Electronic Supplementary Information. Direct chemiluminescence detection of circulating. micrornas in serum samples using a single-strand specific

Transcription

1 Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information Direct chemiluminescence detection of circulating micrornas in serum samples using a single-strand specific nuclease-distinguishing nucleic acid hybrid system Kai Ling, * a,b Hongyan Jiang, b Xue Huang, a Yang Li, a Juanjuan Lin a and Fu-Rong Li* a a. Translational Medicine Collaborative Innovation Center, The Second Clinical Medical College (Shenzhen People s Hospital), Jinan University, Shenzhen , China. b. Department of Pharmacy, Shantou University Medical College, No. 22 Xinling Road, Shantou , China. These authors contributed equally. *To whom correspondence should be addressed. kailing@stu.edu.cn, frli62@163.com.

2 1. Experimental 1.1. Materials and chemicals Proteinase K (20 mg/ml), Tween 20 surfact-amps detergent solution (10%), Tris/EDTA (TE) buffer (ph 8.0), maleic anhydride activated microplates (white, 96- well), phosphate-buffered saline (PBS 10, ph 7.4), SuperBlock blocking buffer (in PBS), SA-poly-HRP, Poly-HRP dilution buffer, SuperSignal West Pico PLUS chemiluminescent substrate, E-Gel 4% high-resolution agarose gels, a GeneRuler ultra low range DNA ladder, and Nunc adhesive plate seals were purchased from Thermo Fisher Scientific (Shanghai, China). RNase ONE ribonuclease was purchased from Promega (Fitchburg, WI, USA). mircury RNA isolation kit (biofluids) was purchased from Exiqon (Vedbaek, Denmark). TaqMan mirna reverse transcription kit and TaqMan mirna assays (hsa-mir-16, hsa-mir-25, and hsa-mir-223) were purchased from Applied Biosystems (Foster City, CA, USA). Nuclease-free water was purchased from Sangon Biotech (Shanghai, China). All oligonucleotides (HPLC grade) were synthesized and purchased from TaKaRa Biotechnology (Dalian, China). Hydrochloric acid, sodium hydroxide, sodium citrate, sodium chloride, and EDTA (analytical grade) were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China) and were used as received. Milli-Q ultrapure water (18.2 MΩ cm; Millipore, Billerica, MA, USA) was used throughout the study. The base sequences of the oligonucleotides used in this study were as follows (5 to 3 ) : mir-16: rurargrcrargrcrarcrgrurarararurarururgrgrcrg

3 let-7a: let-7b: let-7c: let-7d: let-7e: let-7f: rurgrargrgrurargrurargrgrururgrurarurargruru rurgrargrgrurargrurargrgrururgrurgrurgrgruru rurgrargrgrurargrurargrgrururgrurarurgrgruru rargrargrgrurargrurargrgrururgrcrarurargruru rurgrargrgrurargrgrargrgrururgrurarurargruru rurgrargrgrurargrurargrarururgrurarurargruru RNA/DNA ChO for mir-16: CAAACAAACATTCAAATATCAATC rcrgrcrcrararurarurururarcrgrurgrcrurgrcrura TACTTCTTTACTACAATTTACAAC RNA/DNA ChO for mir-25: CAAACAAACATTCAAATATCAATC rurcrargrarcrcrgrargrarcrarargrurgrcrararurg TACTTCTTTACTACAATTTACAAC RNA/DNA ChO for mir-223: CAAACAAACATTCAAATATCAATC rurgrgrgrgrurarurururgrarcrarararcrurgrarcra TACTTCTTTACTACAATTTACAAC RNA/DNA ChO for let-7a: CAAACAAACATTCAAATATCAATC rararcrurarurarcrararcrcrurarcrurarcrcrurcra TACTTCTTTACTACAATTTACAAC LO: SAO: NH 2 -(CH 2 ) 12 -GTTGTAAATTGTAGTAAAGAAGTA GA-(biotin-T)-TGATATT-(biotin-T)-GAATGTT-(biotin-T)- GTTTG-biotin 1.2. Instruments All luminescence measurements were recorded by a Spark 10M multimode

