Contents. Welcome 3. EAU Sponsors and Contributors 4

Transcription

1 It s easy to save money on your flights if you fly the Star Alliance network. Simply quote the event code SK01A57 when you make your booking with any Star Alliance member airline and you ll automatically get a discount of up to 20%. The Star Alliance network has 27 member airlines with over 21,900 flights a day so we can offer you a lot more choice when planning your travel. For more information about our member airlines and contact details, please visit our website at staralliance.com/conventionsplus staralliance.com Information correct as at 11/2012

2 Contents Welcome 3 EAU Sponsors and Contributors 4 Synopsis & Venue EAU Award Winners 6 Acknowledgement of Abstract reviewers 9 Floorplans 12 Synopsis 15 Exhibition Floorplans 30 Alphabetical list of Exhibitors 34 General General Information 39 Speaker Guidelines 46 CME Accreditation 47 EU-ACME Programme 48 Congress Hotels 49 EAU Programme Friday, 15 March 53 EAU Programme Saturday, 16 March 75 EAU Programme Sunday, 17 March 143 EAU Programme Monday, 18 March 233 EAU Programme Tuesday, 19 March 317 ESU Courses and Hands-on Training Courses ESU Courses 321 ESU/ESUT Hands-on Training Courses 373 Sponsored Sessions 397 About EAU EAU Membership 423 EAU Offices 424 Historical Overview EAU Congresses 427 Indices Abstract Authors 429 Abstracts sorted by Topic 467 Sessions sorted by Topic 470 List of Speakers (not abstracts) 471 The EAU Scientific Congress Office is responsible for the scientific congress programme (with the exception of the sponsored sessions). However, the opinions and recommendations expressed by the presenters and planners of educational content in this programme are their own and do not necessarily represent the viewpoint of the EAU 2 Programme Book

3 Welcome to Milan by the EAU Secretary General and the Congress President Dear friends and colleagues, We are delighted to have you here with us at the 28th Annual EAU Congress, in the beautiful city of Milan! The congress thrives on your enthusiastic participation and continuous support and we thank you for bringing your experience and your ideas to this international gathering. Milan is a wonderful host city and we are very excited to return to the recently renovated venue of MiCo Milano Congressi. It features all the latest facilities to accommodate an event of this scope and we believe that it will provide a perfect setting for our forward-looking discussions. From a full-day live surgery event in the euro Auditorium to the state-of-the art technology shown on the exhibition floor, the congress will draw much of its inspiration from the promises of the future. The scientific programme of the congress is once again very diverse both in format and content. We have made sure to meet the needs of the whole urological community and address a wide range of pressing topics. At the same time we will be continuing some of the ongoing discussions, such as screening for prostate cancer and adding new evidence and experience to these controversial topics. Over 1,500 faculty members will be delivering the latest information in urology and sharing the most relevant best practices in the course of five days a scientific effort of an incredible scale, which will certainly inspire many of us to further grow within this field and contribute to its development. If you are looking for practical information and a hands-on experience, the European School of Urology has prepared nearly 40 courses to choose from. Highly interactive and always popular, the courses are a great chance not only to learn, but also to meet new colleagues and build new contacts. We hope that your time in Milan will be productive and that it will be a source of great inspiration and knowledge for the year to come. We also wish you to have a very pleasant stay in Milan a city known for its architecture, exquisite restaurants and fashion! On behalf of the European Association of Urology, Per-Anders Abrahamsson EAU Secretary General Francesco Montorsi Congress President EAU Milan

4 EAU Sponsors & Contributors EAU Platinum Corporate sponsors AMGEN ASTELLAS GLAXOSMITHKLINE IPSEN EAU Gold Corporate Sponsors AMERICAN MEDICAL SYSTEMS ELI LILLY AND COMPANY FERRING PHARMACEUTICALS INTUITIVE SURGICAL JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON KARL STORZ GMBH & CO.KG MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY OLYMPUS EUROPA HOLDING GMBH PIERRE FABRE MÉDICAMENT SANOFI ONCOLOGY EAU Congress Contributors ALLERGAN BAYER HEALTHCARE PHARMACEUTICALS IBSA INSTITUTE BIOCHEMIQUE SA LUMENIS MENARINI NOVARTIS ONCOLOGY OM PHARMA PFIZER PORGÈS A COLOPLAST DIVISION PRIME ONCOLOGY RECORDATI STEBA BIOTECH 4 Programme Book

5 EAU Member Benefits at EAU 2013! EAU members are kindly invited to collect the following complementary items: EAU Pocket Guidelines The Pocket Guidelines - a booklet and CD including the EAU Guidelines can be collected at OLYMPUS booth C01. The distribution is supported by OLYMPUS. EAU members are kindly invited to the EAU booth H17 to collect the following complementary items: EAU Extended Guidelines The EAU Extended urological guidelines edition 2013, are distributed at the EAU Square. European Association of Urology Guidelines 2013 edition European Association of Urology Pocket Guidelines 2013 edition De Historia Urologiae Europaeae Vol. 20 This year marks the 20th edition of De Historia Urologiae Europaeae, the EAU History Office s annual edited volume of Europe s urological history. Beside the regular contributors from the History Office, newcomers tackle a broad range of fascinating topics. Congress delegates are kindly invited to collect the following complementary items: EAU Abstract CD 2013 A CD containing all presented abstracts during the 28th Annual EAU Congress can be collected at FERRING booth E42. Supported by an educational grant from FERRING PHARMACEUTICALS. ESU Courses CD 2013 A CD including all presentations and course materials of the ESU Courses given during the congress can be collected at MILLENIUM: The TAKEDA Oncology company, booth D30. Supported by an educational grant from MILLENIUM: The TAKEDA Oncology Company. EAU Poster DVD 2013 A DVD containing the majority of the posters presented during the 28th Annual EAU Congress. The EAU Poster DVD can be collected at AMGEN booth D20. Supported by an unrestricted educational grant from AMGEN. EUROPEAN UROLOGY EAU Posters th Annual EAU Congress EU-ACME accredited content SUPPLEMENTS Volume 12 Issue 1 March 2013 ESU Courses th Annual EAU Congress Abstracts 28th Annual EAU Congress

6 Awards EAU Award Winners EAU Willy Gregoir Medal 2013 For a significant contribution to the development of the urological specialty in Europe C-C. Abbou, Creteil, France EAU Frans Debruyne Life Time Achievement Award 2013 For a longstanding and important contribution to the activities and development of the EAU J. Breza, Bratislava, Slovakia EAU Crystal Matula Award 2013 For a young promising European urologist P. Boström, Turku, Finland Supported by an unrestricted educational grant from LABORIE EAU Hans Marberger Award 2013 For the best European paper published on Minimally Invasive Surgery (in Urology) J. Rassweiler, Heilbronn, Germany ipad-assisted Percutaneous Access to the Kidney Using Marker-Based Navigation: Initial Clinical Experience M. Müller, M. Fangerau, J. Klein, A. Goezen, P. Pereira, H-P. Meinzer, D. Teber (Heilbronn, Germany) European Urology (2012), doi /j.eururo Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG EAU Innovators in Urology Award 2013 For inventions and clinical contributions which have had a major impact on influencing the treatment and/or diagnosis of a urological disease U. Studer, Berne, Switzerland EAU Prostate Cancer Research Award 2013 For the best paper published on clinical or experimental studies in prostate cancer I. Ahmad, Glasgow, United Kingdom HER2 overcomes PTEN (loss) - induced senescence to cause aggressive prostate cancer R. Patel, L. Babloo Singh, C. Nixon, M. Seywright, R. Barnetson, V. Brunton, W. Muller, J. Edwards, O. Sansom, H. Leung (Glasgow, Edinburgh, United Kingdom; Montreal, Canada) PNAS September 27, 2011 vol. 108 no Supported by an unrestricted educational grant from the FRITZ H. SCHRÖDER FOUNDATION Prize for the Best Paper published on Fundamental Research in the Urological Literature E. Martens, S. Jalava, N. Dits, G. Van Leenders, S. Møller, J. Trapman, C. Bangma, T. Litman, T. Visakorpi, G. Jenster (Rotterdam, The Netherlands; Tampere, Finland; Vedbeak, Denmark) Diagnostic and prognostic signatures from the small non-coding RNA transcriptome in prostate cancer Oncogene (2012) 31, doi: /onc Prize for the Best Paper published on Clinical Research in the Urological Literature S. Shariat, M. Rink, B. Ehdaie, E. Xylinas, M. Babjuk, A. Merseburger, R. Svatek, E. Cha, S. Tagawa, H. Fajkovic, G. Novara, P. Karakiewicz, Q-D. Trinh, S. Daneshmand, Y. Lotan, W. Kassouf, H-M. Fritsche, F. Chun, G. Sonpavde, A. Joual, D. Scherr, M. Gonen (New York, San Antonio, Los Angeles, Dallas, Houston, United States of America; Hamburg, Hanover, Regensburg, Germany; Paris, France; Prague, Czech Republic; Padua, Italy; Montreal, Canada; Casablanca, Morocco) Pathologic Nodal Staging Score for Bladder Cancer: A Decision Tool for Adjuvant Therapy After Radical Cystectomy European Urology (2012) accepted June 5, doi: /j.eururo Prize for the Best Scientific Paper published in European Urology in 2012 R. Rosenblatt, A. Sherif, E. Rintala, R. Wahlqvist, A. Ullén, S. Nilsson, P-U. Malmström, The Nordic Urothelial Cancer Group (Katrineholm, Stockholm, Uppsala, Sweden; Helsinki, Finland; Oslo, Norway) Pathologic Downstaging Is a Surrogate Marker for Efficacy and Increased Survival Following Neoadjuvant Chemotherapy and Radical Cystectomy for Muscle-Invasive Urothelial Bladder Cancer European Urology, Volume 61, Issue 6, June 2012, Pages Supported by an unrestricted educational grant from ELSEVIER 6 Programme Book

