TRPA1 channels regulate astrocyte resting calcium. and inhibitory synapse efficacy through GAT-3

Transcription

1 TRPA1 channels regulate astrocyte resting calcium and inhibitory synapse efficacy through GAT-3 * 1 Eiji Shigetomi, * 1 Xiaoping Tong 3 Kelvin Y. Kwan, 3 David P. Corey & 1,2 Baljit S. Khakh Ψ 1 Departments of Physiology and 2 Neurobiology, David Geffen School of Medicine, University of California Los Angeles, Los Angeles USA CA Howard Hughes Medical Institute, Harvard Medical School, Neurobiology, Goldenson 444, 220 Longwood Ave, Boston, MA *authors with equal contributions to experiments (ES and XT) SUPPLEMENTARY INFORMATION LIST Legends for Supplementary videos Page 2 Supplementary figures and legends Pages 3 23 Supplementary Tables Pages

2 Legends for Supplementary Videos Supplementary Video 1: Spotty Ca 2+ signals in a representative astrocyte in co-cultures. Frame interval = 1 s, duration of movie = 300 s. Representative from 696 sites of 54 cells. Supplementary Video 2: Spotty Ca 2+ signals are abolished upon application of Ca 2+ free buffers in astrocytes in co-cultures. Frame interval = 1 s, duration of movie = 1800 s. Representative from 155 sites of 14 cells. Supplementary Video 3: HC , a specific blocker of TRPA1 channels, largely reduces spotty Ca 2+ signals in astrocytes in co-cultures. Frame interval = 1 s, duration of movie = 1800 s. Representative from 96 sites of 11 cells. HC almost completely reduced the spotty Ca 2+ signals. Supplementary Video 4: Spotty Ca 2+ signals are preserved in astrocytes in co-cultures transfected with control sirna. Frame interval = 1 s, duration of movie = 360 s. Representative of 55 cells. ATP (30 µm) was applied at 300 s for 2 s (as indicated by the text). Supplementary Video 5: Spotty Ca 2+ signals are reduced in astrocytes in co-cultures transfected with TRPA1 sirna. Frame interval = 1 s, duration of movie = 360 s. Representative of 8 cells. ATP (30 µm) was applied at 300 s for 2 s (as indicated by the appearance of the callout text). Supplementary Video 6: A low concentration of AITC increased astrocyte spotty Ca 2+ signals in co-cultures. Frame interval = 1 s, duration of movie = 360 s. AITC (1 µm) was applied at 120 s for 120 s (as indicated by the text). Representative of 21 cells. Supplementary Video 7: Spotty Ca 2+ signals in control astrocytes in co-cultures. Frame interval = 1 s, duration of movie = 300 s. Representative of 13 cells. These data were gathered at the same time as for experiments where mtrpa1 was expressed in astrocytes (see Supplementary movie 8). Supplementary Video 8: Over expression of mtrpa1 channels increased spotty Ca 2+ signals in astrocytes in co-cultures. Frame interval = 1 s, duration of movie = 300 s. Note that astrocytes over expressing mtrpa1 show more spotty Ca 2+ signals. Representative of 12 cells. 2

3 Supplementary Figure 1: Dual emission imaging with Lck-GCaMP3 and cytosolic Fura Red in co-cultures. a. Representative images from co-cultures showing basal fluorescence of Lck-GCaMP3 and Fura Red captured simultaneously with a beam splitter. b. Representative traces show simultaneous recordings from a region of interest for the Lck-GCaMP3 signal (green) and the Fura Red signal (red). Note that spotty Ca 2+ signals can be easily seen in the Lck-GCaMP3 trace, but these are harder to see in the Fura Red trace. However, elevation of global Ca 2+ levels by ATP results in robust signals for the Lck-GCaMP3 and Fura Red traces. c. Plots the peak amplitude of the df/f for 363 spotty Ca 2+ signals (x-axis) against the Fura Red signal (y-axis) for the same regions of interest. The solid line represent the line of identity: all points should fall near this line if spotty Ca 2+ signals measured by Lck-GCaMP3 also resulted in significant elevations in cytosolic Ca 2+ signals. Importantly, the dynamic range for Lck-GCaMP3 was large, whereas that for Fura Red it was small. Also, very few points were near the line of identity and there was little correlation between the two signals. d. Summary bar graph showing the peak df/f for the spotty Ca 2+ signals measured by Lck-GCaMP3 in relation to the signals measured by Fura Red when transients were observed in both channels with a beam splitter. From the data it is clear that spotty Ca 2+ signals do not largely elevate Ca 2+ in the cytosol of astrocytes, but that for ~46% of events the signals can be detected with a cytosolic dye with a largely reduced signal-to-noise. Overall, we conclude that spotty Ca 2+ signals are easily detected by membrane tethered Lck- GCaMP3, but that the Ca 2+ quickly dissipates and is unreliably and poorly detected by cytosolic dyes. These data show Ca 2+ entry during spotty Ca 2+ signals does elevate bulk cytosolic levels, but the signal dissipates. 3

4 Supplementary Figure 2: Properties of spotty Ca 2+ signals studied with TIRF microscopy and Fluo-4 in co-cultures. a. Spotty Ca 2+ signals disappeared, but ATP-induced Ca 2+ signals were maintained in the absence of extracellular Ca 2+. b. Depletion of intracellular Ca 2+ stores by thapsigargin (TG, 1 µm) completely abolished ATP-induced Ca 2+ signals. However, spotty Ca 2+ signals still exist in the presence of TG. c. Shows a plot of blockade (%) of spotty Ca 2+ signals versus blockade 4

5 (%) of ATP-induced Ca 2+ signals. Red circles indicate the drugs that mainly reduced spotty Ca 2+ signals, suggesting TRP-like channels mediated spotty Ca 2+ signals. Green circles indicate drugs that mainly reduced ATP-evoked Ca 2+ signals. Grey circles indicate drugs affect both or none of signals. d. df/f images of astrocyte footprints observed in TIRF for cells loaded with Fluo-4. Bottom panels show 3D rendering of images above. e. Intensity versus time profile of four ROIs. HC dramatically decreased spotty Ca 2+ signals (n = 22 sites from 11 cells). f. Shows fluorescence images of mcherry (left panels) and df/f images of spotty Ca 2+ signals. We transfected sirnas with mcherry as a reporter. The numbers in the images correspond to the time when images were taken (in seconds). g. Shows summary data for the percentage of astrocytes showing spotty Ca 2+ signals observed in TIRF. TRPA1 sirnas significantly reduced the number of cells showing spotty Ca 2+ signals (Fisher s exact test, Control, 77.8%, n = 27 cells; TRPA1 #1, 5.6%, n = 18 cells, p < ; TRPA1 #2, 40.8%, n = 27 cells, p < 0.01; TRPA1 #3, 17.4%, n = 13 cells, p < ). h. Number of spotty Ca 2+ signals in astrocyte were significantly decreased by TRPA1 sirnas (negative control sirna, 3.7 ± 0.6 events per cell; TRPA1 sirna #1, 0.06 ± 0.06 events per cell, p < ; TRPA1 sirna #2, 0.74 ± 0.25 events per cell, p < ; TRPA1 sirna #3, 0.22 ± 0.11 events per cell, p < ). Note: in panel c a value of less than 0% inhibition represents an increase, as was subtly observed in the case of BBG, U73122 and ryanodine. 5

6 Supplementary Figure 3: Overexpression of mtrpa1 in co-cultures and HEK 293 cells increased spotty Ca 2+ signals measured by Lck-GCaMP3. a. Representative df/f images of a maximal projection of 300 frame video of astrocytes in cocultures expressing Lck-GCaMP3 with or without co-transfection of mtrpa1 (Supplementary Video 7, 8). Dashed lines show the outline of the imaged astrocytes. b. Cumulative probability plot of the number of spotty Ca 2+ signals within each cell. Astrocyte co-cultures over expressing mtrpa1 channels (gray line, n = 12 cells) showed significantly more spotty Ca 2+ signals than control (black line, n = 13 cells, Kolmogorov-Smirnov test, p < ). The number of spotty Ca 2+ signals increased from 3.4 ± 2.5 locations per astrocytes to 16.4 ± 4.2 locations in astrocytes expressing TRPA1 channels. c. The panels show df/f images of HEK 293 cells expressing Lck- GCaMP3 and mtrpa1. d. Traces show the intensity versus time profile of Lck-GCaMP3 signals. HEK-293 cells did not express functional TRPA1 channels natively since AITC (10 µm) did not cause detectable Ca 2+ transients. e. Expression of mtrpa1 caused spontaneous spotty 6