4 microplate reader (TECAN, Männedorf, Swizerland) at 25 C. A dry bath thermostatic shaking incubator (JXH-200; Shanghai Jingxin Industrial Co., Ltd, Shanghai, China) was used for serum sample processing and hybridization. Reverse transcription reactions of mirnas were performed on a Veriti thermal cycler (Applied Biosystems). q-pcr reactions were performed on an ABI Prism 7500 and analyzed using Prism 7500 software (v1.4; Applied Biosystems). The quality and quantity of all RNA and DNA were estimated by ultraviolet (UV) spectroscopy with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). All agarose gels were visualized under UV light and photographed using the Enduro GDS gel documentation system (Labnet, Edison, NJ, USA) Direct detection of circulating mirnas in clinical serum samples Clinical serum samples Clinical serum samples from 16 NSCLC patients and 10 healthy human donors (confirmed by pathological examinations) were obtained from the Shenzhen People s Hospital (Shenzhen, China). This study was approved by the Ethical Committee of the Shenzhen People s Hospital and by the Ethical Committee of the Medical College, Jinan University. All patients provided written informed consent Serum-sample processing Tween 20 solution (10%) was diluted with TE buffer (ph 8.0) to a final concentration of 1% and added to the Proteinase K solution (final concentration: 200

5 μg/ml) to form the serum processing solution. A frozen serum sample ( 80 C) was thawed to 25 C and swirled gently five to ten times. The serum sample was mixed with the processing solution at a 1:1 ratio and incubated at 37 C for 30 min with gentle swirling. The mixture was then incubated at 60 C for 90 min with shaking at 300 rpm. The processed serum sample was then processed further or stored at 80 C for future use Fixing the LO to the 96-well microplate PBS buffer (10 ; ph 7.4) was diluted with nuclease-free water to 1, and LO was dissolved into the 1 PBS buffer to a final concentration of 1 nm. The wells of the maleic anhydride activated microplate were washed completely three times, and 100 μl of the LO solution was added to each well of the microplate. The plate was sealed tightly and incubated at 37 C for 10h to 12 h with gentle swirling. After discarding the seal and the solution, 200 μl of SuperBlock blocking buffer (in PBS) were added to the wells and incubated at 25 C for 1 h with gentle swirling. Tween 20 surfactamps detergent solution (10%) was diluted with 1 PBS buffer (ph 7.4) to a final concentration of 0.05% for use as a wash buffer. After removing the blocking buffer from the wells, the plate was washed three times with wash buffer and the microplate was used immediately or sealed and stored at 4 C for future use Hybridizing RNA/DNA chimera oligonucleotide (ChO) with LO

6 ChO was dissolved in TE buffer (ph 8.0) to a final concentration of 1 nm and 100 μl of the ChO solution was added to each well of the microplate and incubated at 37 C for 10 min with gentle swirling. After mixing completely, the plate was sealed tightly and incubated at 45 C to begin the 2 h hybridization Hybridizing circulating mirnas with ChO After removing the seal and solution, the wells of the microplate were washed three times with wash buffer, and 100 μl of the processed serum sample was added to each well and incubated at 37 C for 10 min with gentle swirling. After mixing completely, the plate was sealed tightly and incubated at 45 C to initiate overnight hybridization Distinguishing mirna-cho hybrids by SSSN RNase ONE ribonuclease was diluted 500-fold with TE buffer (ph 8.0) to a final concentration range of 1 U/100 μl to 2 U/100 μl. After discarding the seal and solution, the wells of the microplate were washed three times with wash buffer and 100 μl of the RNase ONE ribonuclease solution was added, followed by incubation at 37 C for 10 min with gentle swirling. After mixing completely, the plate was sealed tightly and incubated at 37 C to initiate the 1 h biodegradation Hybridizing the SAO with ChO

