan P. Schneck * Supplemental Figure
Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-
Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
a surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
Normal Skin. Tissue Samples and Melanoma Cell Lines. BRAF Mut. RAS Mut RAS WT /BRAF WT
Supplemental Figure 1. MERTK gene expression in melanoma cell line panel from Cancer Cell Line Encyclopedia. A. Microarray analysis of melanoma cell lines from UNC collection grouped by oncogenic mutation.
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
Supplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
Pathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
Transcription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey