Supplementary information
|
|
|
- Derrick Rodgers
- 5 years ago
- Views:
Transcription
1 Supplementary information Hepatitis B virus genotype, mutations, human leukocyte antigen polymorphisms and their interactions in hepatocellular carcinoma: a multi-centre case-control study Juan Wen, Ci Song, Deke Jiang, Tianbo Jin, Juncheng Dai, Liguo Zhu, Jiaze An, Yao Liu, Shijie Ma, Na Qin, Cheng Liang, Jiaping Chen, Yue Jiang, Linlin Yang, Jibin Liu, Li Liu, Tingting Geng, Chao Chen, ie Jiang, Jianguo Chen, Fengcai Zhu, Yefei Zhu, Long Yu, Hongbing Shen, Xiangjun Zhai, Jianfeng Xu, Zhibin Hu 1
2 Supplementary Figure Supplementary Figure 1. The nested multiplex PCR specifically detects d the HBV genotypes and subgenotypes from alll the subjects, includingg the HCC patients andd the HBV persistent carriers. Each lane correspondss to a subject. P1: Lanee 1: genotype B; lanes 2-6: 2 genotype C; lanes 7-10: genotype BC (coinfection); lane 11: genotype D. The sizes of the amplicons a for the HBV genotypes are: genotype B: 331 bp; genotype C: 242 bp; genotype D: 189 bp. P2: Lanes 1, 7-10: subgenotype B2. P3: lanes 2, 7: subgenotypes e C1; lanes 3, 8: subgenotype C2; lanes 6, 10: subgenotype C1C2 (coinfection);; lanes 4, 5, 9: subgenotypes C3, C4 C and C3, respectively, which were detected by sequencing and alignment for the corresponding subgenotyps pe of genotype C that was not detected. The sizes of the ampliconss for the subgenotypes are: subgenotype B2: 278 bp; subgenotype C1: 554 bp; subgenotype C2: 652 bp. 2
3 A. HBV B type-specific sequence B. HBV C type-specific sequence C. HBV D type-specific sequence 3
4 D. HBV B2 type-specific sequence E. HBV C1 type-specific sequence 4
5 F. HBV C2 type-specific sequence 5
6 G. HBV C3 type-specific sequence H. HBV C4 type-specific sequence Supplementary Figure 2. HBV type-specific sequences includingg genotypes B and C and subgenotypes B2, C1, C2, C3 and C4. The sequences of subgenotypes C3 andd C4 were obtained by sequencing the amplicon of genotype C. 6
7 A. C1653T B. C1673T C. T1674C/G D. A1703G E. G1719T 7
8 F. A1726C G. T1727A/G H. C1730G I. A1752G J. T1753C 8
9 K. A1762T/G1764A L. C1799G M. A1846T N. G1896A O. G1899A 9
10 P. G1915A/C Q. C1969T R. A1979G Supplementary Figure 3. The sequences off the HBV hotspot mutations in thee EnhII/BCP/PC region including wild type and the mutation( (s) of C1653T, C1673T, T1674C/G, A1703G, G1719T, A1726C, T1727A/G, C1730G, A1752G, T1753C, A1762T, G1764A, G1799C, A1846T, G1896A, G1899A, G1915A/C, C1969T and A1979G. 10
11 Supplementary table Supplementary Table S1. Information of primers and probes Type Primers or probes (5'-3') Position Nested PCR primers P1-S TTTGCGGGTCACCATATTCTTGG P1-AS CGAACCACTGAACAAATGGCACTAG P2-S CCTACTGTTCAAGCCTCCAAGC P2-AS GACCAACCTCCCATGCTGTAG P3-S CCGGAAAGCTTGAGCTCTTCTTTTTCACCTCTGC CTAATCA P3-AS CCGGAAAGCTTGAGCTCTTCAAAAAGTTGCATG GTGCTGG HBV Genotype primers A-S GGCTCCAGTTCAGGAACAGT A-AS CTCGCGGAGATTGACGAGATGT B-S CCAAACTCTTCAAGATCCCAGAGTCA B-AS ACAGGTTGGTGAGTGACTGGAGATTT C-S CTCCCATCTCTCCACCTCTAAGAGACAGT C-AS CAGGGGTCCTAGGAATCCTGATGTTG D-S CAGACGCCAACAAGGTAGGAGCT D-AS GAGTGTCTCTCAAAGGTGGAGACAGA E-S ATACCCTATGGAAGGCGGGCATCT E-AS CCCATTCGAGAGGGACCGTCCA F-S TATCTGTGGGTATCCATTTGAATACCTC F-AS CGAGCGAAACAGGCTGCAAG HBV Subgenotype primers B1-S CCTTCTGACTTCTTTCCGTCGG B1-AS CCTGATCTTTAGGCCCATGTTAGTG B2-S GGGCTTTATTCTTCTACGGTACCTTG B2-AS TTCCAAAGAGTGTGTAAATAATGTCTC C1-S CATTGTTCACCTCACCATACAGCACTA C1-AS CATATTGTTGACATCTGTTGATAATATCCTCTTT C2-S ATACTCTGTGGAAGGCTGGCATTC C2-AS GGGGTCCTAGGAATCCTGATGTTG Primers of enhancer II (EhnII), basic core promoter (BCP), precore regions BCP-1S TGCACTTCGCTTCACCTCTG BCP-1AS TAAGCGGGAGGAGTGCGAAT BCP-2S GCATGGAAACCACCGTGAAC BCP-2AS ATACAGAGCAGAGGCGGTAT Size (bp) of product Primers and probes for TaqMan allelic discrimination rs s CAATTGTTTTTATAAGTTTCCTCTGCTTC 11
12 rs as AGTCCTGTATGCTGATATCCAGTCAC rs p-a FAM-TGATTGTGAGAGACC-MGB rs p-g HEX-TGATTGTGAGAGGCC-MGB rs s GACAGTGCAGCCTTCAGTCTGT rs as GCGGTCTTCCACCCTTCAT rs p-c FAM-TTGAAGGTCCCAGAGC-MGB rs p-t HEX-TGAAGGTCTCAGAGCC-MGB Abbreviation: S, sense; AS, antisense. 12
13 Supplementary Table S2. Distribution of selected demographic variables in HCC and HBV persistent carriers Variable HCC patients HBV persistent carriers Nanjing Nantong Qidong Zhangjiagang Taixing Danyang (n = 535) (n = 522) (n = 450) (n = 510) (n = 500) (n = 550) N (%) N (%) N (%) N (%) N (%) N (%) All HCC patients (n = 1507) N (%) All HBV persistent carriers (n = 1560) N (%) P a Age 50.5± ± ± ± ± ± ± ± Gender Male 454 (84.9) 409 (78.4) 358 (79.6) 409 (80.2) 398 (79.6) 448 (81.5) 1221 (81.0) 1255 (80.4) Female 81 (15.1) 113 (21.6) 92 (20.4) 101 (19.8) 102 (20.4) 102 (18.5) 286 (19.0) 305 (19.6) a All HCC patients vs. All HBV persistent carriers
14 Supplementary Table S3. Distribution of selected demographic variables in the additional independent sample set from Xi an Variable HCC patients (n = 107) N (%) HBV persistent carriers (n = 204) N (%) Age 51.3± ± Gender Male 85 (79.4) 164 (80.4) Female 22 (20.6) 40 (19.6) P