7 Ca 2+ signals in 41.7% of HEK cells (n = 36 cells in total), whereas only 5.9% of HEK-293 cells (n = 34 cells in total) expressing solely Lck-GCaMP3 showed spontaneous signals. These data further suggest that TRPA1 channels are sufficient to cause spontaneous spotty Ca 2+ signals. AITC (10 µm) evoked strong Ca 2+ signals in HEK-293 cells expressing mtrpa1. 7

8 Supplementary Figure 4: TRPA1 sirnas do not affect ATP-evoked global Ca 2+ signals in astrocyte co-cultures. a. ATP (30 µm)-evoked Ca 2+ transients in astrocytes observed by Fluo-4 with epifluorescence microscopy under the conditions indicated. b. Average data for experiments such as those shown in panel a. Negative control sirna, 6.9 ± 0.4 (n = 17 cells); sirna#1, 6.4 ± 0.5 (n = 7 cells); sirna#2, 6.6 ± 0.3 (n = 12 cells); sirna#3, 6.2 ± 0.3 (n = 10 cells). 8

9 Supplementary Figure 5: Evidence for TRPA1 expression in astrocyte co-cultures. a. AITC (100 µm)-evoked currents in astrocytes and HEK-293 cells expressing mtrpa1. We used 100 µm AITC to maximally activate TRPA1 because the currents were relatively small in astrocytes (see text for data). Voltage-ramps were applied from -80 mv to 60 mv every 2 s (in 280 ms) and from -80 mv to +50 mv every 0.5 s for astrocytes and HEK-293 cells before, during after applications of AITC. AITC was applied for 60 s. Currents were normalized to the currents at -80 mv. Both currents showed similar outward rectification which is typical for TRPA1 currents. The bar graph shows summary data of the effect of sirna on mtrpa1 currents in HEK-293 cells at -60 mv. sirna significantly decreased TRPA1 currents (p < 0.05). b. Current-voltage relationships for AITC (100 µm)-evoked currents in astrocyte co-cultures transfected with negative control sirna (black trace) or TRPA1 sirna #1 (gray trace). The bar graph on the right shows summary data of AITC-evoked currents, which were reduced significantly by TRPA1 sirna (p < 0.05). c. As in b, but for IV plots for astrocytes without any agonist applications to monitor the potassium currents. The TRPA1 sirna did not significantly affect the potassium currents at any voltage, as shown by the bar graph. d. A 130 kd band was detected in HEK-293 cells expressing rtrpa1 channels, but not in untransfected cells. The 9

10 control β-actin band is also shown, which was natively expressed at much higher levels than TRPA1. e. Western blot analysis of TRPA1 expression relative to β-actin under the conditions indicated for astrocyte co-cultures: sirna#1 significantly reduced TRPA1 band intensity as shown in the bar graph. 10

11 Supplementary Figure 6: Spotty Ca 2+ signals measured with Lck-GCaMP3 in co-cultures are not due to neurotransmitter release. a. Representative traces of spotty Ca 2+ signals recorded from astrocytes in co-cultures. At the times indicated by the solid bars, TTX (1 µm; n = 122 sites from 6 cells), PPADS (40 µm; n = 86 sites from 5 cells), MCPG (500 µm; n = 110 sites from 8 cells) or CNQX and APV (10 and 50 µm; n = 103 sites from 4 cells) were applied. N = events. None of these agents had any detectable effect on spotty Ca 2+ signals. b. Summary data for experiments such as those shown in a. 11