7 Prize for the Best Scientific Paper published on Fundamental Research in European Urology by a young urologist (max. 35 years) in 2012 R. Kandimalla, A. Van Tilborg, L. Kompier, D. Stumpel, R. Stam, C. Bangma, E. Zwarthoff (Rotterdam, The Netherlands) Genome-wide Analysis of CpG Island Methylation in Bladder Cancer Identified TBX2, TBX3, GATA2, and ZIC4 as pta-specific Prognostic Markers European Urology, Volume 61, Issue 6, June 2012, Pages Supported by an unrestricted educational grant from ELSEVIER Awards Prize for the Best Scientific Paper published on Clinical Research in European Urology by a young urologist (max. 35 years) in 2012 M. Rink, B. Ehdaie, E. Cha, D. Green, P. Karakiewicz, M. Babjuk, V. Margulis, J. Raman, R. Svatek, H. Fajkovic, R. Lee, G. Novara, J. Hansen, S. Daneshmand, Y. Lotan, W. Kassouf, H-M. Fritsche, A. Pycha, M. Fisch, D. Scherr, S. Shariat (New York, Dallas, Hershey, San Antonio, Los Angeles, Houston, United States of America; Hamburg, Regensburg, Germany; Montreal, Canada; Prague, Czech Republic; St. Poelten, Austria; Padua, Bolzano, Italy) Stage-Specific Impact of Tumor Location on Oncologic Outcomes in Patients With Upper and Lower Tract Urothelial Carcinoma Following Radical Surgery European Urology, Volume 62, Issue 4, October 2012, Pages First Prize for the Best Abstract (Oncology) J. Moll, R. Van Soest, J. Kumagai, R. Graeser, I. Hickson, G. Jenster, W. Van Weerden (Rotterdam, The Netherlands; Beerse, Belgium) - Abstract 824 Abiraterone is able to block AR activation induced by accumulating levels of precursor hormones resulting from CYP17A1 inhibition Second Prize for the Best Abstract (Oncology) P. Sooriakumaran, L. Haendler, T. Nyberg, I. Heus, M. Olsson, S. Carlsson, M. Roobol, P. Wiklund (Stockholm, Sweden; Rotterdam, The Netherlands) - Abstract 912 Comparative oncologic effectiveness of radical prostatectomy and radiotherapy in prostate cancer: An analysis of mortality outcomes in 34,515 patients treated with up to 15 years follow-up Third Prize for the Best Abstract (Oncology) H. Uemura, T. Kimura, K. Yoshimura, T. Minami, M. Nozawa, T. Nakagawa, H. Fujimoto, S. Egawa, A. Yamada, K. Itoh (Osaka, Tokyo, Fukuoka, Japan) - Abstract 98 Combination therapy of peptide vaccines and dexamethasone for chemotherapy naïve castration resistant prostate cancer - a randomized phase-2 study First Prize for the Best Abstract (Non-Oncology) M. Lanz, C. Birchall, A. Ali, K. Walton, C.Townes, L. Lim, S. Roushias, P. Aldridge, R. Pickard, J. Hall (Newcastle Upon Tyne, United Kingdom) - Abstract 623 Bacterial motility and NF-κB activation by clinical isolates from urinary tract infections Second Prize for the Best Abstract (Non-Oncology) K. Filipski, K. Deckmann, T. Bschleipfer, G. Krasteva-Christ, T. Papadakis, A. Rafiq, M. Wolff, I. Ibanez-Tallon, B. Schütz, E. Weihe, W. Kummer (Giessen, Berlin, Marburg, Germany) - Abstract 62 A new cell in the urogenital tract - cholinergic chemosensory brush cells are sentinels of the urethra Third Prize for the Best Abstract (Non-Oncology) Y. Song, H. Lee, J. An, J. Yun, J. Kim, S. Doo, W. Yang, S. Kim (Seoul, South Korea) Abstract 325 Repair of erectile dysfunction using transplantation of human mesenchymal stem cells cultivated on the surface of nanofibrous meshes in rats with cavernous nerve injury The European Urology Platinum Award 2013 P-A. Abrahamsson, Malmö, Sweden W. Artibani, Verona, Italy J. Roelofswaard, Arnhem, The Netherlands M. Schlief, Arnhem, The Netherlands C. Schulman, Brussels, Belgium P. Teillac, Toulouse, France H. Van Poppel, Leuven, Belgium M. Wirth, Dresden, Germany EAU Milan

8 Awards EAU Award Winners First Prize for the Best Abstract by a resident G. Shaw, D. Lewis, J. Boren, A. Ramos-Montoya, D. Soloviev, R. Bielik, K. Brindle, D. Neal (Cambridge, United Kingdom) Abstract 833 Monitoring the effects of therapeutic fatty acid synthase inhibition in prostate canecr using 11C acetate PET Second Prize for the Best Abstract by a resident F. Castiglione, P. Hedlund, F. Van Der Aa, T. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium; Baltimore, United States of America) - Abstract 324 Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile function in a rat model of Peyronie s disease Third Prize for the Best Abstract by a resident A. Ingels, A. Thong, M. Saar, M. Valta, R. Nolley, J. Santos, H. Zhao, D. Peehl (Stanford, United States of America) Abstract 975 Pre-clinical trial of a new dual mtor inhibitor: INK128 for renal cell carcinoma Resident s Corner Award for the Best Scientific Paper published in European Urology by a resident (2 awards) T. Hambrock, C. Hoeks, C. Hulsbergen-Van de Kaa, T. Scheenen, J. Fütterer, S. Bouwense, I. Van Oort, F. Schröder, H. Huisman, J. Barentsz (Nijmegen, Rotterdam, The Netherlands) Prospective Assessment of Prostate Cancer Aggressiveness Using 3-T Diffusion-Weighted Magnetic Resonance Imaging Guided Biopsies Versus a Systematic 10-Core Transrectal Ultrasound Prostate Biopsy Cohort European Urology, Volume 61, Issue 1, January 2012, Pages E. Cha, L-A. Tirsar, C. Schwentner, P. Christos, C. Mian, J. Hennenlotter, T. Martini, A. Stenzl, A. Pycha, S. Shariat, B. Schmitz-Dräger (New York, United States of America; Nürnberg, Tübingen, Germany; Bolzano, Italy) Immunocytology Is a Strong Predictor of Bladder Cancer Presence in Patients With Painless Hematuria: A Multicentre Study European Urology, Volume 61, Issue 1, January 2012, Pages First video prize O. Ukimura, A. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Goh, M. Desai, M. Aron, I. Gill (Los Angeles, United States of America) - Video: V79 Novel surgical tile-pro navigation with 3D prostate cancer model during robot-assisted radical prostatectomy Second video prize A. Rao, R. Gray, H. Motiwala, M. Laniado, O. Karim (Wexham, United Kingdom) - Video: V78 Sequential occlusion angiography using contrast enhanced ultrasound scan (CEUS) demonstrating the avascular plane of Brodel: An adjunct to a novel technique of zero-ischaemia robot-assisted partial nephrectomy Third video prize S. Crouzet, Lyon, France - Video: V77 Alternative solution to current MIS robotic system EUSP Best Scholar Award L.F. Arenas Da Silva, Mullheim an der Ruhr, Germany Urethral Reconstruction using tissue Engineering Techniques The 28th Annual EAU Congress features an EAU Award Gallery. Here you can find a complete overview of all EAU Awards that will be handed out during the Congress. It will also list the past winners of the most prestigious urology prizes. The EAU Award Gallery provides a great opportunity to take in all the important developments and breakthroughs in recent years. It can be found on Level S2 (between euro Auditorium and the catering point), be sure to visit it! 8 Programme Book

9 Acknowledgement of Abstract reviewers The abstract sessions have been composed by and under the responsibility of the members of the EAU Scientific Congress Office & Video Committee (see page 425) who wish to acknowledge the following reviewers for their important contribution to the 28th Annual EAU Congress. Reviewers H. Abol-Enein, Mansoura (EG) L.M. Abranches Monteiro, Lisbon (PT) E. Akkus, Istanbul (TR) P.C. Albertsen, Farmington (US) K. Albrecht, Hanover (DE) G.J. Alivizatos, Athens (GR) F.E. Ameye, Ghent (BE) K.M. Anson, London (GB) A. Apostolidis, Thessaloniki (GR) M. Auprich, Graz (AT) A. Avelino, Porto (PT) A.R. Azzouzi, Angers (FR) M. Babjuk, Prague (CZ) J. Baniel, Petach Tikva (IL) G. Barbagli, Arezzo (IT) J. Barkin, Toronto (CA) R. Bauer, Munich (DE) J. Bedke, Tübingen (DE) D. Behr-Roussel, Orsay (FR) J. Bellmunt, Barcelona (ES) M. Bennamoun, Paris (FR) A. Bex, Amsterdam (NL) C. Bolenz, Mannheim (DE) T.A. Borkowski, Warsaw (PL) A. Bossi, Villejuif (FR) M. Brausi, Modena (IT) A. Breda, Barcelona (ES) M. Brehmer, Stockholm (SE) E.K. Bres-Niewada, Warsaw (PL) S.D. Brookman-May, Regensburg (DE) R.T. Bryan, Birmingham (GB) R.J. Bryant, Oxford (GB) V. Bucuras, Timisoara (RO) M. Burger, Würzburg (DE) F.J. Burgos Revilla, Madrid (ES) I. Cagiannos, Ottawa (CA) F. Calais Da Silva Junior, Lisbon (PT) U. Capitanio, Milan (IT) S.V.C. Carlsson, Gothenburg (SE) D.M. Castro-Diaz, Santa Cruz de Tenerife (ES) I.T.R. Cavarretta, Milan (IT) Y. Ceder, Malmö (SE) H.M. Çek, Istanbul (TR) A. Cestari, Milan (IT) M.B. Chancellor, Royal Oak (US) E. Chartier-Kastler, Paris (FR) A.B. Chkhotua, Tbilisi (GE) P. Chlosta, Cracow (PL) F.K-H. Chun, Hamburg (DE) L. Cindolo, Vasto-Chieti (IT) M. Colombel, Lyon (FR) C.B. Congregado Ruiz, Seville (ES) M.R. Cooperberg, San Francisco (US) J-N.L. Cornu, Paris (FR) C.S.R. Costa, Porto (PT) S. Crouzet, Lyon (FR) C.D. Cruz, Porto (PT) B. Cuzin, Lyon (FR) J-E. Damber, Gothenburg (SE) R. De Gier, Nijmegen (NL) J.M. De La Morena Gallego, Madrid (ES) C. De Nunzio, Rome (IT) T.M. De Reijke, Amsterdam (NL) M. De Santis, Vienna (AT) S.G.G. De Wachter, Antwerp (BE) A. Descazeaud, Limoges (FR) F. Desgrandchamps, Paris (FR) T. Diemer, Giessen (DE) J. Dobruch, Warsaw (PL) B. Dore, Poitiers (FR) T.A. Drewa, Bydgoszcz (PL) B.A. Dybowski, Warsaw (PL) L. Dyrskjøt, Århus (DK) C.L. Eaton, Sheffield (GB) A.W. El-Kassaby, Cairo (EG) T. Esen, Istanbul (TR) K. Everaert, Ghent (BE) R. Favaretto, Sao Paulo (BR) A. Feyaerts, Brussels (BE) A.J. Figueiredo, Coimbra (PT) M.M. Fisch, Hamburg (DE) M. Fröhner, Dresden (DE) F. Fusco, Naples (IT) S. Füssel, Dresden (DE) A. Galan, Alicante (ES) A. Galfano, Milan (IT) A. Gallina, Monza (IT) R. Ganzer, Regensburg (DE) E. García-Cruz, Barcelona (ES) P.A. Geavlete, Bucharest (RO) G. Giannarini, Berne (CH) M. Giessing, Düsseldorf (DE) V. Gomez Dos Santos, Madrid (ES) F. Gómez Veiga, A Coruna (ES) P. Gontero, Turin (IT) A. Govorov, Moscow (RU) EAU Milan