15 Supplementary Table S4. Distribution of HBV genotypes and subgenotypes in HCC and HBV persistent carriers from the central and southern Jiangsu Province HCC patients HBV persistent carriers Variable Nanjing Nantong Qidong Zhangjiagang Taixing Danyang (n = 535) (n = 522) (n = 450) (n = 510) (n = 500) (n = 550) N (%) N (%) N (%) N (%) N (%) N (%) No. of HBV typed 520 (97.2) 516 (98.9) 435 (96.7) 509 (99.8) 485 (97.0) 542 (98.5) Genotype C 359 (69.0) 428 (82.9) 399 (91.7) 191 (37.5) 210 (43.3) 128 (23.6) B 120 (23.1) 26 (5.0) 13 (3.0) 62 (12.2) 237 (48.9) 330 (60.9) BC 40 (7.7) 61 (11.8) 20 (4.6) 255 (50.1) 36 (7.4) 84 (15.5) D 1 (0.2) 1 (0.2) 3 (0.7) 1 (0.2) 2 (0.4) 0 (0.0) Subgenotype C2 315 (60.6) 365 (70.7) 305 (70.1) 172 (33.8) 170 (35.1) 108 (19.9) C1C2 8 (1.5) 27 (5.2) 34 (7.8) 6 (1.2) 1 (0.2) 4 (0.7) C1 4 (0.8) 1 (0.2) 5 (1.1) 1 (0.2) 2 (0.4) 2 (0.4) C3 28 (5.4) 28 (5.4) 55 (12.6) 10 (2.0) 37 (7.6) 14 (2.6) C4 4 (0.8) 7 (1.4) 0 (0.0) 2 (0.4) 0 (0.0) 0 (0.0) B2 120 (23.1) 26 (5.0) 13 (3.0) 62 (12.2) 237 (48.9) 330 (60.9) B2C1 1 (0.2) 1 (0.2) 0 (0.0) 1 (0.2) 0 (0.0) 1 (0.2) B2C1C2 0 (0.0) 4 (0.8) 4 (0.9) 2 (0.4) 1 (0.2) 0 (0.0) B2C2 39 (7.5) 52 (10.1) 16 (3.7) 250 (49.1) 34 (7.0) 82 (15.1) B2C3 0 (0.0) 4 (0.8) 0 (0.0) 2 (0.4) 1 (0.2) 1 (0.2) D 1 (0.2) 1 (0.2) 3 (0.7) 1 (0.2) 2 (0.4) 0 (0.0) 15
16 Supplementary Table S5. Distribution of HBV genotypes and subgenotypes in the additional independent sample set from Xi an Variable HCC patients (n = 107) N (%) HBV persistent carriers (n = 204) N (%) P No. of HBV typed 103 (96.3) 197 (96.6) Genotype <0.001 C 80 (77.7) 109 (55.3) B 7 (6.8) 42 (21.3) BC 11 (10.7) 42 (21.3) D 5 (4.9) 4 (2.0) Subgenotype C2 69 (67.0) 97 (49.2) C1C2 4 (3.9) 4 (2.0) C3 5 (4.9) 7 (3.6) C4 2 (1.9) 1 (0.5) B2 7 (6.8) 42 (21.3) B2C1 0 (0.0) 1 (0.5) B2C1C2 1 (1.0) 0 (0.0) B2C2 10 (9.7) 40 (20.3) B2C3 0 (0.0) 1 (0.5) D 5 (4.9) 4 (2.0) 16
17 Supplementary Table S6. A nucleotide with the highest frequency at each site from HBV persistent carriers as wild type Position Wild type Position Wild type Position Wild type Position nt1702 C nt1752 A nt1802 T nt1852 A nt1902 T nt1952 T Note: The bold represents hotspot sites with combined mutation frequencies > 10% from all the participants. 17 Wild type Position Wild type Position Wild type Position nt1653 C nt1703 A nt1753 T nt1803 T nt1853 T nt1903 G nt1953 T nt1654 A nt1704 T nt1754 T nt1804 C nt1854 G nt1904 G nt1954 T nt1655 T nt1705 A nt1755 A nt1805 A nt1855 T nt1905 A nt1955 T nt1656 A nt1706 C nt1756 G nt1806 C nt1856 C nt1906 C nt1956 T nt1657 A nt1707 T nt1757 G nt1807 C nt1857 C nt1907 A nt1957 G nt1658 G nt1708 T nt1758 T nt1808 A nt1858 T nt1908 T nt1958 C nt1659 A nt1709 C nt1759 T nt1809 G nt1859 A nt1909 T nt1959 C nt1660 G nt1710 A nt1760 A nt1810 C nt1860 C nt1910 G nt1960 T nt1661 G nt1711 A nt1761 A nt1811 A nt1861 T nt1911 A nt1961 T nt1662 A nt1712 A nt1762 A nt1812 C nt1862 G nt1912 C nt1962 C nt1663 C nt1713 G nt1763 G nt1813 C nt1863 T nt1913 C nt1963 T nt1664 T nt1714 A nt1764 G nt1814 A nt1864 T nt1914 C nt1964 G nt1665 C nt1715 C nt1765 T nt1815 T nt1865 C nt1915 G nt1965 A nt1666 T nt1716 T nt1766 C nt1816 G nt1866 A nt1916 T nt1966 C nt1667 T nt1717 G nt1767 T nt1817 C nt1867 A nt1917 A nt1967 T nt1668 G nt1718 T nt1768 T nt1818 A nt1868 G nt1918 T nt1968 T nt1669 G nt1719 G nt1769 T nt1819 A nt1869 C nt1919 A nt1969 C nt1670 A nt1720 T nt1770 G nt1820 C nt1870 C nt1920 A nt1970 T nt1671 C nt1721 G nt1771 T nt1821 T nt1871 T nt1921 A nt1971 T nt1672 T nt1722 T nt1772 A nt1822 T nt1872 C nt1922 G nt1972 T nt1673 C nt1723 T nt1773 C nt1823 T nt1873 C nt1923 A nt1973 C nt1674 T nt1724 T nt1774 T nt1824 T nt1874 A nt1924 A nt1974 C nt1675 C nt1725 A nt1775 A nt1825 T nt1875 A nt1925 T nt1975 T nt1676 A nt1726 A nt1776 G nt1826 C nt1876 G nt1926 T nt1976 T nt1677 G nt1727 T nt1777 G nt1827 A nt1877 C nt1927 T nt1977 C nt1678 C nt1728 G nt1778 A nt1828 C nt1878 T nt1928 G nt1978 T nt1679 A nt1729 A nt1779 G nt1829 C nt1879 G nt1929 G nt1979 A nt1680 A nt1730 C nt1780 G nt1830 T nt1880 T nt1930 A nt1980 T nt1681 T nt1731 T nt1781 C nt1831 C nt1881 G nt1931 G nt1981 T nt1682 G nt1732 G nt1782 T nt1832 T nt1882 C nt1932 C nt1982 C nt1683 T nt1733 G nt1783 G nt1833 G nt1883 C nt1933 T nt1983 G nt1684 C nt1734 G nt1784 T nt1834 C nt1884 T nt1934 T nt1984 A nt1685 A nt1735 A nt1785 A nt1835 C nt1885 T nt1935 C nt1985 G nt1686 A nt1736 G nt1786 G nt1836 T nt1886 G nt1936 T nt1986 A nt1687 C nt1737 G nt1787 G nt1837 A nt1887 G nt1937 G nt1987 T nt1688 G nt1738 A nt1788 C nt1838 A nt1888 G nt1938 T nt1988 C nt1689 A nt1739 G nt1789 A nt1839 T nt1889 T nt1939 G nt1989 T nt1690 C nt1740 T nt1790 T nt1840 C nt1890 G nt1940 G nt1990 C nt1691 C nt1741 T nt1791 A nt1841 A nt1891 G nt1941 A nt1991 C nt1692 G nt1742 G nt1792 A nt1842 T nt1892 C nt1942 G nt1992 T nt1693 A nt1743 G nt1793 A nt1843 C nt1893 T nt1943 T nt1993 C nt1694 C nt1744 G nt1794 T nt1844 T nt1894 T nt1944 T nt1994 G nt1695 C nt1745 G nt1795 T nt1845 C nt1895 T nt1945 A nt1995 A nt1696 T nt1746 G nt1796 G nt1846 A nt1896 G nt1946 C nt1996 T nt1697 T nt1747 A nt1797 G nt1847 T nt1897 G nt1947 T nt1997 A nt1698 G nt1748 G nt1798 T nt1848 G nt1898 G nt1948 C nt1998 C nt1699 A nt1749 G nt1799 G nt1849 T nt1899 G nt1949 T nt1999 C nt1700 G nt1750 A nt1800 T nt1850 T nt1900 C nt1950 C nt2000 G nt1701 G nt1751 G nt1801 G nt1851 C nt1901 A nt1951 T Wild type
