Paediatric Neurogenetics. Prof Martin Delatycki Clinical Genetics Austin Health Bruce Lefroy Centre for Genetic Health Research, MCRI

Transcription

1 Paediatric Neurogenetics Prof Martin Delatycki Clinical Genetics Austin Health Bruce Lefroy Centre for Genetic Health Research, MCRI

2 What will be covered Dynamic mutations NF Tuberous sclerosis Prenatal diagnosis and preimplantation diagnosis Genetic disease searches

3 Genes- Nuclear and Mitochondrial Nuclear- most genes (~23,000) Mitochondrial- 37 genes- 13 encode proteins No introns 93% of mitochondrial genome is coding DNA (nuclear 2%) Mitochondrial DNA maternally inherited

4 Dynamic mutations

5 DYNAMIC MUTATIONS = a mutation which changes upon transmission Trinucleotide repeat disorders are the best example = three nucleotides which are present in increased number

6 TRINUCLEOTIDE REPEATS Normal Disease causing when expanded beyond a certain threshold Below that threshold they are stable both in mitosis and meiosis Beyond a certain number the repeat can be unstable in meiosis ± mitosis

7 DYNAMIC MUTATIONS REPEAT DISEASES INHERITANCE PARENTAL GENDER BIAS CGG/GCC FRAX A, E XL MATERNAL GAA FRIEDREICH ATAXIA AR MATERNAL CTG MYOTONIC DYSTROPHY, SCA8? AD CAG HD, DRPLA, SCA AD, XL 1,2,3,6,7, 17 (TBP), SBMA, 12 MER PROGRESSIVE AD MYOCLONUS EPILEPSY 5 MER SCA 10 AD MATERNAL PATERNAL CCTG DM2 AD

8 SITE OF TRINUCLEOTIDE REPEAT 5 3 ATG TAA CCG GAA CAG CTG FRAXA FRDA HD DM CAG SCA 12 SBMA SCA1,2,3,6,7?SCA8

9 DYNAMIC MUTATIONS INTERGENERATIONAL INSTABILITY ANTICIPATION PREMUTATIONS

10 INTERGENERATIONAL INSTABILITY REPEAT CHANGES IN SIZE FROM PARENT TO OFFSPRING SEX OF TRANSMITTING PARENT IMPORTANT SOME MORE UNSTABLE FROM FATHER, OTHERS FROM MOTHER

11 ANTICIPATION MORE SEVERE PHENOTYPE WITH SUCCESSIVE GENERATIONS BEST EXAMPLE IS MYOTONIC DYSTROPHY

12 MYOTONIC DYSTROPHY Worse with succeeding generations= anticipation Most severe= congenital myotonic dystrophy Very floppy, may need ventilator If survives, intellectual disability

13 ANTICIPATION Myotonic dystrophy

14 MYOTONIC DYSTROPHY CTG repeat <37- no problem >50- disease generally mild Congenital form often >1000 Congenital form almost always maternally inherited

15 PREMUTATIONS REPEAT SIZE WHICH IS UNSTABLE BUT DOES NOT RESULT IN A PHENOTYPE BEST EXAMPLE IS FRAGILE X SYNDROME

16 Fragile X syndrome

17 Fragile X syndrome

18 FRAGILE X SYNDROME CGG repeat <55- normal and no risk for offspring (45-54 grey zone) = premutation- normal intellect but risk to offspring of females >200- males have intellectual disability but intellect in females is variably affected

19 FRAGILE X PREMUTATION Not truly a premutation because female premutation carriers have a higher rate of premature ovarian failure shy personality Males and females with a premutation are at higher risk of late onset cerebellar tremor/ ataxia syndrome (FXTAS)

20 FRAXA Cerebellar Tremor/ Ataxia Syndrome Progressive action tremor, ataxia, cognitive decline 45% males, 17% females >50yrs

21

22 GENOTYPE- PHENOTYPE For most dynamic mutation disorders, the larger the repeat, the earlier the onset CANNOT use the repeat size to predict phenotype with accuracy eg: myotonic dystrophy prenatal Huntington disease predictive test NOT true for all dynamic mutations- eg: CCTG repeat in DM2

23

24 Friedreich Ataxia

25 Friedreich Ataxia Autosomal Recessive Commonest Hereditary Ataxia Prevalence 1: based on molecular data Carrier Frequency 1:85

26

27 Friedreich Ataxia Clinical Features» progressive ataxia of limbs» absent lower limb reflexes» reduction in vibration and proprioception» extensor plantar responses» scoliosis» foot deformity» cardiomyopathy» diabetes mellitus