10 Reviewers Acknowledgement of Abstract reviewers M. Graefen, Hamburg (DE) C. Gratzke, Munich (DE) F. Greco, Leipzig (DE) I. Gruenwald, Haifa (IL) O.W. Hakenberg, Rostock (DE) T. Hanus, Prague (CZ) H. Hashim, Bristol (GB) K. Hatzimouratidis, Pefka (GR) S.A. Haukaas, Bergen (NO) A. Heidenreich, Aachen (DE) T.R.W. Herrmann, Hanover (DE) P. Hoffmann, Brussels (BE) M. Hohenfellner, Heidelberg (DE) S. Holmäng, Gothenburg (SE) W. Horninger, Innsbruck (AT) A. Hoznek, Creteil (FR) J. Huguet Pérez, Barcelona (ES) C. Imbimbo, Naples (IT) D. Jacqmin, Strasbourg (FR) G. Jenster, Rotterdam (NL) S.G. Joniau, Leuven (BE) V. Joulin, Brest (FR) K. Junker, Jena (DE) T.M. Kessler, Zurich (CH) M. Khodari, Nanterre (FR) E. Kiely, Cork (IE) T. Klatte, Vienna (AT) M. Knowles, Leeds (GB) E. Kocjancic, Chicago (US) Z. Kopa, Budapest (HU) G. Kramer, Vienna (AT) M.P. Laguna, Amsterdam (NL) S. Larré, Reims (FR) T.A. Leslie, Oxford (GB) H.Y. Leung, Glasgow (GB) H. Leyh, Garmisch-Partenkirchen (DE) E. Liatsikos, Patras (GR) J.E. Lingeman, Indianapolis (US) B. Ljungberg, Umeå (SE) E. Lledo García, Madrid (ES) C. Llorente, Madrid (ES) T. Loch, Flensburg (DE) N. Longo, Naples (IT) J.J. Lopez-Tello Garcia, Madrid (ES) Y. Lotan, Dallas (US) N. Lumen, Ghent (BE) S. Madersbacher, Vienna (AT) N. Malats, Madrid (ES) P-U. Malmström, Uppsala (SE) M. Margreiter, Vienna (AT) J.I. Martínez Salamanca, Madrid (ES) M.P. Matikainen, Helsinki (FI) J. Mattelaer, Kortrijk (BE) M. Matuszewski, Gdansk (PL) M. May, Regensburg (DE) S. McClinton, Aberdeen (GB) R. Medina López, Seville (ES) A.S. Merseburger, Hanover (DE) R. Miano, Rome (IT) S. Micic, Belgrade (RS) G. Mickisch, Bremen (DE) K. Miller, Berlin (DE) A. Minervini, Florence (IT) K. Monastyrskaya, Berne (CH) N. Mondaini, Florence (IT) N. Mottet, Saint Etienne (FR) A. Mottrie, Aalst (BE) A. Muneer, London (GB) M. Muntener, Zurich (CH) F.J. Murat, Lyon (FR) V.W. Nitti, New York (US) G. Novara, Padua (IT) P.J. Nyirády, Budapest (HU) S. Oehlschläger, Dresden (DE) M. Oelke, Hanover (DE) S. Oudard, Paris (FR) D. Oxley, Bristol (GB) P. Palma, Campinas (BR) J.I. Pascual Piedrola, Pamplona (ES) A. Patel, London (GB) H. Payne, London (GB) S. Perner, Bonn (DE) D. Pushkar, Moscow (RU) R. Rabenalt, Düsseldorf (DE) M. Ramirez Backhaus, Valencia (ES) J. Ramon, Tel Aviv (IL) J. Rassweiler, Heilbronn (DE) P. Rehder, Innsbruck (AT) I. Rehman, Sheffield (GB) Y. Reisman, Amstelveen (NL) M. Remzi, Vienna (AT) D. Rengifo Abbad, Madrid (ES) C.A. Rentsch, Basel (CH) M.J. Ribal, Barcelona (ES) J.P. Rioja Zuazu, Zaragoza (ES) P. Rocchi, Vancouver (CA) B. Rocco, Milan (IT) E.A. Rodrigues De Lima, Porto (PT) O. Rodriguez Faba, Barcelona (ES) I. Romics, Budapest (HU) M.J. Roobol, Rotterdam (NL) A. Rosales, Barcelona (ES) M. Roscigno, Bergamo (IT) M. Rouprêt, Paris (FR) 10 Programme Book

11 J. Rubio Briones, Valencia (ES) A. Ruffion, Pierre-Bénite (FR) R.E. Sanchez Salas, Paris (FR) M. Sanchez-Carbayo, Madrid (ES) F.R. Santer, Innsbruck (AT) T. Schlomm, Hamburg (DE) H-P. Schmid, St. Gallen (CH) J. Schmidbauer, Vienna (AT) A. Schröder, Toronto (CA) C. Schwentner, Tübingen (DE) F.P. Secin, Buenos Aires (AR) J. Seibold, Tübingen (DE) E. Serafetinides, Athens (GR) K-D. Sievert, Tübingen (DE) D.J. Smith, Sheffield (GB) E. Solsona, Valencia (ES) R. Sosnowski, Warsaw (PL) M. Spahn, Berne (CH) R.S. Stefanescu, Paris (FR) M. Stöckle, Homburg (DE) W.L. Strohmaier, Coburg (DE) M.E. Sullivan, Oxford (GB) T. Sulser, Zurich (CH) D.J. Summerton, Leicester (GB) A. Tasca, Vicenza (IT) P. Tenke, Budapest (HU) H.G. Tiselius, Stockholm (SE) A. Tubaro, Rome (IT) L.N. Türkeri, Istanbul (TR) D. Ulmert, New York (US) B. Uvelius, Malmö (SE) G. Van Koeveringe, Maastricht (NL) E. Van Laecke, Ghent (BE) G.J.L.H. Van Leenders, Rotterdam (NL) K.M.L. Van Renterghem, Hasselt (BE) B. Van Rhijn, Amsterdam (NL) M. Vandenbossche, Brussels (BE) F. Villacampa Auba, Madrid (ES) A. Villers, Lille (FR) A. Volpe, Turin (IT) A. Vuksanovic, Belgrade (RS) F.M.E. Wagenlehner, Giessen (DE) A. Wagg, Edmonton (CA) J. Walz, Marseille (FR) R.W.G. Watson, Dublin (IE) E. Wespes, Charleroi (BE) P. Whelan, Leeds (GB) T. Wiegel, Ulm (DE) D.N. Wood, London (GB) B. Wullt, Lund (SE) J.J. Wyndaele, Antwerp (BE) O. Yossepowitch, Petach Tikva (IL) S. Zastrow, Dresden (DE) P.C. Zehnder, Berne (CH) P. Zimmern, Dallas (US) Reviewers EAU Milan

12 Floorplan South Levels Prayer Room Platinum Hall S3 Duomo Rooms Amber Hall 3-4 Tower Room Amber Hall 1-2 EAU Award Gallery euro Auditorium Brown Brown SANOFI-HS3 Hall 3 Hall 1-2 Amber Hall 7-8 Amber Hall 6 TAKEDA-HS2 AMS-HS1 Amber Hall 5 EAU Video Library ASTELLAS Gold View Lounge COOK MEDICAL Panorama Lounge S2 Connection Level S2 - N2 First Aid Connection Level S0 - N1 Education & Innovation Booth ATM EAU Booth S1 Internet Corner 2 European Urology Booth Connection Level S0 - N0 Exhibition Hall Internet Corner 1 S0 Elevator to S2 ASTELLAS Gold View Lounge S3 COOK MEDICAL Panorama Lounge 12 Programme Book

13 North Levels Floorplan Silver Hall Connection Level S2 - N2 EAU Press Centre N2 Press Conference Room Regional Meetings: Best Posters Area Yellow Hall Blue Hall 1-2 Red Hall 2 Red Hall 1 Charge and Connect Area ATM Duomo Room 3 N1 Duomo Room 1 Connection Level S0 - N1 Duomo Room 2 Meeting Corner Speaker Service Centre Connection Level S0 - N0 Registration Presentation Training Duomo Centre Room 11 Duomo Room 12 Bank and Exchange EAU Information Desk MAIN ENTRANCE Taxi rank & shuttle busses to metro N0 Best Posters Upcoming Meetings Area Sponsored Sessions Promotion Area Turquoise Hall 1 Orange Hall 1 Duomo Rooms 7-10 Green Hall 1 Green Hall 2 Company busses & Car Park ESU Booth Green Hall 3 N1 Turquoise Hall 2 Duomo Room 4 Duomo Room 5 Duomo Room 6 Orange Hall 2 Orange Hall 3 EAU Milan

14 All sessions showing the webcast symbol will be available online. Register now at

15 Programme Friday, 15 March euro Auditorium Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Red Hall 1 Red Hall 2 Blue Hall 1-2 Yellow Hall Special Session International Conference on Prostate Cancer Prevention 2013 with Consensus Conference on Chemoprevention of Prostate Cancer Synopsis Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Chinese Urological Association (CUA) Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Korean Urological Association (KUA) Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Urological Society of India (USI) Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Iranian Urological Association (IUA) Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Arab Association of Urology (AAU) page 56 page 57 page 59 page 61 page Urology beyond Europe Urology beyond Europe Urology beyond Europe Urology beyond Europe Urology beyond Europe Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Japanese Urological Association (JUA) Joint Session of the European Association of Urology (EAU) and the Confederación Americana de Urología (CAU) EAU - International: Caucasus and Central Asia Session Joint Session of the European Association of Urology (EAU) and the Pan-African Urological Surgeons Association (PAUSA) Joint Session of the European Association of Urology (EAU) and the Maghreb Union Countries Joint Session of the European Association of Urology (EAU) and the Indonesian Urological Association (IUAI) page 65 page 67 page 68 page 69 page 70 page page Symposium Symposium Symposium Symposium Symposium Metastatic castrationresistant prostate cancer: Integrating new learnings to optimise treatment outcomes Urological challenges in managing patients with angiomyolipoma (AML) Extending survival outcomes in RCC and CRPC: Current evidence and future horizons Innovations in clinical urology New data in metastatic RCC: Applying the evidence to clinical practice SANOFI NOVARTIS ONCOLOGY BAYER HEALTHCARE OLYMPUS GLAXOSMITHKLINE ONCOLOGY page 401 page 399 page 397 page 400 page EAU Opening Ceremony page 72 EAU Milan