18 Supplementary Table S7. The associations of the hotspot mutations in the EnhII/BCP/PC region of HBV in HCC patients, as compared with HBV persistent carriers Substitutions HBV HCC persistent patients carriers (n = 1471) (n = 1536) N (%) N (%) OR (95%CI) a P a OR (95%CI) b P b C1653T C 928 (70.7) 1273 (90.1) T 385 (29.3) 140 (9.9) 3.78 ( ) ( ) C1673T C 1151 (87.9) 766 (55.1) T 158 (12.1) 624 (44.9) 0.17 ( ) ( ) T1674C/G T 857 (65.6) 1244 (88.2) C/G 449 (34.4) 167 (11.8) 3.91 ( ) ( ) A1703G A 1155 (88.3) 1291 (91.6) G 153 (11.7) 119 (8.4) 1.44 ( ) ( ) G1719T G 324 (24.7) 816 (57.7) T 989 (75.3) 597 (42.3) 4.19 ( ) ( ) A1726C A 1174 (89.4) 866 (61.3) C 139 (10.6) 547 (38.7) 0.19 ( ) ( ) T1727A/G T 169 (12.9) 671 (47.6) A/G 1144 (87.1) 740 (52.4) 6.17 ( ) ( ) C1730G C 1140 (87.5) 778 (55.6) G 163 (12.5) 622 (44.4) 0.18 ( ) ( ) A1752G A 1211 (92.6) 925 (65.7) G 97 (7.4) 482 (34.3) 0.15 ( ) ( ) T1753C T 896 (70.3) 1213 (88.7) C 378 (29.7) 154 (11.3) 3.33 ( ) ( ) A1762T A 228 (17.4) 761 (53.9) T 1085 (82.6) 652 (46.1) 5.56 ( ) ( ) G1764A G 160 (12.2) 723 (51.2) A 1151 (87.8) 690 (48.8) 7.57 ( ) ( ) G1799C G 171 (13.0) 651 (46.1) C 1142 (87.0) 761 (53.9) 5.74 ( ) ( ) A1846T A 881 (67.8) 991 (70.9) T 419 (32.2) 406 (29.1) 1.16 ( ) ( ) G1896A G 635 (48.4) 731 (51.7) A 677 (51.6) 682 (48.3) 1.14 ( ) ( )
19 G1899A G 1001 (76.2) 1221 (86.4) A 312 (23.8) 192 (13.6) 1.99 ( ) ( ) G1915A/C G 1123 (85.8) 1267 (90.2) A/C 186 (14.2) 137 (9.8) 1.53 ( ) ( ) C1969T C 1102 (83.9) 1328 (94.0) T 211 (16.1) 85 (6.0) 2.99 ( ) ( ) A1979G A 1126 (85.8) 1237 (87.7) G 187 (14.2) 174 (12.3) 1.18 ( ) ( ) a Logistic regression analyses adjusted for age and gender between HCC patients and HBV persistent carriers. b Logistic regression analyses adjusted for age, gender and all the other mutations between HCC patients and HBV persistent carriers. 19
20 Supplementary Table S8. The LD information (pairwise r 2 ) for the hotspot mutations in the EnhII/BCP/PC region of HBV Mutatio ns C1653 T C1673 T T1674C/ G A1703 G G1719 T A1726 C T1727A/ G C1730 G A1752 G C1653T C1673T T1674C/ G A1703G G1719T A1726C T1727A/ G C1730G A1752G T1753C A1762T G1764A G1799C A1846T G1896A G1899A G1915A/ C C1969T A1979G T1753 C A1762 T G1764 A G1799 C A1846 T G1896 A G1899 A G1915A/ C C1969 T 20
21 Supplementary Table S9. Association between two SNPs and HBV-related HCC susceptibility Genotype HCC patients HBV persistent carriers Nanjing Nantong Qidong Zhangjiagang Taixing Danyang (n = 535) (n = 522) (n = 450) (n = 510) (n = 500) (n = 550) N (%) N (%) N (%) N (%) N (%) N (%) All HCC patients (n = 1507) N (%) All HBV persistent carriers (n = 1560) N (%) OR (95%CI) a rs G/G 131 (24.9) 133 (25.8) 111 (24.7) 152 (30.0) 158 (32.2) 180 (33.3) 375 (25.2) 490 (31.9) 1.00 G/A 237 (45.1) 266 (51.7) 216 (48.1) 246 (48.6) 244 (49.7) 258 (47.7) 719 (48.3) 748 (48.6) 1.25 ( ) A/A 158 (30.0) 116 (22.5) 122 (27.2) 108 (21.3) 89 (18.1) 103 (19.0) 396 (26.6) 300 (19.5) 1.72 ( ) Dominant 1.39 ( ) Recessive 1.50 ( ) Additive 1.31 ( ) rs A/A 456 (87.0) 434 (83.6) 374 (83.1) 383 (75.4) 377 (76.9) 438 (81.3) 1264 (84.7) 1198 (77.9) 1.00 G/A 65 (12.4) 81 (15.6) 71 (15.8) 117 (23.0) 105 (21.4) 91 (16.9) 217 (14.5) 313 (20.4) 0.66 ( ) G/G 3 (0.6) 4 (0.8) 5 (1.1) 8 (1.6) 8 (1.6) 10 (1.9) 12 (0.8) 26 (1.7) 0.44 ( ) Dominant 0.64 ( ) Recessive 0.47 ( ) Additive 0.66 ( ) a Logistic regression analyses adjusted for age and gender between all HCC patients and all HBV persistent carriers. P a 21
22 Supplementary Table S10. Stratified analyses on rs and rs with HCC susceptibility HBV genotype HCC patients HBV persistent carriers OR (95% CI) rs (GG / GA / AA) Stratification model 1 B 32 /67 / /313 / ( ) BC 20 /69 / /174 / ( ) C 312 /566 / /252 / ( ) Stratification model 2 B-related b 52 /136 / /487 / ( ) Non-B c 171 /253 / /569 / ( ) rs (AA / GA / GG) Stratification model 1 B 138 /18 / /110 / ( ) BC 101 /19 / /80 / ( ) C 989 /176 /9 399 /118 / ( ) Stratification model 2 B-related b 239 /37 /2 778 /190 / ( ) Non-B c 994 /176 /9 402 /118 / ( ) Note: Logistic regression analyses adjusted for age and gender in the additive genetic model. a P-value for the heterogeneity test. b B-related genotypes including B, BC. c Non-B genotypes including C, D. P a
23 Supplementary Table S11. Contributions of the multiplicative interactions of HLA SNPs with HBV mutations in the EnhII/BCP/PC region of HBV to HCC risk SNP * Mutation OR (95%CI) P SNP * Mutation OR (95%CI) P rs * C1653T 0.88 ( ) rs * C1653T 1.43 ( ) rs * C1673T 1.43 ( ) rs * C1673T 0.76 ( ) rs * T1674C/G 0.90 ( ) rs * T1674C/G 0.77 ( ) rs * A1703G 1.00 ( ) rs * A1703G 0.94 ( ) rs * G1719T 0.76 ( ) rs * G1719T 1.07 ( ) rs * A1726C 1.38 ( ) rs * A1726C 0.78 ( ) rs * T1727A/G 0.75 ( ) rs * T1727A/G 1.26 ( ) rs * C1730G 1.36 ( ) rs * C1730G 0.90 ( ) rs * A1752G 1.84 ( ) rs * A1752G 0.57 ( ) rs * T1753C 1.06 ( ) rs * T1753C 1.02 ( ) rs * A1762T 0.96 ( ) rs * A1762T 1.36 ( ) rs * G1764A 0.77 ( ) rs * G1764A 1.09 ( ) rs * G1799C 0.70 ( ) rs * G1799C 1.16 ( ) rs * A1846T 1.17 ( ) rs * A1846T 0.77 ( ) rs * G1896A 0.94 ( ) rs * G1896A 0.83 ( ) rs * G1899A 1.11 ( ) rs * G1899A 1.02 ( ) rs * G1915A/C 1.15 ( ) rs * G1915A/C 1.24 ( ) rs * C1969T 1.26 ( ) rs * C1969T 1.22 ( ) rs * A1979G 1.01 ( ) rs * A1979G 1.45 ( ) Note: Logistic regression analyses adjusted for age and gender in the additive genetic model. 23