12 12

13 Supplementary Figure 7: TRPA1 expression within astrocyte enriched cultures from hippocampus. a. The images show GFAP staining in relation to that for S100β, MAP2, Iba1 and DAPI, which are markers for astrocytes, neurons, microglia and cell nuclei, respectively. We detected very little evidence for the presence of neurons or microglia in these cultures, which were made using protocols that enrich for astrocytes. b. Pie charts summarize the finding that 99% of the cells showed costaining for GFAP and S100β, confirming that they were astrocytes. Evaluations of MAP2 and Iba1 staining showed that the cells were likely to be ~94% pure for astrocytes. c. Image of an astrocyte expressing Lck-GCaMP3 from astrocyte enriched cultures, shown next to a representative image of a spotty Ca 2+ signal from the same cell. The spotty Ca 2+ signal is shown as 2D and 3D representations. The graph shows average FWHM line profiles of spotty Ca 2+ signals measured from astrocyte enriched cultures. d. Left panel: representative traces for spotty Ca 2+ signals in astrocyte only cultures. Middle panel representative traces for AITC (20 µm; n = 13) evoked calcium signals (the black line is an average of the individual traces shown in gray). Right panel: representative traces showing that AITC-evoked Ca 2+ elevations can be blocked by HC (40 µm; n = 20). e. Representative Western blots showing TRPA1 and β-actin expression in co-cultures and enriched astrocyte cultures. Average data from 4 such experiments are shown in the bar graph with the intensity of the TRPA1 band being normalised to that of β-actin. We found approximately equal levels of TRPA1 in both cultures. 13

14 Supplementary Figure 8: Functional evidence for TRPA1 channels in hippocampal astrocytes but not neurons in co-cultures. a. Several TRPA1 agonists-induced global Ca 2+ transients in astrocytes, but not in neurons (measured by Fluo-4). The following agonist concentrations were used. AITC 20 µm (n = 62 astrocytes; n = 11 neurons), allicin 10 µm (n = 37 astrocytes; n = 12 neurons), N- methylmaleimide 50 µm (NMM, n = 22 astrocytes; n = 10 neurons), acrolein 20 µm (n = 27 astrocytes; n = 15 neurons), formaldehyde 0.01% (n = 36 astrocytes; n = 9 neurons), nicotine 1 mm (n = 26 astrocytes; n = 14 neurons), menthol 30 µm (n = 34 astrocytes; n = 11 neurons). b. Bar graphs summarize results from experiments such as those illustrated in a. c. A representative image of a field of view of neuron-astrocyte co-cultures. In this field of view 5 cells were analyzed (labeled as 1-6): the neurons are identified by the arrows. The traces to the right show AITC-evoked calcium elevations (measured with Fluo-4; 20 µm) in the astrocytes. Similar responses were not recorded in the neurons. For these experiments, neurons were identified by their compact somata and dendrites, whereas astrocytes were identified as flat cells with no dendrites. These features were readily visible in the Fluo-4 and bright field images and the distinction was based on 12 years of experience with hippocampal co-cultures by the Khakh lab and is based on extensive past work using imaging and electrophysiology on co-cultures. In short, we are confident we can discriminate a neuron from an astrocyte. 14

15 Supplementary Figure 9: Representative images of astrocytes in the stratum radiatum region of the hippocampus bulk loaded with Fluo-4. The arrows point to astrocytes. 15

16 Supplementary Figure 10: Properties of interneuron mipscs when astrocytes were dialyzed with BAPTA. a. Normalized interneuron mipsc amplitudes in 5 minute bins from time 0 to 35 minutes after attaining the whole-cell mode in astrocytes and thus beginning intracellular dialysis with BAPTA. In this approach, we recorded from a neuron, established a set of baseline values for mipsc amplitude and frequency and then patch an astrocyte with BAPTA. The mipscs were significantly reduced in amplitude after 20 minutes of BAPTA dialysis. Control experiments (where astrocytes were not patched/dialyzed), showed no decrease in mipsc amplitudes over time. Related control experiments when astrocytes were dialyzed with BAPTA at different levels of Ca 2+ buffering are reported in the main text, demonstrating that the act of dialyzing itself does not affect mipscs. The right hand panels show representative mipscs from a single cell at the 16