16 Synopsis Programme Saturday, 16 March, Morning euro Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall EAU General Assembly 8.00 page Plenary Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session 6 Urology: From young to old Introduction Update The management and long-term outcomes of vesicoureteral reflux Prostate cancer screening 1-12 Laparoscopy: Training, new technologies and techniques Male infertility: Basic science History of urology Urothelial cancer: Tumour biology and experimental therapies Neuro-urology: Basic research Update The long-term outcomes of genital surgery in boys Debate Pelvic floor implants: Artificial mesh or autologous fascia? State-of-the-art lecture Incontinence and age State-of-the-art page 78 page 80 page 82 page 84 page 85 page lecture Is ageing a disease? Residents Day - organised by the Young Urologists Office (YUO) in page 76 collaboration with the European Society of Residents in Urology (ESRU) Meeting of the EAU Section of Uro- Technology (ESUT) in cooperation with ERUS and EULIS What is new in endourology, laparoscopy and robotics COOK, INTUITIVE SURGICAL, IPSEN, KARL STORZ GMBH & CO.KG, NEOTRACT, OLYMPUS, QUANTA SYSTEM, ROCAMED Meeting of the EAU Section of Female and Functional Urology (ESFFU) and the EAU Section of Urological Imaging (ESUI) Imaging in female and functional urology Meeting of the EAU Section of Urolithiasis (EULIS) Urolithiasis - on our way to personalised management Joint Meeting of the the European Organisation for Research and Treatment of Cancer Genito-Urinary Cancer Group (EORTC GUCG), the EAU Section of Urological Research (ESUR), the EAU Section of Oncological Urology (ESOU) and the EAU Section of Uropathology (ESUP) Meeting of the EAU Section of Transplantation Urology (ESTU) Improving outcomes in kidney transplantation page 96 page 99 page 102 page 108 page 104 page Programme Book

17 Blue Hall 1-2 Yellow Hall Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 2 Amber Hall Synopsis Poster Session 7 Non-surgical treatment of advanced urothelial cancer Poster Session 8 Nephron sparing surgery and risk scoring systems HOT ESU/ESUT Handson training in Green light laser vaporisation; Technique and standard cases - Basic course HOT ESU/ESUT Hands-on training Endourology course page 89 page Meeting of the EAU Section of Genito-Urinary Reconstructive Surgeons (ESGURS) Urethral reconstruction and complication management after radical prostatectomy Meeting of the EAU Section of Infections in Urology (ESIU) and the EAU Section of Andrological Urology (ESAU) Urogenital infections and andrology AMERICAN MEDICAL SYSTEMS page HOT ESU/ESUT Handson training in Green light laser vaporisation; Technique and standard cases - Basic course 2 OLYMPUS EUROPA HOLDING GMBH page HOT ESU/ESUT Hands-on training Endourology course AMERICAN MEDICAL SYSTEMS OLYMPUS EUROPA HOLDING GMBH page 110 page 106 page 374 page 378 EAU Milan

18 Synopsis Programme Saturday, 16 March, Afternoon euro Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall 2 Blue Hall Meeting of the EAU Section of Uro-Technology (ESUT) in cooperation with ERUS and EULIS What is new in endourology, laparoscopy and robotics COOK, INTUITIVE SURGICAL, IPSEN, KARL STORZ GMBH & CO.KG, NEOTRACT, OLYMPUS, QUANTA SYSTEM, ROCAMED Meeting of the EAU Section of Female and Functional Urology (ESFFU) and the EAU Section of Urological Imaging (ESUI) Imaging in female and functional urology Meeting of the EAU Section of Urolithiasis (EULIS) Urolithiasis - on our way to personalised management Joint Meeting of the the European Organisation for Research and Treatment of Cancer Genito-Urinary Cancer Group (EORTC GUCG), the EAU Section of Urological Research (ESUR), the EAU Section of Oncological Urology (ESOU) and the EAU Section of Uropathology (ESUP) Meeting of the EAU Section of Transplantation Urology (ESTU) Improving outcomes in kidney transplantation Residents Day - organised by the Young Urologists Office (YUO) in collaboration with the European Society of Residents in Urology (ESRU) Meeting of the EAU Section of Genito-Urinary Reconstructive Surgeons (ESGURS) Urethral reconstruction and complication management after radical prostatectomy page 99 page 102 page 108 page 104 page Video Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session LESS & NOTES New therapies in castration resistant prostate cancer Pelvic organ prolapse: From bench to bedside Men s sexual health Diagnostics in early prostate cancer Bladder cancer: Gene expression and molecular classification Urological infection innovations V1-V page 113 page 114 page 116 page 117 page 119 page 121 page Video Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Improving minimally invasive radical prostatectomy V10-V17 Radical treatment of prostate cancer, beyond prostatectomy Renal tumours: Basic research in prognostic markers Men s sexual health: Testosterone and premature ejaculation Improving diagnosis in prostate cancer Bladder cancer demographics and biomarkers page 93 Cell based therapy in pelvic floor dysfunction page page 127 page 128 page 130 page 132 page 134 page 136 page Symposium Symposium Symposium Symposium Symposium Navigating the new landscape in CRPC Risk stratification to optimize the management of men with symptomatic BPH at risk of progression LUTS/BPH and sexual health - Bridging the gap Transurethral resection of bladder tumor: How to reach excellence Increasing evidence of effectiveness of GAG therapy in different forms of cystitis ASTELLAS page 402 GLAXOSMITHKLINE page 404 ELI LILLY AND COMPANY page 403 IPSEN page 406 IBSA INSTITUT BIOCHIMIQUE page Programme Book

19 Yellow Hall Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 2 Amber Hall 5 Amber Hall Meeting of the EAU Section of Infections in Urology (ESIU) and the EAU Section of Andrological Urology (ESAU) Urogenital infections and andrology page Urology in Italian art page HOT ESU/ESUT Handson training in Green light laser vaporisation; Technique and standard cases - Basic course 2 AMERICAN MEDICAL SYSTEMS page HOT ESU/ESUT Handson training in Green light laser vaporisation; Technique and standard cases - Basic course 3 AMERICAN MEDICAL SYSTEMS page HOT ESU/ESUT Hands-on training Endourology course 2 OLYMPUS EUROPA HOLDING GMBH page Synopsis Poster Session HOT Partial nephrectomy and surveillance: Surveys and comparisons ESU Course 1 Prostate cancer Screening, diagnosis and staging ESU Course 2 Advanced management of urethral stricture surgery ESU Course 3 Metastatic prostate cancer ESU Course 4 Retropubic radical prostatectomy Tips, tricks and pitfalls ESU Course 5 Office management of male sexual dysfunction ESU Course 6 Prolapse management and female pelvic floor problems ESU/ESUT Handson training in Green light laser vaporisation; Technique and standard cases - Basic course page 125 AMERICAN MEDICAL SYSTEMS page Poster Session Robot-assisted partial nephrectomy page 140 page 321 page 322 page 323 page 324 page 325 page Symposium Premature ejaculation treatment: New perspectives for the couple Workshop Holmium Life Enhancing Plan (HoLEP) - The real BPH lifetime solution MENARINI page 408 LUMENIS page EAU Milan

20 Synopsis Programme Sunday, 17 March, Morning euro Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall Plenary Session 2 Upper urinary tract Highlight session Introduction Update The dilemmas in diagnosing upper tract urothelial cancer : Debate How much surgery for upper tract urothelial cancer? EAU Guidelines Office case discussion Upper urinary tract tumours Société Internationale d Urologie (SIU) lecture The role of ESWL in upper urinary tract stones Update Interventional imaging in upper urinary tract stone disease: What s new? Video Session 3 Robot-assisted kidney surgery V18-V Poster Session 23 Prostate cancer: Active surveillance Poster Session 24 Bladder cancer: Pathology Poster Session 25 Prostate cancer: Surgery outcomes Poster Session 26 Treatment of neurogenic LUTD Poster Session 27 Stones: Basic research, imaging and training models Case discussion From above or below: Flexible, rigid or percutaneous management of upper urinary tract stones page 146 page 147 page 149 page 151 page 153 page Update Observation and deferred intervention in the management of stones page Thematic Session Small renal masses: To treat or not to treat? European Urology Session Surgery in Motion Thematic Session 1 EAU Guidelines Office: Recommendation updates Thematic Session 7 Management of surgical complications Thematic Session 4 Non-muscle invasive bladder cancer Thematic Session 8 Paediatric urology Thematic Session 5 Joint session with the European Society of Nuclear Medicine: Diagnostics and therapy of bone metastases in patients with advanced prostate cancer page 168 page 172 page 161 page 170 page 165 page 171 page Programme Book

21 Blue Hall 1-2 Yellow Hall Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall Synopsis ESU Course ESU Course ESU Course ESU Course ESU Course ESU Course Poster Session 28 Preclinical innovation - the future of erectile dysfunction treatment? Poster Session 29 Renal tumour diagnosis: From new techniques to follow-up Management of small renal tumours Renal transplantation: Technical aspects, diagnosis and management of early and late urological complications Advanced course on upper tract laparoscopy (UPJ, adrenal and stones) Advanced course on laparoscopic nephrectomy Painful bladder / chronic pelvic pain; In men and women Lower urinary tract dysfunction and urodynamics HOT ESU/ESUT Hands-on training Laparoscopy course HOT ESU/ERUS Hands-on training on Robotic surgery course HOT ESU/ESUT Hands-on training Laparoscopy course INTUITIVE SURGICAL OLYMPUS EUROPA HOLDING GMBH page 328 page 383 page page 157 page KARL STORZ GMBH & CO.KG and COOK MEDICAL page Thematic Session 3 From bench to bedside: What will be replacing PSA? Thematic Session 2 What are the limitations of minimally invasive surgery? page 327 page 329 page 331 page 333 page HOT ESU/ERUS Hands-on training on Robotic surgery course HOT ESU/ESUT Hands-on training Laparoscopy course HOT ESU/ESUT Hands-on training Laparoscopy course 2 page 164 page 163 KARL STORZ GMBH & CO.KG and COOK MEDICAL page 380 INTUITIVE SURGICAL page 384 OLYMPUS EUROPA HOLDING GMBH page EAU Milan