IL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B
IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,
Single nucleotide polymorphisms in ZNRD1-AS1 increase cancer risk in an Asian population
/, 2017, Vol. 8, (No. 6), pp: 10064-10070 Single nucleotide polymorphisms in ZNRD1-AS1 increase cancer risk in an Asian population Ping-Yu Wang 1,2, Jing-Hua Li 2, Yue-Mei Liu 1, Qing Lv 1, Ning Xie 3,
Review Article Association between HLA-DQ Gene Polymorphisms and HBV-Related Hepatocellular Carcinoma
Hindawi Gastroenterology Research and Practice Volume 2017, Article ID 7150386, 11 pages https://doiorg/101155/2017/7150386 Review Article Association between HLA-DQ Gene Polymorphisms and HBV-Related
Detection and significance of PD-1.3 SNP (rs ) and IL28B SNP (rs ) in patients with current or past hepatitis B virus (HBV) infection
Detection and significance of PD-1.3 SNP (rs11568821) and IL28B SNP (rs12979860) in patients with current or past hepatitis B virus (HBV) infection Asterios Saitis 1, Nikolaos K. Gatselis 1, Kalliopi Azariadi
Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54
CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects
To test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
Natural History of HBV Infection
Natural History of HBV Infection Joseph JY Sung MD PhD Institute of Digestive Disease Department of Medicine & Therapeutics Prince of Wales Hospital The Chinese University of Hong Kong HBV Infection 2
Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2
Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2 rs4402960, (B) MTNR1B rs10830963, (C) TCF7L2 rs7903146, (D) IRS1 rs1801278, (E) PPARG rs1801282, (F)
Relationship between HLA-DP gene polymorphisms and the risk of hepatocellular carcinoma: a meta-analysis
Relationship between HLA-DP gene polymorphisms and the risk of hepatocellular carcinoma: a meta-analysis X. Zhang 1 *, C. Zheng 1 *, Z.H. Zhou 1, M. Li 1, Y.T. Gao 1, S.G. Jin 1, X.H. Sun 2 and Y.Q. Gao
Pappas G. (2009) Int J Parasitol. 39:
Genetic modifications within TLR4and TLR9genes contribute into congenital toxoplasmosis and cytomegalydevelopment Wioletta Wujcicka 1, Jan Wilczyński 1,2, Dorota Nowakowska 1,2 1 Department of Fetal-Maternal
Investigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population
Investigation on ERCC5 genetic polymorphisms and the development of gastric cancer in a Chinese population L.Q. Yang 1, Y. Zhang 2 and H.F. Sun 3 1 Department of Gastroenterology, The Second Affiliated
696 Biomed Environ Sci, 2015; 28(9):
696 Biomed Environ Sci, 2015; 28(9): 696-700 Letter to the Editor Fluoride Exposure, Follicle Stimulating Hormone Receptor Gene Polymorphism and Hypothalamus-pituitary-ovarian Axis Hormones in Chinese
Characterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya
Characterization of Hepatitis B Virus (HBV) Among Liver Patients in Kenya By MISSIANI OCHWOTO (Medical Research officer, KEMRI) Julius Oyugi 2, Dufton Mwaengo 2, James Kimotho 1 Carla Osiowy 3 and Elijah
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage
Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population
Influence of interleukin-18 gene polymorphisms on acute pancreatitis susceptibility in a Chinese population H.B. Gui 1, X.G. Du 2, Z.H. Fu 3 and X.M. Chen 1 1 Department of Emergency, The First Affiliated
Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population
Lack of association of IL-2RA and IL-2RB polymorphisms with rheumatoid arthritis in a Han Chinese population J. Zhu 1 *, F. He 2 *, D.D. Zhang 2 *, J.Y. Yang 2, J. Cheng 1, R. Wu 1, B. Gong 2, X.Q. Liu
Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis
Influence of interleukin-17 gene polymorphisms on the development of pulmonary tuberculosis G.-C. Shi and L.-G. Zhang Department of Tuberculosis, The First Affiliated Hospital of Xinxiang Medical University,
Investigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer
Investigating the role of polymorphisms in mir-146a, -149, and -196a2 in the development of gastric cancer Department of Gastrointestinal Surgery, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong
Massoud Houshmand National Institute for Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran
QUID 2017, pp. 669-673, Special Issue N 1- ISSN: 1692-343X, Medellín-Colombia NON-GENE REGION AND INFLUENCES TUMOR CHARACTERISTICS BY LOW-RISK ALLELES IN BREAST CANCER (Recibido el 21-06-2017. Aprobado
A common genetic variant of 5p15.33 is associated with risk for prostate cancer in the Chinese population
A common genetic variant of 5p15.33 is associated with risk for prostate cancer in the Chinese population Q. Ren 1,3 *, B. Xu 2,3 *, S.Q. Chen 2,3 *, Y. Yang 2,3, C.Y. Wang 2,3, Y.D. Wang 2,3, X.H. Wang
New evidence of TERT rs polymorphism and cancer risk: an updated meta-analysis
JBUON 2016; 21(2): 491-497 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE New evidence of TERT rs2736098 polymorphism and risk: an updated meta-analysis