28 Friedreich Ataxia 9q13 - q21.1 GAA triplet repeat in intron 1 of FXN gene 98% of affected alleles have an expansion of this trinucleotide repeat Normal 7-36 Affected Point mutations and deletions in FXN described

29 Intron 1 GAA n 5a

30 Friedreich Ataxia FXN produces frataxin Nuclear encoded, mitochondrial localisation

31 GAA Expansion 35 Number of alleles in range More GAA repeat number

32 Age of onset v GAA size smaller allele (R 2 =0.39) Age of onset GAA repeat size of smaller allele

33 P- value: complication v small allele size FEATURE Delatycki Dürr Filla Montermini Wheelchair <0.01 < Cardiomyopathy 0.11 <0.05 <0.05 NS Diabetes 0.08 NS <0.001 NS Scoliosis <

34 Iron in FRDA Knockout of the yeast frataxin homologue leads to mitochondrial iron accumulation Iron deposits found in the myocardium of FRDA patients

35 Iron levels in whole cells- FRDA v control (p=0.55) ng Fe/ cell x FRDA Control

36 Mitochondrial iron/protein (p=0.01) ug Fe/ ug protein x FRDA Control

37 Mitochondrial copper/protein (p=0.77) ug Cu/ ug protein x FRDA Control

38 Pathogenesis Frataxin involved in iron sulphur cluster synthesis Fe-S crucial in various protein including some respiratory chain proteins Deficiency leads to increased susceptibility to oxidative stress Increased Fe results in oxidative damage 2 to Fenton chemistry

39 FRDA Treatment - Iron chelation Must preferentially remove mitochondrial rather than cytosolic iron Desferioxamine not successful (Kaplan unpublished data) Deferiprone (L1) has shown promise (Boddaert, Cabantchik Blood, 2007) Reduced dentate nucleus Fe with six months treatment with mg/kg/day deferiprone? Improved neurological parameters- open label Des Richardson- mitochondrial specific chelators

40 Deferiprone trial Placebo controlled, 3 doses- 20, 40, 60 mg/kg International multi-centre- Europe, Australia, Canada Recruited 10 subjects here High dose group permanent stop 20 and 40mg/kg improved cardiac parameters, 40mg/kg worse neurology scales

41 FRDA Treatment - Anti-oxidants Treats down-stream effects Idebenone, mitoquinone, CoQ 10, vitamin E

42 Idebenone Late 90 s shown to reduce cardiac hypertrophy in some Buyse et al Neurology improved cardiac strain and strain rate Di Prospero et at Lancet Neurology 2007 Phase II placebo controlled multi dose Subjects < 18 years 12 subjects per arm- placebo, 5mg, 15mg, 45mg/kg/day Trend to dose dependent response as measured by ICARS Two phase III trials USA- 6/12 trial no benefit Europe- 12/12 trial- no benefit but close and 12% of placebo subjects took idebenone!

43 Idebenone trial

44 Upregulation of FXN In FRDA normal frataxin produced but at low levels An increase in frataxin production should ameliorate disease A few-fold increase in frataxin may stop disease progression

45 Upregulation of FXN Erythropoietin HDAC inhibitors Resveratrol

46 Dynamic Mutations-Practical Implications Diagnosis Predictive testing Therapeutic implications

47 PREDICTIVE TESTING Testing people at increased risk for a disease prior to the clinical onset of that disease Huntington disease= greatest experience Over 5000 predictive tests for HD done worldwide

48 PREDICTIVE TESTING Process 1) discussion of genetics 2) neurological examination 3) counselling regarding what a positive and negative result may mean for that person 4) result given 5) post-result counselling as required

49 PREDICTIVE TESTING- UPTAKE Prior to availability- 75% Reality- less than 20%

50 Predictive testing in minors Guidelines recommend against this Evidence is scarce

51 Neurofibromatosis Type 1

52 Neurofibromatosis Type 1- facts Incidence about 1:3000 Affects all ethnic groups

53 Neurofibromatosis Type 1- diagnostic criteria Require two or more of the following: 6 café au lait patches (>5mm prepubertal; >1.5cm postpubertal) 2 neurofibromas or 1 plexiform neurofibroma Axillary and/or inguinal freckling Optic glioma 2 Lisch nodules