22 Synopsis Programme Sunday, 17 March, Afternoon euro Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall European Urology Session Surgery in Motion HOT ESU Hands-on training course on Urodynamics Video Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Challenging robotic surgery New methods in imaging and targeting prostate cancer Making the diagnosis of bladder cancer Kidney transplantation: Technique and outcome Advances in the treatment of penile cancer Nocturia, OAB, metabolic syndrome - towards a new management Paediatric hypospadias repair Stones: URS and imaging V26-V page Special Session page 174 3D Video and live narration - da Vinci partial nephrectomy with Firefly fluorescence imaging page 175 page 177 page 179 page 181 page 183 page 185 page Video Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session st century stone management How to optimise staging in prostate cancer? Bladder cancer: Imaging and resection Living donor nephrectomy and tumours on kidney transplanted patients News in prostate and bladder infections TURP and beyond Paediatric urology: What s new? Stones: ESWL and PCNL V33-V INTUITIVE SURGICAL page 173 MEDIWATCH page page 193 page 194 page 196 page 198 page 200 page 202 page 204 page Video Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Laparoscopic renal surgery Focal therapy in prostate cancer treatment Diagnostic imaging for bladder cancer Research in kidney transplant Urological infections New and old minimally invasive BPH therapies Paediatric urology developments Stones: ESWL, epidemiology and training V41-V page 212 page 213 page 215 page 217 page 219 page 221 page 223 page Symposium Symposium Symposium Symposium Workshop Symposium Symposium Symposium Management of OAB: Electing the right candidate for the right patient Silodosin: A first choice for the pharmacological treatment of BPH Towards individualisation of prostate cancer treatments: From bench to bedside Burden of illness and optimal management of recurrent cystitis Urinary incontinence - Optimising the patient experience and improving outcomes Focal therapy in localised prostate cancer Clinical conundrums in the treatment of metastatic castration-resistant prostate cancer BPH and inflammation, from lab to clinic ASTELLAS RECORDATI IPSEN OM PHARMA SA ALLERGAN and PORGÈS, a COLOPLAST division STEBA BIOTECH JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON PIERRE FABRE MEDICAMENT page 410 page 416 page 412 page 414 page 409 page 417 page 413 page Programme Book

23 Blue Hall 1-2 Yellow Hall Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall Poster Session 37 Exploring pharmacological targets in OAB Poster Session 38 Surgery for RCC and the adrenal gland ESU Course 13 Pathology (prostate, bladder/uut, kidney, testicles/ penis) ESU Course 14 Surgical management of locally advanced and metastatic renal cancer ESU Course 15 Laparoscopy for beginners ESU Course 16 Testicular cancer ESU Course 17 Management and outcome in invasive and locally advanced bladder cancer HOT ESU/ESUT Hands-on training Laparoscopy course HOT ESU/ERUS Hands-on training on Robotic surgery course 2 INTUITIVE SURGICAL HOT ESU/ESUT Hands-on training Laparoscopy course 2 OLYMPUS EUROPA HOLDING GMBH Synopsis page 384 page KARL STORZ GMBH & CO.KG and COOK MEDICAL page page 189 page page 335 page 337 page 338 page 339 page Poster Session 46 Uro-genital reconstruction and trauma Poster Session 47 Urothelial cancer: Transurethral surgery and intravesical recurrence ESU Course ESU Course ESU Course ESU Course ESU Course ESU Course HOT ESU/ESUT/ EULIS Hands-on training Ureterorenoscopy course page 208 page 210 Robot renal surgery How to write a manuscript and get it published in European Urology Advanced vaginal reconstruction Radical cystectomy and orthotopic bladder substitution Surgical tricks and management of complications Surgery or radiotherapy for localised and locally advanced prostate cancer Flexible ureterorenoscopy and retrograde intrarenal surgery: Instrumentation, technique, tips and tricks, indications KARL STORZ GMBH & CO.KG and COOK MEDICAL page Poster Session Poster Session From bench to bedside in pain and OAB Androgen deprivation therapy, still to improve page 227 page page 342 page 343 page 345 page 347 page 348 page Symposium Nocturia: Definitive diagnosis for better patient outcomes FERRING PHAR- MACEUTICALS page 411 EAU Milan

24 Synopsis Programme Monday, 18 March, Morning euro Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall Plenary Session 3 Lower urinary tract management: How to balance benefits with side-effects Highlight Session Video Session 7 Miscellaneous V49-V Introduction Update Pelvic floor anatomy for urologists Debate The role of urodynamic assessment in contemporary practice page American Urological Association (AUA) Lecture Cellular-based therapy of urinary incontinence Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Case discussion Sling, sphincter or balloon for male urinary incontinence Management of high risk prostate cancer Urothelial cancer treatment: Intravesical approaches Prostate cancer biopsies and pathology Update on SUI Current and new treatments of OAB and LUTS Urothelial cancer treatment: Predicting outcomes Renal tumours: Basic research on pathogenesis da Vinci Robotic Surgery Debate What the practising urologist needs to know about new therapies for LUTS. When, where and how do they work? Live surgery: da Vinci prostatectomy - The Martini Klinik Technique State-of-the-art lecture Is TURP the gold standard for benign prostatic obstruction? page 237 page 239 page 241 page 243 page 245 page 247 page 249 page Thematic Session Thematic Session Thematic Session Thematic Session Thematic Session Thematic Session 13 Andrology Management of pain in urology Urological surgery in renal transplant patients Systemic therapy in urological cancers A session by the European Society of Urogenital Radiology Prevention and treatment of urological infections INTUITIVE SURGICAL page 256 page 254 page 262 page 263 page 258 page 259 page Programme Book

25 Blue Hall 1-2 Yellow Hall Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall Synopsis ESU Course ESU Course ESU Course ESU Course ESU Course ESU Course The infertile couple - Urological aspects Update on stone disease Diagnosis and management of non-muscle invasive bladder cancer (NMIBC) Robot-assisted laparoscopic prostatectomy Minimally invasive treatment for localized prostate cancer Paediatric urology for the adult urologist: A practical update HOT HOT HOT Poster Session 64 OAB in women Poster Session 65 Urethral stricture management ESU/ESUT/ EULIS Hands-on training Ureterorenoscopy course 2 ESU/ERUS Hands-on training on Robotic surgery course 3 ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advance course KARL STORZ GMBH & CO.KG and COOK MEDICAL page 387 INTUITIVE SURGICAL page 394 AMERICAN MEDICAL SYSTEMS page page 251 page Thematic Session Thematic Session Neurourology Expert challenges the expert page 352 page 353 page 354 page 356 page 358 page HOT HOT HOT page 261 page 255 ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar TURP course 1 KARL STORZ GMBH & CO.KG and COOK MEDICAL ESU/ERUS Handson training on Robotic surgery course 4 INTUITIVE SURGICAL ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advance course 2 AMERICAN MEDICAL SYSTEMS page 392 page 395 page 389 EAU Milan

26 Synopsis Programme Monday, 18 March, Afternoon euro Auditorium Platinum Hall Brown Hall 1-2 Brown Hall 3 Amber Hall 1-2 Amber Hall 6 Amber Hall 7-8 Silver Hall Red Hall 1 Red Hall Video Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session Poster Session 72 Developments in cancer diagnosis and management Radical prostatectomy: New techniques Advanced urothelial cancer: Disease outcomes Evidence-based prostate cancer therapies in cellular and animal models Male infertility: Clinical issues Prostate cancer: Biomarkers Complex urological reconstructions and tissue engineering How to reduce warm ischemia in partial nephrectomy V57-V page 264 page 265 page 267 page 269 page 271 page 272 page 274 page Video Session Challenging reconstructive surgery da Vinci Robotic Surgery Live surgery: da Vinci prostatectomy - Early neurovascular bundles release Poster Session 75 Surgical approaches for prostate cancer Poster Session 76 Radical surgery for bladder cancer: Patient outcomes Poster Session 77 Prostate cancer cell biology and signaling European Urological Scholarship Programme (EUSP) Session Poster Session 78 Nephrectomy for RCC: Minimally invasive techniques, renal function, lymph node dissection and prognostic factors Poster Session 79 Stones: PCNL Poster Session 80 Renal tumours: Drug related basic research V65-V page 282 page 283 page 285 page 287 page 289 page 291 page Video Session 10 Highlights & awards V73-V79 INTUITIVE SURGICAL page Poster Session 83 Prostate cancer treatment: Comorbidities and complications Poster Session 84 Radical surgery for bladder cancer: Technical aspects Poster Session 85 Prostate cancer biomarkers and outcome prediction Poster Session 86 Evolving concepts in testicular cancer Poster Session 87 Stones: URS and stents Poster Session 88 History of urology page page 300 page 301 page 303 page 305 page 307 page 309 page Workshop Urinary incontinence - Optimising the patient experience and improving outcomes Symposium Interactive debate: How seriously should I take male LUTS? Symposium Castrationresistant prostate cancer in 2013: Analysing the good, the bad and the ugly ALLERGAN and PORGÈS, a COLOPLAST division page 418 ASTELLAS page 419 PRIME ONCOLOGY page Programme Book

27 Blue Hall 1-2 Yellow Hall Green Hall 1 Green Hall 2 Green Hall 3 Orange Hall 1 Orange Hall 2 Orange Hall 3 Turquoise 1 Turquoise 2 Amber Hall Poster Session 73 What is new in female urology Poster Session 74 BPH: Genes, biomarkers and beyond ESU Course 31 Current concepts and controversy in the diagnosis and management of upper tract urothelial carcinoma (UTUC) ESU Course 32 Advanced course on laparoscopic prostatectomy ESU Course 33 Modern management of BPH ESU Course 34 Urinary tract and genital trauma ESU Course 35 Ultrasound for the urologist - TRUS and TRUS guided biopsies ESU Course 36 Laparoscopic and robotassisted laparoscopic radical cystectomy HOT ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar TURP course 1 KARL STORZ GMBH & CO.KG and COOK MEDICAL page HOT ESU/ERUS Hands-on training on Robotic surgery course 4 INTUITIVE SURGICAL page HOT ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advance course 2 AMERICAN MEDICAL SYSTEMS page Synopsis HOT HOT ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar TURP course 2 ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advance course page 278 page 280 KARL STORZ GMBH & CO.KG and COOK MEDICAL page 361 page 363 page 366 page Poster Session 81 How to diagnose LUTS, BPH and obstruction? Poster Session 82 Male incontinence: Prediction and management ESU Course ESU Course ESU Course ESU Course 40 page 393 AMERICAN MEDICAL SYSTEMS page Post-surgical urinary incontinence in males General neurourology page 365 Percutaneous nephrolithotripsy (PCNL) Single port NOTES and minilaparoscopy: Is this the way to go? page HOT page Poster Session 89 Pharmacotherapy of male LUTS page Poster Session 90 Medical treatment of RCC page 369 page 370 ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advance course 4 AMERICAN MEDICAL SYSTEMS page page 312 page page 371 page Symposium New data on androgen deprivation with a GnRH antagonist: Improving patient outcomes in prostate cancer FERRING PHAR- MACEUTICALS page EAU Milan