7 Removing the seal and solution, the wells of the microplate were washed three times with wash buffer, and SAO was dissolved in TE buffer (ph 8.0) to a final concentration of 1 nm, followed by addition of 100 μl of the SAO solution to each well of the microplate and incubation at 37 C for 10 min with gentle swirling. After mixing completely, the plate was sealed tightly and incubated at 45 C to initiate the 2 h hybridization SA-poly-HRP binding to SAO SA-poly-HRP was diluted 2500-fold with Poly-HRP dilution buffer. After discarding the seal and solution, the wells of the microplate were washed three times with wash buffer and 100 μl of SA-poly-HRP solution was added to each well, followed by incubation at 37 C for 30 min with gentle swirling Addition of the chemiluminescent substrate and signal detection SuperSignal stable peroxide solution was mixed with SuperSignal luminol/enhancer solution at a ratio of 1:1 for use as the ECL substrate. The wells of the microplate were washed three times with wash buffer, and 100 μl of the ECL substrate was added to each well, followed by incubation at 25 C for 5 min. The plate was immediately placed in a microplate reader and the luminescence intensity was recorded using an integration time of 500 ms.

8 1.4. Serum mirna isolation and qpcr Total mirna was extracted from clinical serum samples using the mircury RNA isolation kit (biofluids) according to the manufacturer s instructions (Exiqon), and TaqMan mirna assays (Applied Biosystems) were used to quantify the expression of serum mir-16, mir-25, and mir-223. Reverse transcription was performed using the TaqMan mirna reverse transcription kit (Applied Biosystems). In this study, Ct values for the target mirnas (mir-25 and mir-223) were normalized relative to that of mir-16 (endogenous control), and differential expression of the target mirnas relative to the endogenous control was evaluated using the 2 -ΔΔCt method as previously described Specificity To determine the specificity of the direct chemiluminescence detection system (DCDS), the special RNA/DNA ChO for let-7a was utilized to hybridize the different let-7 family mirnas (let-7a to let-7f), followed by the determination of luminescence intensity according to detection of the serum mirna. The values of the mismatch rates for let-7b to let-7f were obtained by comparing their corresponding luminescence intensity to let-7a. All let-7 family mirnas were artificially synthesized and detected at 1 pm concentration (in 1 PBS buffer) Data analysis OriginPro 8.0 software (OriginLab, Northampton, MA, USA) was used for data

9 processing. Each sample measurement was performed in triplicate, and data were presented as the mean ± standard deviation. All tests were 2-tailed, and results with a P < 0.05 were considered statistically significant. 1 Z. Huang, D. Huang, S. Ni, Z. Peng, W. Sheng and X. Du, Int. J. Cancer, 2010, 127, J. Wang, J. Chen, P. Chang, A. LeBlanc, D. Li, J. L. Abbruzzesse, M. L. Frazier, A. M. Killary and S. Sen, Cancer Prev. Res., 2009, 2, H. M. Heneghan, N. Miller, A. J. Lowery, K. J. Sweeney, J. Newell and M. J. Kerin, Ann. Surg., 2010, 251, Supplementary Results Table S1. Biotin modification of the SAO sequence. Name Base Sequence (5 to 3 ) SAO 1 SAO 2 SAO 3 SAO 4 GATTGATATTTGAATGTTTGTTTG-biotin GA-(biotin-T)-TGATATTTGAATGTTTGTTTG-biotin GA-(biotin-T)-TGATATT-(biotin-T)-GAATGTTTGTTTG-biotin GA-(biotin-T)-TGATATT-(biotin-T)-GAATGTT-(biotin-T)-GTTTG-biotin

10 Fig. S1. Relative standard deviation (RSD, %) of luminescence signals in the range 10 fm to 50 pm mir-16 concentration.

11 Fig. S2. Detection of NSCLC-specific mirna biomarkers. The normalized expression levels of (a) mirna-25 and (b) mirna-223 in 10 healthy donors and 16 NSCLC patients measured by qpcr and the direct chemiluminescence detection system (DCDS) and normalized against endogenous serum mir-16 levels.