54

55

56 Neurofibromatosis Type 1- diagnostic criteria (cont) Distinctive osseous lesion inc: sphenoid wing dysplasia, thinning of long bone cortex ± pseudoarthrosis A 1st degree relative with NF1 by the above criteria

57 Plexiform neurofibromas 30% Severe lesion of head or neck- 2% Majority of disfiguring plexiform neurofibromas evident by 2 years Variable natural history Can undergo malignant transformation

58

59 Plexiform Neurofibromas- Rx Surgery of limited value- regrowth Medical treatment- 2interferon cis-retinoic acid thalidomide farnesyl protein transferase inhibitor etoposide Problem of assessing efficacy

60 Neurofibromatosis Type 1- complications Learning difficulties- 50%. Mean full scale IQ (51-129): severe (IQ< 70)- 6% about 45% require special educational assistance UBOs ( T2 weighted MRI signal)-? association with learning difficulties Seizures- 4.4%

61 Neurofibromatosis Type 1- complications Symptomatic CNS tumours including optic nerve gliomas- 2% Subclinical optic nerve gliomas- 15% Peripheral nerve malignancy- 10%- often in a pre-existing plexiform Scoliosis: requiring surgery- 4.4% mild- 5.2%

62 Optic Nerve Gliomas Asymptomatic 15% Symptomatic 2% F:M= 2:1 Often regress Association with eyelid plexiform Treatment with carboplatin successful in some with symptomatic lesions

63 UBOs Hyperintense regions on T2 MRI images Present in about 2/3- cerebellum> brainstem> internal capsule Increase in size till about 10yrs then often disappear Benign? Should be added to diagnostic criteria

64

65 CNS Tumours 5x more common in NF1 than in general population but after 10 years 100x Apart from optic nerve gliomas CNS tumours are not very common (but increased compared to people without NF1) Include non-optic nerve gliomas meningiomas astrocytomas

66 CNS tumours Childhood astrocytomas tend to be low grade Adult astrocytomas often high grade

67 Spinal Cord Spinal neurofibromas Malignant peripheral nerve sheath tumour infiltrating the spinal canal Rare Children> Adults

68 Aqueduct Stenosis Increased incidence in NF1 tumour idiopathic Childhood or adult presentation Responds well to shunting

69 Malignant Peripheral Nerve Sheath Tumours (MPNST) Neurofibrosarcoma Lifetime risk about 10% Most arise in deep plexiform neurofibromas and fewer in superficial cutaneous plexiform neurofibromas Present with pain and rapid growth PET scanning useful for diagnosis Risk increased by radiotherapy Treatment- surgical

70 Neurofibromatosis Type 1- complications Hypertension- 6% Renal artery stenosis- 1.5% Phaeochromocytoma- 0.7% Disturbances of puberty- rare and when present usually associated with a CNS lesion Mortality- mean age at death 54 (males), 59 (females) cf: gen pop 70, 74

71 Timeline for Complications 0-2: Café au lait, plexiform neurofibromas 1-6: Symptomatic optic nerve glioma, skinfold freckling Preschool onwards: learning difficulties > 2: hypertension >6: neurofibromas, neurofibrosarcomas 6-16: scoliosis

72 Neurofibromatosis Type 1- genetics Autosomal dominant 30-50% are new mutations Due to mutations in a gene called NF1 Product= neurofibromin= tumour suppressor gene Huge gene! Numerous mutations Virtually 100% penetrant by 5 years

73 Neurofibromatosis Type 1- diagnosis Clinical Gene too big with too many mutations to be able to use mutation detection as a clinical tool

74 Neurofibromatosis Type 1- clinical evaluation The vast majority of children with multiple café au lait patches will go on to fulfil the diagnostic criteria for NF1 although a few families with dominant café au lait patches exist Disease severity CANNOT be predicted in a child. There is great intrafamilial variability including identical twins.

75 Neurofibromatosis Type 1- clinical evaluation Children- 12/12 review including:» learning evaluation formal psychometric assessment as necessary» neurological assessment» BP» scoliosis 12/12 ophthalmological review Routine neuroimaging not recommended (controversial)

76 Neurofibromatosis Type 1- genetic counselling Must examine parents to confirm diagnosis in child to provide risk assessments in future pregnancies to look for complications in them Prenatal diagnosis/pgd rarely requested

77 Prenatal Advice If child inherits NF1 mutation: 40% medical problems 50% learning problems, ID- 6% 4.5% problem in childhood resulting in lifelong morbidity Malignant CNS tumour 2.3%

78 Malignancies in NF1 Non nervous system GIST 6% Somatostatinoma? Phaeochromocytoma 1% Breast cancer 8.4% < 50 years (4x background) Rhabdomyosarcoma 0.5% (20x background) Nervous system Astrocytoma? MPNST 8-13% Neuroblastoma?