28 Synopsis Programme Tuesday, 19 March euro Auditorium Plenary Session 4 Souvenir sessions/hot topics in prostate cancer Souvenir session by the EAU Scientific Congress Office EAU policy on live surgery Introduction to the plenary session Update New urological weapons in the treatment of CRPC Late breaking news I State-of-the-art lecture Is there a role for intermittent androgen deprivation? Debate High risk PC: Surgery vs radiation vs systemic therapy Late breaking news II Debate Why focal therapy instead of active surveillance for low risk prostate cancer Report on the Consensus Statement for Prostate Cancer Prevention Update European PSA screening Closing remarks page Programme Book

29 EAUN Programme Overview, March March Saturday 17 March Sunday 18 March Monday Room Amber Hall Level S2 Tower Room - Level S2 Amber Hall Level S2 Tower Room - Level S2 Amber Hall Level S2 Tower Room - Level S EAUN Workshop Writing evidence-based guidelines Break EAUN Workshop Bladder instillation for interstitial cystitis and radiation cystitis Break EAU-ESU Course - 1 Prostate diseases and treatments Part I Break EAU-ESU Course - 1 Prostate diseases and treatments Part II EAUN Opening EAUN Workshop Intermittent catheterisation and dilatation Break AIURO Lecture Urological nursing in Italy: The national association, clinical research and education in the European context EAUN Lecture Who takes care of the caretakers EAUN Workshop Nursing solutions in difficult cases & Case discussions Break Poster viewing Poster Abstract Session 1 EAUN State-of-the-art lecture Health economics Break Symposium CIC experience- making dreams a reality WELLSPECT HEALTHCARE Welcome reception Sponsored by WELLSPECT HEALTHCARE Location: In front of Amber Hall 7-8 EAUN Workshop Market place session: Embarrassing issues in urology. Everything you always wanted to know, but were afraid to ask Break Panel discussion Bladder cancer Debate Prostate cancer screening Break EAUN State-of-the-art lecture Nutritional aspects of preoperative interventions EAUN Workshop Alternative approaches for the improvement of daily life in urological patients Break EAUN Session EAUN Nursing Research Competition EAUN State-of-the-art lecture The gender aspect EAUN Lecture The online diary as a communication tool for patients and nurses Break EAUN State-of-the-art lecture Penile carcinoma ESU-EAUN Cystoscopy Workshop ESU Course - 2 Bladder diseases and treatments Part I Break ESU Course - 2 Bladder diseases and treatments Part II Break EAUN State-of-the-art lecture Palliative care in urology EAUN State-of-the-art lecture Transition from paediatric to adult urology EAUN General Assembly Break EAUN State-of-the-art lecture Brachytherapy in urological cancer EAUN State-of-the-art lecture Urological disorders that challenge the surgeon Break Break Break Award Session Panel discussion Bladder dysfunction: Overactive bladder syndrome, nocturia and pelvic floor issues EAUN State-of-the-art lecture Complimentary medicine in oncology Break EAUN Round table discussion Meeting the challenges of cancer related bone health Supported with an educational grant by AMGEN Poster viewing Poster Abstract Session 2 Break Workshop Safety in urinary catheterization EAUN Session Inside the body - surgery in motion (videos) Synopsis B. BRAUN Urowalk Nurses dinner EAU Milan

30 CIG SMU OCEANA ISTEM MEDIKAL CUA CANADA INTERNET CORNER 1 GALIL MEDICAL CUA CHINA PHYSION HEALUX MEDICA MENARINI ESSM TERUMO WFIP NEXUS OPKO EUROPA UOMO RUDOLF MEDICAL MEDKONSULT AUA THERA- COAT ASCLEPION ERBE ELEKTROMEDIZIN BAYER HEALTHCARE BECKMAN COULTER ELMED SILIMED MCUBE TIME RESEARCH ERASMUS HOLOGIC GEN-PROBE ANGIO- DYNAMICS LISA LASER MEDAC SIU AYMED ENDOCONTROL TRUMPF DENDREON KLS MARTIN GROUP NOVARTIS MEDA MEDCOM ROTTAPHARM MADAUS MEDISPEC LAMIDEY NOURY PROMEPLA (ROCAMED) LABORIE COOK MEDICAL M.A.S. DIREX RECORDATI CRYOLIFE LIMMER LASER CONMED/ VIKING SCOMEDICA OLYMPUS ENTRANCE/EXIT EXHIBITION NORTH LEVELS EXHIBITION HAL HITACHI MEDICAL SYSTEMS EUROPE / HITACHI ALOKA WISEPRESS MMS EUROPEAN UROLOGY RICHARD WOLF ASTELLAS ASTELLAS UROTECH & UROVISION EDAP TMS SHENZHEN HUIKANG SIEMENS SONY OM PHARMA IPSEN MILLENNIUM: THE TAKEDA TELEFLEX ONCOLOGY COMPANY AMGEN GLAXOSMITHKLINE ZEPHYR MEL ANDRO- MEDA MEDI- WATCH ISMH PAJUNK CL MEDICAL COLOPLAST - PORGÈS FERRING INTUITIVE SURGICAL PFIZER AMERICAN MEDICAL SYSTEMS ASPIDE MÉDICAL ALLERGAN INTERNET CORNER 2 BN IMMUNO THERAPEUTICS QUANTA SYSTEM BOSTON SCIENTIFIC CATERING EAU BOOTH: EAU MEMBERSHIP HISTORICAL EXHIBITION RESEARCH FOUNDATION EAU STOCKHOLM 2014 EBU YOUNG UROLOGISTS / RESIDENTS CORNER STARMEDTEC TRIBUTE KITALPHA A.M.I. IBSA KOELIS PROMEDON DEXTÉRITÉ SONACARE ELSEVIER CARESONO JANSSEN PHARMA- CEUTICALS BK MEDICAL EIGEN KARL STORZ FOTONA PIERRE FABRE MÉDICAMENT APOGEPHA UROTISS EIGEN STORZ MEDICAL JANSSEN PHARMACEUTICALS B. BRAUN AESCULAP ALLIUM TAEWOONG MEDICAL BARD LUMENIS EMD ELI LILLY AND COMPANY BIOLITEC INFORMA EMS WELLSPECT HEALTHCARE HISTOSCANNING BY AMD NAMED HC ITALY LENUS PHARMA TRISTEL UROMED MEDTRONIC DORNIER MEDTECH EUROPE SMOKING AREA SIU ITALIA CURAN LUT T-DOC MYRIAD NEOTRACT INTEGRA SPHINX VISION SCIENCES NEOMEDIC Exhibition WFIP EUROPA UOMO ANGIO- DYNAMICS M.A.S. BJ CIG SMU ANATOMY FOR UROLOGY THERA- COAT SILIMED HANGZHOU HAWK LISA LASER MEDAC MEDA MEDCOM PROMEPLA (ROCAMED) LABORIE CRYOLIFE LIMMER LASER HITACHI MEDICAL SYSTEMS EUROPE / HITACHI ALOKA OCEANA MENARINI CONMED/ VIKING WISEP ASCLEPION MCUBE ERBE ELEKTROMEDIZIN SIU AYMED ROTTAPHARM MADAUS SCOMEDICA DIREX MMS PHYSION HEALUX ESSM RUDOLF MEDICAL NEXUS BAYER HEALTHCARE TIME RESEARCH ERASMUS ENDOCONTROL TRUMPF DENDREON MEDISPEC RECORDATI INTERNET CORNER 1 HOLOGIC GEN-PROBE LAMIDEY NOURY ISTEM MEDIKAL A GALIL MEDICAL MEDICA MEDKONSULT OPKO BECKMAN COULTER KLS MARTIN GROUP B COOK MEDICAL C CUA CANADA CUA CHINA TERUMO AUA ELMED NOVARTIS OLYMPUS EXHIBITION HALL - SOUTH LEVEL S0 A TO OTHER TO OTHER LEVELS LEVELS B C D E F G H ENTRANCE/EXIT EXHIBITION NORTH LEVELS 30 Programme Book

31 Exhibition UROTECH & UROVISION SHENZHEN HUIKANG SONY TELEFLEX BJUI/WILEY-BLACKWELL MEDI- WATCH HITACHI MEDICAL SYSTEMS EUROPE / HITACHI ALOKA RICHARD WOLF SIEMENS OM PHARMA ZEPHYR ISMH MEL PAJUNK WISEPRESS TO OTHER LEVELS IPSEN MMS EDAP TMS MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY ASTELLAS AMGEN C D E ASTELLAS GLAXOSMITHKLINE EUROPEAN UROLOGY STARMEDTEC TRIBUTE KITALPHA ENTRANCE/EXIT EXHIBITION NORTH LEVELS EAU Milan

32 CIG SMU OCEANA ISTEM MEDIKAL CUA CANADA INTERNET CORNER 1 GALIL MEDICAL CUA CHINA PHYSION HEALUX MEDICA MENARINI ESSM TERUMO WFIP NEXUS OPKO EUROPA UOMO RUDOLF MEDICAL MEDKONSULT AUA THERA- COAT ASCLEPION ERBE ELEKTROMEDIZIN BAYER HEALTHCARE BECKMAN COULTER ELMED SILIMED MCUBE TIME RESEARCH ERASMUS HOLOGIC GEN-PROBE ANGIO- DYNAMICS LISA LASER MEDAC SIU AYMED ENDOCONTROL TRUMPF DENDREON KLS MARTIN GROUP NOVARTIS MEDA MEDCOM ROTTAPHARM MADAUS MEDISPEC LAMIDEY NOURY PROMEPLA (ROCAMED) LABORIE COOK MEDICAL M.A.S. DIREX RECORDATI CRYOLIFE LIMMER LASER CONMED/ VIKING SCOMEDICA OLYMPUS HITACHI MEDICAL SYSTEMS EUROPE / HITACHI ALOKA ENTRANCE/EXIT EXHIBITION NORTH LEVELS WISEPRESS MMS EUROPEAN UROLOGY RICHARD WOLF ASTELLAS ASTELLAS UROTECH & UROVISION EDAP TMS SHENZHEN HUIKANG SIEMENS SONY OM PHARMA IPSEN MILLENNIUM: THE TAKEDA TELEFLEX ONCOLOGY COMPANY AMGEN GLAXOSMITHKLINE ZEPHYR MEL ANDRO- MEDA MEDI- WATCH ISMH PAJUNK CL MEDICAL COLOPLAST - PORGÈS FERRING INTUITIVE SURGICAL PFIZER AMERICAN MEDICAL SYSTEMS ASPIDE MÉDICAL ALLERGAN INTERNET CORNER 2 BN IMMUNO THERAPEUTICS QUANTA SYSTEM BOSTON SCIENTIFIC CATERING EAU BOOTH: EAU MEMBERSHIP HISTORICAL EXHIBITION RESEARCH FOUNDATION EAU STOCKHOLM 2014 EBU YOUNG UROLOGISTS / RESIDENTS CORNER STARMEDTEC TRIBUTE KITALPHA A.M.I. IBSA KOELIS PROMEDON DEXTÉRITÉ SONACARE ELSEVIER CARESONO JANSSEN PHARMA- CEUTICALS BK MEDICAL EIGEN KARL STORZ FOTONA PIERRE FABRE MÉDICAMENT APOGEPHA UROTISS EIGEN STORZ MEDICAL JANSSEN PHARMACEUTICALS B. BRAUN AESCULAP ALLIUM TAEWOONG MEDICAL BARD LUMENIS EMD ELI LILLY AND COMPANY BIOLITEC INFORMA EMS WELLSPECT HEALTHCARE HISTOSCANNING BY AMD NAMED HC ITALY LENUS PHARMA TRISTEL UROMED MEDTRONIC DORNIER MEDTECH EUROPE SMOKING AREA SIU ITALIA CURAN LUT T-DOC MYRIAD NEOTRACT INTEGRA SPHINX VISION SCIENCES NEOMEDIC Exhibition CL MEDICAL ASPIDE MÉDICAL COLOPLAST - PORGÈS ALLERGAN FERRING INTUITIVE SURGICAL PFIZER E AMERICAN MEDICAL SYSTEMS EXHIBITION HALL - SOUTH LEVEL S0 A.M.I. IBSA TO OTHER LEVELS TO OTHER LEVELS A B C D E F G H 32 Programme Book