17 time points indicated. b. Representative mipscs (gray) and averages (black and green) at the time points indicated after start of astrocyte dialysis with BAPTA. The bar graphs show that the rise and decay times of mipscs were not altered with astrocyte BAPTA dialysis. c. The graph plots the control amplitude of mipscs (green symbols) on the x-axis from the 0-5 min period against the amplitude of mipscs recorded min after astrocyte BAPTA dialysis. The thick black line represents the expected relationship between the two distributions if the mipscs after BAPTA dialysis scaled proportionally with those before. The dashed line represents one expected result if the mipscs after astrocyte BAPTA dialysis were scaled across all synapses in a subtractive manner. The red line represents the expected result if the mipscs scaled in a multiplicative manner by a factor of across all synapses, which closely represents the observed data. d. The right hand graph shows cumulative probability plots for mipsc amplitudes under control conditions and after astrocyte dialysis with BAPTA. The right hand graph shows the same data, but after mipscs recorded following astrocyte BAPTA dialysis were scaled by a factor of Note this scaling factor was sufficient to render the two distributions identical. These data suggest that astrocyte BAPTA dialysis scales all synapses equally by ~ 0.73, as discussed in the text for 6/8 interneurons. 17

18 Supplementary Figure 11: Dialysis of interneurons with BAPTA did not affect mipscs, but dialysis of astrocytes did so. a. Representative traces of mipscs recorded from interneurons using a standard intracellular solution as well as from interneurons recorded with 13 mm BAPTA in the patch-pipette. b. Cumulative probability mipsc amplitude and inter-event interval distributions for interneurons with a standard control intracellular solution and for interneurons dialyzed with 13 mm BAPTA. 18

19 c. Representative mipsc traces for interneurons located near astrocytes dialyzed with intracellular solutions to clamp the bulk concentration of Ca 2+ ions to known levels using either the fast chelator BAPTA, or the slower chelator EGTA. d-f. Shows average cumulative probability plots for experiments like those illustrated in c. No significant changes were observed for the inter-event interval distributions under any conditions. g. Summary bar graph showing the effect of astrocyte dialysis with BAPTA (to achieve the indicated calculated intracellular Ca 2+ concentrations) in mipsc amplitudes and frequency (see text for details). In brief, the mipsc amplitudes alone were decreased significantly (p < 0.01) when astrocyte Ca 2+ levels were decreased below rest to ~35 nm. 19

20 Supplementary Figure 12: The TRPA1 channel blocker HC did not affect the membrane properties of CA1 region pyramidal neurons or interneurons. Panels a-b show representative traces before and during application of 40 µm HC for recordings from interneurons and pyramidal neurons. The table presents average data for key parameters for control conditions and during the application of key drugs used in the course of the experiments reported in this study. None of them produced any significant effect on the membrane properties of interneurons or pyramidal neurons. 20

21 Supplementary Figure 13: Controls for experiments showing that astrocyte dialysis with BAPTA occludes the effect of HC on interneuron mipscs and also the effect of astrocyte BAPTA dialysis on evoked IPSCs. a. Representative traces of mipscs arriving onto interneurons for control conditions and after min astrocyte dialysis with BAPTA (13 mm). b. Average cumulative probability plots showing mipsc amplitudes and inter-event intervals for the experimental conditions shown in a: note the significant reduction in mipsc amplitudes. These experiments were performed in parallel with those reported in Fig 5e and are the control data set for those experiments. c. The graph shows stimulus response curves at a range of stimulation intensities for control interneurons (black symbols) as well as those located within ~100 µm of astrocytes dialyzed with 13 mm BAPTA (green). Representative traces are shown to the right. IPSCs were evoked using a glass stimulating electrode placed within 100 µm of the recorded interneuron with a pulse duration of 0.2 ms. 21

22 Supplementary Figure 14: GAT-1 and GAT-3 immunostaining in the stratum radiatum region of the hippocampus. a. The confocal images show GAT-1 and GFAP staining in the stratum radiatum. The spotty GAT-1 immunostaining did not colocalise with GFAP. b. As in a, but for GAT-3 immunostaining. In this case GAT-3 staining did colocalise with GFAP (white arrows). 22

23 Supplementary Fig 15: Elevating astrocyte calcium levels did not affect mipscs onto interneurons. a. The upper panel shows traces for AITC (100 µm) evoked calcium elevations in hippocampal astrocytes. The lower graph is an average cumulative probability plot of mipsc amplitudes before and during AITC. b. As in a, but for ADPβS (30 µm) applications. c. As in a but for ET-1 (100 nm) applications. d. Summary data for experiments such as those shown in panels a-c. Neither AITC, ADPβS or ET-1 changed the amplitude or frequency of mipscs arriving onto interneurons. 23