Association between IL-17A and IL-17F gene polymorphisms and risk of gastric cancer in a Chinese population
Association between IL-17A and IL-17F gene polymorphisms and risk of gastric cancer in a Chinese population W.M. Zhao 1, P. Shayimu 1, L. Liu 1, F. Fang 1 and X.L. Huang 2 1 Department of Gastrointestinal
Analysis of glutathione peroxidase 1 gene polymorphism and Keshan disease in Heilongjiang Province, China
Analysis of glutathione peroxidase 1 gene polymorphism and Keshan disease in Heilongjiang Province, China H.L. Wei, J.R. Pei, C.X. Jiang, L.W. Zhou, T. Lan, M. Liu and T. Wang Center for Endemic Disease
Original Article MiR-146a genetic polymorphism contributes to the susceptibility to hepatocellular carcinoma in a Chinese population
Int J Clin Exp Pathol 2017;10(2):1833-1839 www.ijcep.com /ISSN:1936-2625/IJCEP0026649 Original Article MiR-146a genetic polymorphism contributes to the susceptibility to hepatocellular carcinoma in a Chinese
Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation
BRIEF REPORT Role of Hepatitis B Virus Genotypes in Chronic Hepatitis B Exacerbation Man-Fung Yuen, 1 Erwin Sablon, 2 Danny Ka-Ho Wong, 1 He-Jun Yuan, 1 Benjamin Chun-Yu Wong, 1 Annie On-On Chan, 1 and
CYP19 gene polymorphisms and the susceptibility to breast cancer in Xinjiang Uigur women
CYP19 gene polymorphisms and the susceptibility to breast cancer in Xinjiang Uigur women L. Yang, X.Y. Wang, Y.T. Li, H.L. Wang, T. Wu, B. Wang, Q. Zhao, D. Jinsihan and L.P. Zhu The Department of Mammary
Association between the CYP1A1 polymorphisms and hepatocellular carcinoma: a meta-analysis
Association between the CYP1A1 polymorphisms and hepatocellular carcinoma: a meta-analysis B.W. Yu 1 *, L.Q. Zhang 1 *, X.L. Teng 1, Y. Zhang 1, L.B. Zou 2 and H.Y. Ying 3 l Department of Clinical Laboratory,
Relative activity (%) SC35M
a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure
Association between polymorphisms in the promoter region of pri-mir-34b/c and risk of hepatocellular carcinoma
Association between polymorphisms in the promoter region of pri-mir-34b/c and risk of hepatocellular carcinoma L.L. Chen 1,2, Y. Shen 3, J.B. Zhang 4, S. Wang 5, T. Jiang 6, M.Q. Zheng 6, Z.J. Zheng 7
Association between matrix metalloproteinase-9 rs polymorphism and development of coronary artery disease in a Chinese population
Association between matrix metalloproteinase-9 rs3918242 polymorphism and development of coronary artery disease in a Chinese population L.M. Qin 1, G.M. Qin 2, X.H. Shi 1, A.L. Wang 1 and H. Zuo 1 1 The
GWAS Identifies Novel Susceptibility Loci on 6p21.32 and 21q21.3 for Hepatocellular Carcinoma in Chronic Hepatitis B Virus Carriers
GWAS Identifies Novel Susceptibility Loci on 6p21.32 and 21q21.3 for Hepatocellular Carcinoma in Chronic Hepatitis B Virus Carriers The Harvard community has made this article openly available. Please
NATURAL HISTORY OF HEPATITIS B
NATURAL HISTORY OF HEPATITIS B AND DIAGNOSTIC: STATE OF THE ART O. BAHRI LABORATORY OF MEDICAL BIOLOGY AZIZA OTHMANA HOSPITAL TUNIS, TUNISIA The 2 nd Congress of The Federation of Arab Societies of Clinical
Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population
Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population R. Zhao and M.F. Ying Department of Pharmacy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University,
mir-146a and mir-196a2 polymorphisms in ovarian cancer risk
mir-146a and mir-196a2 polymorphisms in ovarian cancer risk X.C. Sun, A.C. Zhang, L.L. Tong, K. Wang, X. Wang, Z.Q. Sun and H.Y. Zhang Department of Obstetrics and Gynecology, China-Japan Union Hospital
THE ROLE OF microrna POLYMORPHISMS IN GASTRIC CANCER PATHOGENESIS
UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA DOCTORAL SCHOOL THE ROLE OF microrna POLYMORPHISMS IN GASTRIC CANCER PATHOGENESIS PhD THESIS ABSTRACT SCIENTIFIC ADVISOR: PROF. UNIV. DR. ION ROGOVEANU PhD student:
IL-17 rs genetic variation contributes to the development of gastric cancer in a Chinese population
IL-17 rs2275913 genetic variation contributes to the development of gastric cancer in a Chinese population B.L. Xu, Y.T. Li, S.X. Dong, J. Qi, H.M. Feng, L. Zi and D.Y. Yang Department of General Surgery,
encouraged to use the Version of Record that, when published, will replace this version. The most /BSR
Bioscience Reports: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date
Association of Polymorphisms intrail and Chronic Hepatitis B in Chinese Han Populations from Shandong Province
374 Available online at www.annclinlabsci.org Annals of Clinical & Laboratory Science, vol. 46, no. 4, 2016 Association of Polymorphisms intrail and Chronic Hepatitis B in Chinese Han Populations from
Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer
Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer M.G. He, K. Zheng, D. Tan and Z.X. Wang Department of Hepatobiliary Surgery, Nuclear Industry 215 Hospital
Association between MTHFR 677C/T and 1298A/C gene polymorphisms and breast cancer risk
Association between MTHFR 677C/T and 1298A/C gene polymorphisms and breast cancer risk X.F. Zhang 1, T. Liu 2, Y. Li 1 and S. Li 2 1 Department of Breast, Liao Ning Cancer Hospital and Institute, Shenyang,