33 VEL S0 Exhibition ASPIDE MÉDICAL INTERNET CORNER 2 SIU ITALIA BN IMMUNO THERAPEUTICS FOTONA APOGEPHA B. BRAUN AESCULAP CATERING ALLERGAN BK MEDICAL UROTISS CURAN TO OTHER LEVELS EIGEN EIGEN ALLIUM TAEWOONG MEDICAL EMD BIOLITEC INFORMA NAMED EMS LENUS PHARMA HC ITALY TRISTEL LUT ANDRO- MEDA PIERRE FABRE MÉDICAMENT BARD WELLSPECT HEALTHCARE HISTOSCANNING BY AMD UROMED MEDTRONIC T-DOC MYRIAD ICAL KARL STORZ STORZ MEDICAL EAU BOOTH: QUANTA SYSTEM BOSTON SCIENTIFIC LUMENIS EAU MEMBERSHIP HISTORICAL EXHIBITION RESEARCH FOUNDATION EAU STOCKHOLM 2014 EBU YOUNG UROLOGISTS / RESIDENTS CORNER NEOTRACT INTEGRA SPHINX F G H ELMEDICAL SYSTEMS JANSSEN PHARMA- CEUTICALS JANSSEN PHARMACEUTICALS ELI LILLY AND COMPANY DORNIER MEDTECH EUROPE VISION SCIENCES NEOMEDIC IBSA KOELIS PROMEDON DEXTÉRITÉ SONACARE ELSEVIER CARESONO SMOKING AREA EAU Milan

34 Exhibitors Alphabetical list of Exhibitors Please note that this list and the floor plans on the previous pages will not be comprehensive due to the printing date of this programme book (list and floor plans are updated through 30 January 2013). EXHIBITOR BOOTH NR. A A.M.I. GMBH E02 ALLERGAN F31 ALLIUM LTD G48 AMERICAN MEDICAL SYSTEMS, INC E06 AMERICAN UROLOGICAL ASSOCIATION (AUA)...A06 AMGEN (EUROPE) GMBH...D20 ANATOMY FOR UROLOGY - PRIMAL PICTURES LTD...B59 ANDROMEDA MEDIZINISCHE SYSTEME GMBH H26 ANGIODYNAMICS...B65 APOGEPHA ARZNEIMITTEL GMBH...G35 ASCLEPION LASER TECHNOLOGIES B47 ASPIDE MÉDICAL...F47 ASTELLAS PHARMA EUROPE LTD.... C04 & C20 AYMED MEDICAL TECHNOLOGY B41 B B. BRAUN AESCULAP G50 BARD LTD G34 BAYER HEALTHCARE B31 BECKMAN COULTER, INC....B09 BIOLITEC BIOMEDICAL TECHNOLOGY GMBH...H47 BJUI / WILEY-BLACKWELL C72 BK MEDICAL F38 BN IMMUNOTHERAPEUTICS...F44 BOSTON SCIENTIFIC...G11 C CANADIAN UROLOGICAL ASSOCIATION (CUA CANADA)...A00 CARESONO TECHNOLOGY CO., LTD H01 CHINESE UROLOGICAL ASSOCIATION (CUA CHINA)...A02 CL MEDICAL...E70 COCHRANE INCONTINENCE REVIEW GROUP (CIG) A07 COLOPLAST - PORGÈS E54 CONMED / VIKING...C25 COOK MEDICAL B02 CRYOLIFE EUROPA, LTD C35 CURAN MEDICAL BV H32 D DENDREON CORPORATION B25 DEXTÉRITÉ SURGICAL...G01 DIREX GMBH C21 DORNIER MEDTECH EUROPE GMBH...H05 34 Programme Book

35 E EAU BOOTH...H17 EAU HISTORICAL EXHIBITION H17 EAU STOCKHOLM H17 EAU RESEARCH FOUNDATION...H17 EDAP TMS...D41 EIGEN G31 ELI LILLY AND COMPANY...G06 ELMED LITHOTRIPSY SYSTEMS B05 ELMEDICAL LTD...H10 ELSEVIER...H03 EMD MEDICAL G44 EMS ELECTRO MEDICAL SYSTEMS H45 ENDOCONTROL...B33 ERASMUS S.A....B27 ERBE ELEKTROMEDIZIN GMBH B45 ESSM A32 EUROPA UOMO...A50 EUROPEAN BOARD OF UROLOGY H17 EUROPEAN UROLOGY...C02 Exhibitors F FERRING INTERNATIONAL CENTER S.A....E42 FOTONA B.B F48 G GALIL MEDICAL...A14 GLAXOSMITHKLINE...D06 H HANGZHOU HAWK OPTICAL ELECTRONIC INSTRUMENTS CO., LTD....B55 HC ITALY...H41 HEALUX A24 HISTOSCANNING BY AMD H29 HITACHI MEDICAL SYSTEMS EUROPE / HITACHI ALOKA C48 HOLOGIC GEN-PROBE...B17 I IBSA INSTITUT BIOCHIMIQUE SA F01 INFORMA HEALTHCARE...H49 INTEGRA H14 INTERNET CORNERS A22 & F54 INTUITIVE SURGICAL...E30 IPSEN...D42 ISMH (INTERNATIONAL SOCIETY OF MEN S HEALTH) E43 ISTEM MEDIKAL A01 J JANSSEN PHARMACEUTICALS...F06 & G05 EAU Milan

36 Exhibitors Alphabetical list of Exhibitors K KARL STORZ GMBH & CO. KG F26 KITALPHA MED LTD... E01 KLS MARTIN GROUP B11 KOELIS...F02 L LABORIE B28 LAMIDEY NOURY MEDICAL B10 LENUS PHARMA GESMBH...H53 LIMMER LASER GMBH...C29 LISA LASER PRODUCTS B63 LUMENIS DEUTSCHLAND GMBH G18 LUT GMBH H30 M M.A.S.... C37 MCUBE TECHNOLOGY...B49 MEDA CO., LTD...B32 MEDAC GMBH B53 MEDCOM GMBH...B26 MEDICA S.P.A A12 MEDICAL MEASUREMENT SYSTEMS B.V....C40 MEDISPEC LTD B12 MEDIWATCH PLC E47 MEDKONSULT...A16 MEDTRONIC INTERNATIONAL TRADING SÀRL H25 MENARINI A44 MEXICAN SOCIETY OF UROLOGY (SMU)...A05 MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY D30 MYRIAD GENETICS H18 N NAMED S.P.A....H51 NEOMEDIC INTERNATIONAL S.L....H02 NEOTRACT, INC H16 NEXUS S.R.L A28 NOVARTIS B01 O OCEANA THERAPEUTICS...A03 OLYMPUS MEDICAL SYSTEMS EUROPA GMBH C01 OM PHARMA SA...D64 OPKO DIAGNOSTICS...A10 P PAJUNK GMBH...E37 PFIZER INTERNATIONAL OPERATIONS...E22 PHYSION A34 PIERRE FABRE MÉDICAMENT F30 PROMEDON S.A....G03 PROMEPLA (ROCAMED) B30 36 Programme Book

37 Q QUANTA SYSTEM SPA... F22 Exhibitors R RECORDATI...C09 RICHARD WOLF GMBH...D51 ROTTAPHARM MADAUS...B22 RUDOLF MEDICAL GMBH + CO. KG A30 S SCOMEDICA...C23 SHENZHEN HUIKANG MEDICAL APPARATUS CO., LTD....D70 SIEMENS AG HEALTHCARE SECTOR...D54 SILIMED INDUSTRIA DE IMPLANTES LTDA B61 SIU SOCIETÀ ITALIANA DI UROLOGIA H36 SOCIÉTÉ INTERNATIONALE D UROLOGIE (SIU)...B51 SONACARE G02 SONY EUROPE LIMITED...D72 SPHINX MEDICAL LTD H12 STARMEDTEC GMBH D02 STORZ MEDICAL AG...F26 SYNERGO-MEDICAL ENTERPRISES...E39 T T-DOC COMPANY, LLC H24 TAEWOONG MEDICAL, CO. LTD...G42 TELEFLEX...D74 TERUMO EUROPE N.V A04 THERACOAT B57 TIME RESEARCH LIMITED...B29 TRIBUTE...E03 TRISTEL SOLUTIONS...H39 TRUMPF...B33 U UROMED KURT DREWS KG H35 UROTECH GMBH & UROVISION GMBH D61 UROTISS GMBH...G35 V VISION-SCIENCES, INC H06 W WELLSPECT HEALTHCARE...H33 WISEPRESS ONLINE BOOKSHOP C42 WORLD FEDERATION OF INCONTINENT PATIENTS - WFIP...A48 Y YOUNG UROLOGISTS / RESIDENTS CORNER H17 Z ZEPHYR SURGICAL IMPLANTS...E41 EAU Milan