79 Tuberous Sclerosis

80 Tuberous Sclerosis = Bourneville disease 1:5000 of those < 5 years 1: of all ages

81 Diagnostic Criteria Major Features Facial angiomas of forehead plaques Nontraumatic ungual or periungual fibroma >3 hypomelanotic macules Shagreen patch Multiple retinal nodular hamartomas Cortical Tuber Subependymal nodule

82 Diagnostic Criteria Major features (cont) Subependymal giant cell astrocytoma Cardiac rhabdomyoma 1 Lymphangiomyomatosis Renal angiomyolipoma

83 Diagnostic Criteria Minor features Multiple pits in dental enamel Hamartomatous rectal polyps Bone cysts Cerebral white matter migration lines Gingival fibromas Nonrenal hamartomas Retinal achromic patch

84 Diagnostic Criteria Minor features (cont) Confetti skin lesions Multiple renal cysts

85 Diagnostic Criteria Definite TS 2 major OR 1 major + 2 minor Probable TS 1 major + 1 minor Possible TS 1 major OR 2 minor

86 TS- Adenoma Sebaceumsevere

87 TS- Adenoma Sebaceum- mild

88 TS- Hypomelanotic Macule

89 TS- Periungual Fibroma

90 TS- Shagreen Patch

91 TS- Forehead plaque

92 TS- MRI showing a tuber and subependymal nodules

93 TS- Hyperpigmented macule= café au lait

94 TS- Enamel pits

95 CNS 85% CNS complication Seizures Intellectual disability Behavioural problems Tumours

96 Seizures 75% Infantile spasms (20% will have TS) Myoclonic, partial, GTCS Presence in 1st 2yrs- association with MR- particularly infantile spasms Can be refractory to treatment

97 Development and Behaviour About 50% have intellectual disability- mild- severe 30% profound ID Behaviour- ADHD, autistic like, sleep problems

98 Tumours >75% have a brain abnormality inc: tubers subependymal glial nodules white matter radial migration Giant cell astrocytomas- highest risk is late childhood/ adolescence but can affect adults Usually cause hydrocephalus

99 Skin Depigmented patches may only be visible using a Woods lamp- UV light- present in nearly all Adenoma sebaceum= angiofibromata- butterfly distributionpresent in >75% Forehead plaque- 25% Shagreen patch- leathery - 60%

100 Ophthalmology Retinal phakoma- rarely affect vision mulberry lesions

101 CVS Cardiac rhabdomyomata Mostly asymptomatic Rarely to arrhythmia or CCF Tend to regress spontaneously

102 Renal complications Commonest cause of TS related death Angiomyolipomata Generally bilateral and multiple (~80% of adults with TS) Usually asymptomatic Increase in frequency and severity with age Can bleed

103 Renal complications Renal cysts (contiguous gene deletion TSC2 and PKD1) Renal cell carcinoma ~3%

104 Respiratory Lymphangiomyomatosis F>>M Poor prognosis

105 Genetics Autosomal dominant 2/3 sporadic, 1/3 inherited 2 genes TSC1-9q34 TSC2-16p13.3 Tumour suppressor genes

106

107 Gene % of Probands with Definite TSC and an Identifiable Mutation in This Gene Mutation Detection Frequency by Gene, Family History, and Test Method Familial Cases Simplex Cases TSC1 ~31% ~30% ~15% TSC2 ~69% 51% ~60%-70%

108 mtor inhibitors in TSC mtor = mammalian target of rapamycin mtor activated by mutations in TSC1 and 2 Sirolimus, mtor inhibitor, used for 12 months, resulted in a reduction in size of angiomyolipomas and improved PFTs in some with lymphangiomyomatosis Everolimus treatment reduced the size of subependymal giant cell astrocytomas and reduced seizure frequency Topical rapamycin shown to reduce size of facial angiofibromas

109 Genetics TSC1:TSC2= 1:1 in families TSC2:TSC1= 5:1 in sporadic cases?tsc2 more severe than TSC1 TSC1- hamartin TSC2- tuberin No homology between the two Appear to function in the same pathway

110 Genetics Mutations tend to cluster but the majority are family specific Not widely available US$2000 Mutation found in about 80%