Nature Genetics: doi: /ng Supplementary Figure 1. Study design.
Supplementary Figure 1 Study design. Leukopenia was classified as early when it occurred within the first 8 weeks of thiopurine therapy and as late when it occurred more than 8 weeks after the start of
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations
Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations Kouichi Ozaki 1, Hiroshi Sato 2, Katsumi Inoue 3, Tatsuhiko Tsunoda 4, Yasuhiko
Letter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *
814 Biomed Environ Sci, 2016; 29(11): 814-817 Letter to the Editor Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * ZHANG Lu 1,^,
Review Article MicroRNA single-nucleotide polymorphisms and susceptibility to gastric cancer
Am J Digest Dis 2016;3(1):11-15 www.ajdd.us /ISSN:2329-6992/AJDD0023804 Review Article MicroRNA single-nucleotide polymorphisms and susceptibility to gastric cancer Xinhang Jiang, Xintong Chen, Linhua
Association between rs G<C gene polymorphism and susceptibility to pancreatic cancer in a Chinese population
Association between rs9904341 G
Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population
Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population J.J. Lu, H.Q. Zhang, P. Mai, X. Ma, X. Chen, Y.X. Yang and L.P. Zhang Gansu Provincial Hospital, Donggang
Associations of mirna polymorphisms and expression levels with breast cancer risk in the Chinese population
Associations of mirna polymorphisms and expression levels with breast cancer risk in the Chinese population P. Qi 1, L. Wang 2, B. Zhou 2, W.J. Yao 3, S. Xu 1, Y. Zhou 1 and Z.B. Xie 1 1 Department of
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
Associations between matrix metalloproteinase gene polymorphisms and the development of cerebral infarction
Associations between matrix metalloproteinase gene polymorphisms and the development of cerebral infarction J.H. Zhao 1,2, Y.M. Xu 1, H.X. Xing 2, L.L. Su 2, S.B. Tao 2, X.J. Tian 2, H.Q. Yan 2 and S.B.
Laboratory of Chronic Kidney Disease Prevention and Treatment (Peking University), Ministry of Education; Beijing, , People's Republic of China
Concise Communication DOI 10.1002/art.39268 Variants in CCR6 are associated with susceptibility to lupus nephritis in Chinese Authors: Xu-jie Zhou 1, MD & PhD;Rong Mu 2, MD & PhD;Chun Li 2, MD;Swapan K
Relationship Between GSTT1 Gene Polymorphism and Hepatocellular Carcinoma in Patients from China
RESEARCH ARTICLE Relationship Between GSTT1 Gene Polymorphism and Hepatocellular Carcinoma in Patients from China Jie Chen, Liang Ma, Ning-Fu Peng, Shi-Jun Wang, Le-Qun Li* Abstract Objective: The results
Research and Development
SNP Frequencies in SLC11A2, HFE, TMPRSS6, and TF and their Association with the Indicators of Blood Iron Status and Concentration in Pregnant Filipino Women Vanessa Joy A. Timoteo a, Jacus S. Nacis a,
A genome-wide association study identifies two new cervical cancer susceptibility loci at 4q12 and 17q12. Supplementary Materials
A genome-wide association study identifies two new cervical cancer susceptibility loci at 4q12 and 17q12 Supplementary Materials Yongyong Shi 1-4,42, Li Li 5,42, Zhibin Hu 6,7,42, Shuang Li 1,42, Shixuan
Corresponding author: F.Q. Wen
Association of a disintegrin and metalloproteinase 33 (ADAM33) gene polymorphisms with chronic obstructive pulmonary disease in the Chinese population: A meta-analysis D.D. Li 1,2, S.J. Guo 1,2, L.Q. Jia
Long term effects of low dose radiation exposure: the Portuguese tinea capitis cohort. Paula Boaventura
Long term effects of low dose radiation exposure: the Portuguese tinea capitis cohort Paula Boaventura Background The epilation by X-ray irradiation for tinea capitis treatment was widely used in many
Glecaprevir-Pibrentasvir in HCV GT 1 or 4 & Prior DAA Treatment MAGELLAN-1 (Part 2)
Phase 3 Treatment-Experienced in HCV GT 1 or 4 & Prior DAA Treatment MAGELLAN-1 (Part 2) in HCV GT 1 or 4 & Prior DAA Treatment MAGELLAN-1 (Part 2): Study Features MAGELLAN-1 (Part 2) Trial Design: Randomized,
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
Association between Toll-like receptor 9 gene polymorphisms and risk of bacterial meningitis in a Chinese population
Association between Toll-like receptor 9 gene polymorphisms and risk of bacterial meningitis in a Chinese population X.H. Wang, H.P. Shi and F.J. Li Tuberculosis Hospital of Shanxi Province, Xi an, China
modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,
The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,
Expression of programmed death ligand-1 on tumor cells varies pre and post
Expression of programmed death ligand-1 on tumor cells varies pre and post chemotherapy in non-small cell lung cancer Jin Sheng 1,2,3,*, Wenfeng Fang 1,2,3,*, Juan Yu 3, Yunpeng Yang 1,2,3, Yuxiang Ma
Treatment of chronic hepatitis B 2013 update
22 February 213 Treatment of chronic hepatitis B 213 update Pietro Lampertico 1st Gastroenterology Unit Fondazione IRCCS Cà Granda - Ospedale Maggiore Policlinico Università di Milano EASL 212 Clinical
What have we learned from HBV clinical cohorts?