24 Supplementary Table 1: Effect of blockers on spotty Ca 2+ signals measured with TIRF microscopy. Drugs Conc. % block of microdomain Ca 2+ signal frequency (%) % of block of ATP responses (%) 0 Ca 2+ EGTA 5mM 98.7 ± 1.3 (22) 17.9 ± 2.1 (44) Target proteins BAPTA-AM 100 µm ND (9 FOV) 98.3 ± 0.5 (22) Ca 2+ chelator Gd µm 100 ± 0 (30) 42.7 ± 5.6 (37) TRPs, SOCC, Orai1 La µm 96.6 ± 3.4 (17) ± 5.2 (27) TRPs, SOCC HC µm 99.2 ± 0.8 (22) 0.4 ± 1.9 (21) TPRA1 2-aminoethoxy diphenylborate (2-APB) 100 µm -3.0 ± 16.5 (16) 95.3 ± 0.6 (19) TRPCs, TRPMs, Orai1 Ruthenium Red 10 µm -5.0 ± 2.0 (20) 49.1 ± 4.4 (26) TRPVs, TRPA1 SKF µm 33.1 ± 26.7 (19) 55.0 ± 5.7 (29) TPRCs, SOCCs, Orai1 MRS µm 53.3 ± 17.3 (11) 43.7 ± 4.7 (33) TRPCs, SOCCs Flufenamic acid (FFA) 100 µm 54.7 ± 12.2 (15) 36.7 ± 22.4 (44) TRPCs, TRPMs, SOCCs Menthol 500 µm 81.9 ± 4.2 (30) 7.2 ± 6.4 (30) TRPA1 Streptomycin 200 µm 58.7 ± 14.8 (27) 4.2 ± 1.3 (42) Mechnosensitive cation channels 10 mm Mg ± 14.2 (16) 7.7 ± 2.4 (34) Mechnosensitive cation channels Cyclopiazonic acid (CPA) 20 µm 42.7 ± 11.6 (17) 95.3 ± 1.4 (37) SERCA pump Thapsigargin (TG) 1 µm 27.5 ± 16.9 (14) 95.8 ± 0.8 (34) SERCA pump Xestospondin C (XeC) 20 µm 10.8 ± 19.3 (29) 81.2 ± 5.1 (16) IP 3 receptors U µm ± 16.6 (13) 97.1 ± 0.5 (40) Phospholipase C Ryanodine 100 µm 22.6 ± 14.1 (16) -8.0 ± 5.8 (28) Ryanodine receptors PPADS 40 µm 17.8 ± 13.0 (21) 95.5 ± 1.2 (28) P2Y receptors Cd µm 34.6 ± 32.7 (12) 60.9 ± 4.5 (43) Voltage-gated Ca 2+ channels Brilliant Blue G (BBG) 10 µm -30 ± 31.4 (5) 13.5 ± 3.9 (27) P2X 7 receptor 24

25 Supplementary Table 2: Sequences of sirnas. sirna Sense Antisense Negative control sirna TRPA1 sirna #1 UAACGACGCGACGACGUAAtt ACACGUGGACAUCAAAGCUGUGUUC UUACGUCGUCGCGUCGUUAtt GAACACAGCUUUGAUGUCCACGUGU TRPA1 sirna #2 AACUCAGGCCGCAAAUUCCUUAGCC GGCUAAGGAAUUUGCGGCCUGAGUU TRPA1 sirna #3 UUAGUGUCAAGAAUGACCUUCAUGG CCAUGAAGGUCAUUCUUGACACUAA The negative control sirna did not target any gene product. 25

26 Supplementary Table 3: A TRPA1 agonist (AITC; 100 µm) and antagonist (HC ; 80 µm) did not affect the membrane properties of pyramidal neurons in hippocampal slices. Control + AITC (100 µm) Control + HC (80 µm) Vm (mv) ± ± ± ± 0.6 Rm (MΩ) 225 ± ± ± ± 9 AP height (mv) 98 ± ± ± ± 1.6 AP T 0.5 (ms) 1.7 ± ± ± ± 0.1 n