111 Genetic Counselling Parent with TS- 50% risk to offspring If affected about 50% chance MR- therefore 25% risk MR 75% risk epilepsy

112 Genetic Counselling Apparent sporadic case MUST assess parents Skin examination including Woods lamp CT ± MRI brain Renal ultrasound Ophthalmology If normal, recurrence risk 2% (gonadal mosaicism)

113 Prenatal diagnosis Preimplantation diagnosis

114 Prenatal Options Traditional prenatal diagnosis Chorionic villus sampling Amniocentesis Preimplantation genetic diagnosis

115 Chorion Villous Sampling (CVS) Amniocentesis CVS from 11 weeks Amnio from 15 weeks Diagnosis Chromosome abnorm. DNA Studies Biochemical studies CVS Amnio CVS 1:100 miscarriage Amnio 1:200 miscarriage

116 Preimplantation Genetic Diagnosis- PGD In the context of IVF Testing by embryo biopsy Chromosomal abnormalities Selected single gene disorders Most common reason an objection to TOP or previous TOP following PND. No apparent increase in birth defects

117 PGD +

118 PGD - DNA extracted and mutation detection testing done

119 Method of embryo biopsy The hole in the zona allows entry of a micro pipette to aspirate 1 or 2 cells from the embryo. The cell can then be fixed to a slide, or placed in solution to allow genetic analysis.

120 PGD for single gene disorders Requested by couples wishing to avoid TOP 97% diagnostic accuracy 20% pregnancy rate per cycle Cystic fibrosis most common indication Counselling by both Genetics and IVF team

121 Next generation sequencing

122 Next Generation Sequencing (NGS) = Massively parallel sequencing (MPS) Whole exome sequencing = sequencing of all ~200,000 exons (~50x10 6 bp) Whole genome sequencing = sequencing of 3x10 9 bp of genome

123 Whole exome sequencing Most disease causing mutations are in the protein coding part of the genome (ie: exons) Cost ~ $1,000 but ~$3000 with interpretation ~40,000 variants per exome!

124

125 AATCCGATTTCGGCTAAGCCTAAGGCTGTTACGTACCCG AATCCGATTTTGGCTAAGCCTAAGGCTGTTACGTACCCG AATCCGATTTCGGCTAAGCCTAAGGGTGTTACGTACCCG AATCCGATTTCGGCTAAGCCTAAGGCTGTTACGTACCCG AATCCGATTTCGGCTAAGCCTAAGGCTGTTACGTACCCG AATCCAATTTCGGCTAAGCCTAAGGCTGTTACGTACCCG AATCCGATTTCGGCTAAGCCTAAGGCTGTTACGTACCCG AATCCGATTTCGGCTAAGCCTCAGGCTGTTACGTACCCG AATCCGATTTCGGCTAAGCCTAAGGCTGTTACGTACCCG AATCCGATTTCGGCTAAGCCTAAGGCTGTTACGTACCCG

126 NGS- uses Research- gene discovery Now possible to identify genes for rare diseases with few families or in one family with relatively few affected individuals New genes (and old genes causing new phenotypes) being identified daily

127 Clinical uses It is much cheaper to do whole exome or targeted gene sequencing and look at genes of interest than to sequence two or more genes Here gene panels developed- technology focusses on the genes of interest- targeted capture to get very high coverage of genes of interest eg: Charcot Marie Tooth, Leukodystrophy, HSP, muscular dystrophy ~$1000 cf TS-$2000 for 2 genes!

128

129 Typical whole exome dataset Statistics summary ASD Total reads 27,617,622 52,616,952 Total yield (bp) 3,037,938,420 5,787,864,720 Average read length (bp) Mappable reads (=reads mapped to human genome) 22,786,188 47,217,845 Mappable yield (bp) 2,362,112,810 4,936,651,971 % Mappable reads (out of total reads) 82.50% 89.70% On-target reads (=reads mapped to target regions) 18,178,648 35,664,336 On-target yield (bp) 1,536,584,594 3,004,107,432 % On-target reads (out of mappable reads) 79.80% 75.50% % On-target reads (out of total reads) 65.80% 67.80% Target regions (bp) 62,085,286 62,085,286 % Coverage of target regions (more than 1X) 88.20% 93.20% % Coverage of target regions (more than 10X) 66.70% 82.10% Median read depth of target regions 20.0X 44.0X

130 Whole genome sequence 1 st human genome sequence- 13 years, $2.7 billion Now ~$5K (aim is for $1K)- this is for the test- more $$$ for interpretation 98% more data than whole exome sequence Much more variation