PHC 2015: Hepatitis B What have we learned from HBV clinical cohorts? Jia-Horng Kao MD, Ph D Graduate Institute of Clinical Medicine, Hepatitis Research Center, Department of Internal Medicine, National
Matrix metalloproteinase variants associated with risk and clinical outcome of esophageal cancer
Matrix metalloproteinase variants associated with risk and clinical outcome of esophageal cancer L. Zhang, R.-X. Xi and X.-Z. Zhang Department of Radiation Oncology, The First Affiliated Hospital of Xi
Original Article Association of osteopontin polymorphism with cancer risk: a meta-analysis
Int J Clin Exp Med 2015;8(11):20911-20917 www.ijcem.com /ISSN:1940-5901/IJCEM0015120 Original Article Association of osteopontin polymorphism with cancer risk: a meta-analysis Gang Yang 1, Xiaoxing Peng
Original Article Single nucleotide polymorphisms in VEGF gene are associated with an increased risk of osteosarcoma
Int J Clin Exp Pathol 2014;7(11):8143-8149 www.ijcep.com /ISSN:1936-2625/IJCEP0002762 Original Article Single nucleotide polymorphisms in VEGF gene are associated with an increased risk of osteosarcoma
Association between hsa-mir-34b/c rs T > C promoter polymorphism and cancer risk: a meta-analysis based on 6,036 cases and 6,204 controls
Original Article Association between hsa-mir-34b/c rs4938723 T > C promoter polymorphism and cancer risk: a meta-analysis based on 6,036 cases and 6,204 controls Tao Tao 1,2,3 *, Shuqiu Chen 1,2,3 *, Bin
TGF-β1 polymorphisms and familial aggregation of liver cancer in Guangxi, China
TGF-β1 polymorphisms and familial aggregation of liver cancer in Guangxi, China P.Q. Wan, J.Z. Wu, L.Y. Huang, J.L. Wu, Y.H. Wei and Q.Y. Ning Department of Infectious Disease, The First Affiliated Hospital
Pooled analysis of association between a genetic variant in the 3'-untranslated region of Toll-like receptor 4 and cancer risk
Pooled analysis of association between a genetic variant in the 3'-untranslated region of Toll-like receptor 4 and cancer risk X. Wang*, Z. Xu* and C.H. Miao Department of Anesthesiology, Shanghai Cancer
Association of MHC class III gene polymorphisms with ER-positive breast cancer in a Chinese Han population
Association of MHC class III gene polymorphisms with ER-positive breast cancer in a Chinese Han population Q. Pan 1 *, Y. Ning 1 *, L.Z. Chen 2, S. Zhang 1, Z.Z. Liu 1, X.X. Yang 3, W. Wei 3, H. Wei 1,
A total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in
Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican
Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
1 2 APPENDIX Legends to figures 3 4 5 Figure A1: Distribution of perfect SSR along chromosome 1 of V. cholerae (El-Tor N191). a) SSR with core motif > 2 and repeats number >3. b) MNR with repeats number>5.
Association of polymorphism rs in STAT3 with chronic hepatitis B virus infection in Han Chinese population
Li et al. BMC Medical Genetics (2018) 19:52 https://doi.org/10.1186/s12881-018-0569-x RESEARCH ARTICLE Open Access Association of polymorphism rs1053005 in STAT3 with chronic hepatitis B virus infection
Lack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis
Lack of association between IL-6-174G>C polymorphism and lung cancer: a metaanalysis Y. Liu, X.L. Song, G.L. Zhang, A.M. Peng, P.F. Fu, P. Li, M. Tan, X. Li, M. Li and C.H. Wang Department of Respiratory
The association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease
The association between TCM syndromes and SCAP polymorphisms in subjects with non-alcoholic fatty liver disease Shanshan Sun, Tao Wu, Miao Wang, Wei Li, Lin Wang, Songhua He, Huafeng Wei, Haiyan Song,
Supplementary Material
1 Supplementary Material 3 Tumour Biol. 4 5 6 VCP Gene Variation Predicts Outcome of Advanced Non-Small-Cell Lung Cancer Platinum-Based Chemotherapy 7 8 9 10 Running head: VCP variation predicts NSCLC
Viral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016
Viral and Host Factors in Vulvar Disease DR MICHELLE ETHERSON 26 TH OF APRIL 2016 Human Papillomavirus (HPV) Small non-enveloped Double stranded DNA Virus Genome 8000 basepairs 8 coding genes, Early (E)
UNIVERSITY OF MEDICINE AND PHARMACY OF CRAIOVA DOCTORAL SCHOOL DOCTORAL THESIS
UNIVERSITY OF MEDICINE AND PHARMACY OF CRAIOVA DOCTORAL SCHOOL DOCTORAL THESIS PHARMACOGENETICS AND THE APPLICATION OF SINGLE NUCLEOTIDE POLYMORPHISMS IN RESPONSE TO PEGYLATED INTERFERON AND RIBAVIRIN
Journal of Microbes and Infection,June 2007,Vol 2,No. 2. (HBsAg)2 , (PCR) 1762/ 1764
68 2007 6 2 2 Journal of Microbes and Infection,June 2007,Vol 2,No. 2 2 S 1 1 1 2 2 3 1 (HBsAg)2 ( YIC) S 5 30g 60g YIC ( HBV) DNA > 2 log10 e (HBeAg), 6 DNA, 1 YIC 1, (PCR) (0 ) (44 ) HBV DNA S 2, S a
Original Article Correlation between mirna-196a2 and mirna-499 polymorphisms and bladder cancer
Int J Clin Exp Med 2016;9(11):20484-20488 www.ijcem.com /ISSN:1940-5901/IJCEM0031518 Original Article Correlation between mirna-196a2 and mirna-499 polymorphisms and bladder cancer Jiansheng Wang, Yi Zhang,
Association of microrna polymorphisms with the risk of head and neck squamous cell carcinoma in a Chinese population: a case control study
DOI 10.1186/s40880-016-0136-9 Chinese Journal of Cancer ORIGINAL ARTICLE Open Access Association of microrna polymorphisms with the risk of head and neck squamous cell carcinoma in a Chinese population:
CYP1A2 polymorphism in Chinese patients with acute liver injury induced by Polygonum multiflorum
CYP1A2 polymorphism in Chinese patients with acute liver injury induced by Polygonum multiflorum K.F. Ma, X.G. Zhang and H.Y. Jia The First Affiliated Hospital, Zhejiang University, Hangzhou, China Corresponding
HLA Class II Variants in Chinese Breast Cancer Patients
RESEARCH COMMUNICATION Xue-Xi Yang 1&, Hua-Zheng Pan 2&, Pei-Yi Li 1, Fen-Xia Li 1, Wei-Wen Xu 1, Ying- Shong Wu 1, Guang-Yu Yao 3, Ming Li 1* Abstract Alterations of human leukocyte antigen (HLA) class
Diagnostic Methods of HBV infection. Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO)
Diagnostic Methods of HBV infection Zohreh Sharifi,ph.D of Virology Research center, Iranian Blood Transfusion Organization (IBTO) Hepatitis B-laboratory diagnosis Detection of HBV infection involves
Genetic variants on 17q21 are associated with asthma in a Han Chinese population
Genetic variants on 17q21 are associated with asthma in a Han Chinese population F.-X. Li 1 *, J.-Y. Tan 2 *, X.-X. Yang 1, Y.-S. Wu 1, D. Wu 3 and M. Li 1 1 School of Biotechnology, Southern Medical University,
DM type. Diagnostic method of DR. fluorescein angiography; Ophthalmoscopy. ophthalmoscopic examination. fundus photography; Ophthalmoscopy
2012 Informa USA, Inc. DOI: 10.3109/13816810.2012.675398 Online supplementary material published in conjunction with S. Zhao et al.., Nitric oxide synthase 3 (NOS3) 4b/a, T-786C and G894T polymorphisms
Association of polymorphisms of the xeroderma pigmentosum complementation group F gene with increased glioma risk
Association of polymorphisms of the xeroderma pigmentosum complementation group F gene with increased glioma risk W.K. Zhou 1, L.Y. Huang 1, L. Hui 1, Z.W. Wang 1, B.Z. Jin 1, X.L. Zhao 1, X.Z. Zhang 1,
Original Article Association between interleukin-10 gene promoter polymorphisms and susceptibility to liver cirrhosis
Int J Clin Exp Pathol 2015;8(9):11680-11684 www.ijcep.com /ISSN:1936-2625/IJCEP0011439 Original Article Association between interleukin-10 gene promoter polymorphisms and susceptibility to liver cirrhosis
Association study between polymorphism of interleukin 12B 1188A/C and hepatitis B virus infection in a Chinese Han population
Experimental immunology DOI: 10.5114/ceji.2013.39763 Association study between polymorphism of interleukin 12B 1188A/C and hepatitis B virus infection in a Chinese Han population Zusen Wang 1, Congcong
Association of the IL6 polymorphism rs with cancer risk: a meta-analysis
Association of the IL6 polymorphism rs1800796 with cancer risk: a meta-analysis Y. Du 1,2 *, L. Gao 1,2 *, K. Zhang 1 and J. Wang 1 1 Key Laboratory of Mental Health, Institute of Psychology, Chinese Academy
Original Article Pre-miR-149 rs polymorphism is associated with increased cancer risk and AKT1/cyclinD1 signaling in hepatocellular carcinoma
Int J Clin Exp Med 2015;8(8):13628-13633 www.ijcem.com /ISSN:1940-5901/IJCEM0012040 Original Article Pre-miR-149 rs71428439 polymorphism is associated with increased cancer risk and AKT1/cyclinD1 signaling
CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population
CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population Christopher N. Greene, Ph.D. Newborn Screening and Molecular Biology Branch National Center for Environmental
Investigation of ERCC1 and ERCC2 gene polymorphisms and response to chemotherapy and overall survival in osteosarcoma
Investigation of ERCC1 and ERCC2 gene polymorphisms and response to chemotherapy and overall survival in osteosarcoma Q. Zhang 1, L.Y. Lv 1, B.J. Li 1, J. Zhang 1 and F. Wei 2 1 Department of Orthopaedics,
Clinical and Virological Characteristics of Chronic Hepatitis B Patients with Coexistence of HBsAg and Anti-HBs
RESEARCH ARTICLE Clinical and Virological Characteristics of Chronic Hepatitis B Patients with Coexistence of HBsAg and Anti-HBs Yong Liu 1,2, Le Zhang 1,2, Jin-Yong Zhou 1,2, Jinshun Pan 1,2, Wei Hu 1,
Qidong hepatitis B virus infection cohort: a 25-year prospective study in high risk area of primary liver cancer
Chen et al. Hepatoma Res 2018;4:4 DOI: 10.20517/2394-5079.2017.50 Hepatoma Research Cohort Profile Open Access Qidong hepatitis B virus infection cohort: a 25-year prospective study in high risk area of
UNIVERSITY OF CALIFORNIA, LOS ANGELES
UNIVERSITY OF CALIFORNIA, LOS ANGELES BERKELEY DAVIS IRVINE LOS ANGELES MERCED RIVERSIDE SAN DIEGO SAN FRANCISCO UCLA SANTA BARBARA SANTA CRUZ DEPARTMENT OF EPIDEMIOLOGY SCHOOL OF PUBLIC HEALTH CAMPUS
Identification of hepatitis B virus DNA reverse transcriptase variants associated with partial response to entecavir
Title Identification of hepatitis B virus DNA reverse transcriptase variants associated with partial response to entecavir Author(s) Wong, DKH; Fung, JYY; Lai, CL; Yuen, RMF Citation Hong Kong Medical
Title:The effect of CD14 and TLR4 gene polimorphisms on asthma phenotypes in adult Turkish asthma patients: a genetic study
Author's response to reviews Title:The effect of CD14 and TLR4 gene polimorphisms on asthma phenotypes in adult Turkish asthma patients: a genetic study Authors: Fusun Sahin (fusunsahin19700@hotmail.com)