12 Table S2. qpcr analysis of endogenous mir-16, mir-25, and mir-223 expression in serum samples from healthy donors. Serum Samples mir-16 mir-25 mir-223 Number Gender Age Ct mean Ct SD Ct mean Ct SD 2 -ΔCt* Ct mean Ct SD 2 -ΔCt** (years) H1 Male H2 Male H3 Female H4 Male H5 Male H6 Female H7 Female H8 Male H9 Male H10 Female * The Ct value of mir-25 minus the Ct value of mir-16. ** The Ct value of mir-223 minus the Ct value of mir-16. SD, standard deviation. Table S3. qpcr analysis of endogenous mir-16, mir-25, and mir-223 expression in serum samples from NSCLC patients. Serum Samples mir-16 mir-25 mir-223 Patient number Age Ct Ct Ct Gender Ct SD Ct SD 2 -ΔCt* Ct SD (cancer type, stage) (years) mean mean mean 2 -ΔCt** N1 (adenocarcinoma, I) Male N2 (adenocarcinoma, I) Female N3 (squamous carcinoma, I) N4 (squamous carcinoma, III) Male Male N5 (adenocarcinoma, II) Male N6 (adenocarcinoma, I) Male N7 (adenocarcinoma, I) Male N8 (adenocarcinoma, IV) Female N9 (squamous Female

13 carcinoma, I) N10 (adenocarcinoma, IV) N11 (squamous carcinoma, III) N12 (adenocarcinoma, II) N13 (adenocarcinoma, IV) N14 (adenocarcinoma, IV) N15 (adenocarcinoma, IV) N16 (adenocarcinoma, I) Male Female Female Male Female Male Female * The Ct value of mir-25 minus the Ct value of mir-16. ** The Ct value of mir-223 minus the Ct value of mir-16. SD, standard deviation. Table S4. Measurement of endogenous mir-16, mir-25, and mir-223 expression in serum samples from healthy donors using the direct chemiluminescence detection system. Serum Samples mir-16 mir-25 mir-223 Age Number Gender LI mean LI SD LI mean LI SD LIR 25/16 * LI mean LI SD LIR 223/16 ** (years) H1 Male H2 Male H3 Female H4 Male H5 Male H6 Female H7 Female H8 Male H9 Male H10 Female * The ratio of the luminescence intensity (signal background) of mir-25 to the luminescence intensity (signal

14 background) of mir-16 ** The ratio of the luminescence intensity (signal background) of mir-223 to the luminescence intensity (signal background) of mir-16. The luminescence intensity of the background is 1287 ± 165 LU. LI, luminescence intensity; LIR, normalized LI ratio; SD, standard deviation. Table S5. Measurement of endogenous mir-16, mir-25, and mir-223 expression in serum samples from healthy donors using the direct chemiluminescence-detection system. Serum Samples mir-16 mir-25 mir-223 Patient number Age LI LI LI (cancer type, Gender (years LI SD LI SD LIR 25/16 * LI SD LIR 223/16 ** mean mean mean stage) ) N1 (adenocarcinoma, I) N2 (adenocarcinoma, I) N3 (squamous carcinoma, I) N4 (squamous carcinoma, III) N5 (adenocarcinoma, II) N6 (adenocarcinoma, I) N7 (adenocarcinoma, I) N8 (adenocarcinoma, IV) N9 (squamous carcinoma, I) N10 (adenocarcinoma, IV) N11 (squamous carcinoma, III) Male Female Male Male Male Male Male Female Female Male Female

15 N12 (adenocarcinoma, II) N13 (adenocarcinoma, IV) N14 (adenocarcinoma, IV) N15 (adenocarcinoma, IV) N16 (adenocarcinoma, I) Female Male Female Male Female * The ratio of the luminescence intensity (signal background) of mir-25 to the luminescence intensity (signal background) of mir-16 ** The ratio of the luminescence intensity (signal background) of mir-223 to the luminescence intensity (signal background) of mir-16. The luminescence intensity of the background is 1231 ± 232 LU. LI, luminescence intensity; LIR, normalized LI ratio; SD, standard deviation. Fig. S3. Relative correlation of endogenous serum mir-25 (a) and mir-223 (b) between the results given by qpcr (x-axis) and the direct chemiluminescence detection system (DCDS, y- axis) in the same clinical serum samples.