131 NGS- challenges Generates huge volumes of data- whole exome ~40,000 variants identified per study- separate wheat from chaff Bioinformaticians are the most important people in genetics! Not as accurate as Sanger sequencing so generally need to confirm findings but this is changing Not all exons captured with current technology- very important issue- can make this technology inappropriate for some genes/conditions

132 Variants of unknown significance = VOUS = unclassified variants Some alterations clearly pathogenic Some alteration clearly benign polymorphisms Often can t tell which is the case Already a major issue in genetic testing With NGS being used, this will increase exponentially

133 Variants of unknown significance Generally missense mutations (changes one amino acid for another) Various programs can assist with defining pathogenicity Based on conservation of the amino acid across species Is the amino acid changed from one type to a very different or similar type? Eg: large basic to small acidic v large basic to large basic Common in population = likely to be polymorphism Functional studies- can take years!

134 Problems of VOUS 8 year old child Parents concerned with various symptoms Possibility of connective tissue disorder mentioned Parents went to internet At parent s request, paediatrician ordered FBN1 and COL3A1 mutation detection

135 Reports FBN1- probable pathogenic mutation identified BUT no signs Marfan syndrome! Probable polymorphismtest parents (who have no signs Marfan syndrome)- if one has it, can be confident it is not pathogenic COL3A1- silent mutation (base substitution but no change in amino acid sequence)- extremely unlikely to be pathogenic (child has no signs of EDS III)- parents still concerned- want to have testing to be sure it is inherited

136 Extrapolate to WES and WGS 1000s of alterations We will quickly become better at knowing what is pathogenic and what is not but there will always be unknowns This case has taken 4 hours of clinical geneticist time already Who will counsel individuals/families? Charge per alterations discussed??!!

137 NEJM October people with ID where cause not known (microarray, frax), IQ<50, healthy parents Whole exome sequencing 765 others with ID used to assess new genes

138 79 de novo alterations in 53 patients 10 autosomal mutations and 3 X-linked inherited mutations in males previously described as pathogenic Potentially causative de novo mutations in 22 others These genes sequenced in 765 others with ID Mutations in 3 new ID genes identified in others with similar phenotype No autosomal recessive mutations found

139 Overall, 16% received a diagnosis 19 unclassified variants Shows that most undiagnosed genetic ID is new dominant mutations Surprising how little is recessive This will enter clinical practice Will potentially diagnose as many causes of ID as microarray Whole genome sequencing will likely eventually replace whole exome AND microarray

140 Whole genome sequencing Mercy Children s Hospital Kansas- whole genome sequencing and preliminary report in 50 hours from receipt of sample for neonates (Stat-seq)- $13,500 Not in clinical use yet in Australia but will be soon no doubt

141 Non-invasive prenatal diagnosis Detects foetal DNA in maternal blood Utilises NGS Currently fairly limited in how many things can be tested (trisomy 13, 18,21, sex chromosome disorders) but will increase rapidly Likely will be able to do whole exome/genome in the relatively near future Will CVS/amnio become obsolete?

142 Ethical issues NGS can reveal things that were not being sought Incest Mutations in other genes- eg: BRCA What to do when such information is identified?

143 Ethical guidelines Generally say if the variant leads to preventable disease risk (eg: BRCA), the person should be told If the variant leads to disease that is not treatable/preventable and the disease is unrelated to the purpose of the test (eg: Huntington disease mutation in a person being tested for cause of ID) then they should not be told BUT what if preventions become available? What if families would want to use the information for avoiding future children having those mutations?

144 Ethical issues Can people consent for the level of information they want? Just severe disorders (eg: always causes ID) Risk findings (eg: this finding gives a 15% risk ASD) Everything (eg: your son s likely IQ will be 93, brown hair, 175cm, poor sporting prowess)

145 Online genetics resources OMIM Genereviews

146 Online Mendelian Inheritance in Man OMIM Lists practically every Mendelian condition and every gene associated with a phenotype Lists some mutations Cross referenced to Pubmed and gene databases for those interested in in-depth information about genes and mutations underlying the various conditions

147 Autosomal X- Linked Y- Linked Mitochondrial Total * Gene with known sequence Gene with known sequence and phenotype # Phenotype description, molecular basis known % Mendelian phenotype or locus , molecular basis unknown Other, mainly phenotypes with suspected mendelian basis Total

148

149

150

151

152

153

154

155 Thank you!