38

39 General information Abstracts More than abstracts have been accepted for presentation during poster and video sessions in Milan. The EAU Abstract CD 2013 will be distributed to all congress delegates by FERRING PHARMACEUTICALS (booth E42 in the exhibition on level S0). The EAU Poster DVD 2013 will be distributed to all congress delegates by AMGEN (booth D20 in the exhibition on level S0). All abstracts and PDFs of the posters are available online at Abstracts are also available through the congress App. The EAU Poster DVD 2013 is supported by an unrestricted educational grant from AMGEN The EAU Abstract CD 2013 is supported by an educational grant from FERRING PHARMACEUTICALS Access to the Session Rooms Seating is regulated on a first-come, first-served basis. We recommend delegates to go to the session room well in advance of the session. Due to safety regulations, the organisers will close the session room when all seats are taken. It is not allowed for delegates to stand in the aisles of the rooms. Ride car parks located close to the following Metro stops: Cascina Gobba (Green Line), San Donato (Yellow Line), Famagosta (Green Line), Bisceglie (Red Line), Lampugnano (Red Line) Airport Shuttle Bus From Milan Central Station (Stazione Centrale = Garibaldi Station) a shuttle bus goes directly to Linate (+/- 25 minutes) and Malpensa airport (+/- 60 minutes). Malpensa The Malpensa shuttle bus operates between and from Milan Central Station. The tickets cost 10 and can be purchased on board. The Malpensa shuttle bus to the airport departs every 20 minutes. The closest bus stop from the congress venue is at Viale Teodorico. Linate The Linate shuttle bus operates between until from Milan Central Station. The tickets cost 5 and can be purchased on board. The bus to Milan Linate airport departs every 30 minutes. General Address and Accessibility Congress Centre The MiCo Milano Congressi can be well reached by public transport. The public transport system is easy to use and a very efficient way to get around the city. Congress delegates may collect a complimentary transportation pass in the registration area on level N0. See also Transportation Pass. Address congress centre: MiCo - Milano Congressi Via Gattamelata 5 (Gate 14) 20149, Milan, Italy T: F: By metro: The nearest metro station is Amendola. From there complimentary shuttle busses (see also Shuttle Bus ) will bring participants to the main entrance of the congress venue. By car: From the ring roads circling Milan, follow the signs to Fieramilanocity. There is a car parking onsite (accessible through gate 17) or there are large Park & App - Your smart congress companion The Congress App will bring the 28th Annual EAU Congress to your smartphone. The application offers the best mobile overview of this scientific event with instant access to congress abstracts, exhibition booth locations and the latest news from before, during and after the meeting! This year you will find a whole new set of features and you won t need constant internet access to navigate the information. Please, check under EAU 2013 in your App Store or Android market to get your smart congress companion. Award Gallery At the EAU Award Gallery you will find a complete overview of all awards that were handed out by the European Association of Urology this year (see page 6-8 for an overview of the award winners). It also features information on past winners of the most prestigious EAU prizes. The EAU Award Gallery provides a great opportunity to take in all the important developments and breakthroughs in recent years. It can be found on level S2 between the euro Auditorium and the catering point, be sure to visit it! EAU Milan

40 General information General Badge Tracking System Congress delegates have a barcode on their badge which enables them to leave their contact details with exhibitors in a quick and easy way. The barcode will also be scanned at the entrance of the session rooms to gather CME and statistic information. Badges The badge classification is as follows: Blue badge : EAU member White badge : Delegate Brown badge : Nurse Green badge : Exhibitor Red badge : Press Purple badge : Accompanying person Yellow badge : Organising staff Bank, Exchange and Credit Cards The national currency in Italy is the Euro ( ). Two ATM machines are available at the MiCo; one in the North wing on level N1 and one on in the South wing on level S1 on the balcony in the exhibition. A bank including an exchange office is available in the congress venue on level N0 near the entrance to the registration area. There are also banks near the congress centre, please go to the EAU Information Desk on level N0 for detailed information. Best Posters The Best Posters wall features the best scientific posters of the Milan Congress. This high-tech plasma wall is accessible during congress hours on level N0. The best posters can also be viewed through the congress website during and after the congress. Certificate of Attendance A Certificate of Attendance for the Milan Congress can be printed online at as of 20 March You will need your registration number (under barcode on the badge) to print the Certificate of Attendance. Information on CME accreditation is available in this programme book on page 47. Cloakroom / Luggage The cloakroom is located in the registration area on level N0 and open during congress hours. Please be sure to collect all personal belongings at the end of the day. CME Accreditation The 28th Annual EAU Congress is accredited by the UEMS/EACCME through the European Board of Urology. More information on national credit systems and credits recognition is available in this programme book on page See also EU-ACME Desk. Congress Bag Each delegate can collect a congress bag in the registration area on level N0. The congress bags are sponsored by ASTELLAS Daily Congress Newsletter: European Urology Today Special Edition Special daily congress newsletters are available on Saturday 16, Sunday 17 and Monday 18 March. The newsletters cover on-site news, congress session information and background information on a variety of subjects. The first edition also contains an Exhibition Overview. The newsletters will also be available online at during and after the congress. Business Centre There is a Business Centre located on level S1 (balcony) of the exhibition which offers facilities such as computers, printers, copiers and internet. Congress Hours Speaker Service Centre Registration Sessions Sponsored sessions Exhibition Cloakroom Thursday, 14 March Friday, 15 March Saturday, 16 March Sunday, 17 March Monday, 18 March Tuesday, 19 March Programme Book

41 EAU Congress Office Managing Directors Jacqueline Roelofswaard Maurice Schlief Congress Manager Patricia de Bont Exhibition Manager Henriet Wieringa Manager Business Relations Peter Hazenberg Congress Consultants B.V. PO Box AA Arnhem The Netherlands T +31 (0) F +31 (0) info@congressconsultants.com EAU Education Office (European School of Urology) The European School of Urology (ESU), working with European faculties, aims to provide high quality international educational courses in urology. The ESU has a special booth on level N-1 with extensive information on its activities. Registration for the courses can be made at the ESU registration desks in the registration area on level N0. The ESU Courses CD 2013 is distributed at the EAU desk next to the MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY booth (booth D30 in the exhibition on level S0) to all congress delegates. The ESU Courses CD 2013 is supported by an unrestricted educational grant from MILLENNIUM: THE TAKEDA ONCOLOGY COMPANY Fees ESU Courses (for congress registered delegates only) 2 hrs. 3 hrs. EAU members Non-EAU members Residents (members/non-members) Prices are excl. 21% VAT Hands-on training sessions on Laparoscopy, Ureterorenoscopy, Bipolar TURP, Robotic surgery, Endourology, Urodynamics and Green light laser are organised by the ESU in cooperation with the EAU Robotic Urology Section (ERUS), the EAU Section of Uro-Technology (ESUT) and the EAU Section of Urolithiasis (EULIS). The registration fee is 25 per hands-on training (excl. VAT). Registration for hands-on trainings and courses can be made at the ESU registration desks and in the Self Service Area in the registration area on level N0. The Hands-on training sessions are supported by educational grants from AMERICAN MEDICAL SYSTEMS, INTUITIVE SURGICAL, KARL STORZ GMBH & CO.KG, MEDIWATCH and OLYMPUS EUROPA HOLDING GMBH E-BLUS (European training in Basic Laparoscopic Urological Skills) One of the main goals of the EAU is to establish and introduce common standards for training and European urological practice in order to improve patient care. The E-BLUS exam tests certifies a basic level of laparoscopic urological skills. The exercises address bimanual dexterity, depth perception, suturing, clipping and cutting skills. Clinical application is found in such procedures as partial nephrectomy, total nephrectomy, pyeloplasty and radical prostatectomy. To aid in the training of these skills and to prepare for this E-BLUS exam, the exercises to be performed can be found in the instructional videos at At the EAU Annual Congress several exam sessions will be organised where you can demonstrate your skills and be awarded with a certificate if you pass the defined criteria. Interest usually exceeds the number of available positions, participation in the exam is therefore by invitation. For more information: or at the ESU booth. General EAU Milan

42 General information General EAU Booth The EAU Booth (booth H17 in the exhibition on level S0) consists of the EAU Membership Booth, EBU Corner, Young Urologists/ Residents Corner, EAU Stockholm 2014 Promotion Counter, EAU Research Foundation and the EAU Historical Exhibition. There is also information on European Urology and other EAU publications. The EAU Membership Booth provides information on membership status and membership benefits. Non-members are welcome to visit the EAU Booth for further information and to apply for EAU membership. EAU Research Foundation The EAU Central Research Office initiates and coordinates, as well as refines investigator initiated and other clinical research protocols. It also acts to facilitate all aspects of clinical research and expand the current network of active research centres and investigators - basic and clinical - both within the EAU member states and its international affiliates. The office coordinates clinical and translational research in close liaison with the EAU Research Foundation. The EAU Research Foundation can be visited at the EAU Booth (booth H17) in the exhibition on level S0. Education & Innovation The EAU Education & Innovation booth, located in the exhibition on level S1 (Balcony), represents a joint effort of the European School of Urology, the EAU Section of Uro-technology, the EAU Section on Urolithiasis and the EAU Robotic Urology Section, which offers urologists a hands-on experience with notable technological innovations in urological treatment and training. Electricity The electricity in Italy runs on 220 volts and the frequency is 50 Hz. Plugs have two or 3 round pins. A plug adaptor will be required if incompatible electronic devices are used. Emergency Phone Numbers In case of an emergency please call 113 for police, 115 for fire brigade or 118 for ambulance service. In case of an emergency in the congress centre please call or contact a security guard immediately. See also First Aid. EU-ACME Desk Information on the EU-ACME programme, CME/CPD credits, membership status & benefits, accredited CME activities and national CME credits systems can be obtained at the EU-ACME Desk in the registration area. For more information see page 48. European Association of Urology Nurses (EAUN) The 14th International Meeting of the European Association of Urology Nurses (EAUN) is a 3-day scientific meeting that will be held in conjunction with the 28th Annual EAU Congress from March in support of their goal to continually upgrade the nursing skills of urology nurses. Scheduled are for example abstract sessions and panel discussions and expert nurses and urologists will give lectures, workshops and courses. See page 29 for the EAUN programme. There is also a special EAUN congress App available; search for EAUN 2013 in your App Store or Android market. European Board of Urology (EBU) The European Board of Urology (EBU) operates as an independent section of the UEMS (European Union of Medical Specialists) charged with regulatory matters. Visit the EBU Corner at the EAU Booth (booth H17 in the exhibition on level S0) to obtain more information on EBU s core activities: European Board Examinations in Urology (FEBU) In-Service Assessment Accreditation of Continuing Medical Education & Professional Development (CME & CPD) Certification of Sub-Specialty Centres and Residency Training Programmes in Urology. European Urology European Urology, the official journal of the EAU, has been a respected urological forum for over 20 years and is currently read by more than 10,000 urologists across the globe. With an impact factor of the Platinum Journal remains the leading scientific publication in the field of urology. To keep up with the rapidly evolving world of medicine, technology and surgical techniques, European Urology is constantly updating and innovating its features and layout in order to provide the best clinical guidance, research and education for urologists across Europe and the world. The recently implemented electronic features and platforms make reading the articles and viewing the videos even more interesting! Come 42 Programme Book

43 see European Urology for yourself - visit either the European Urology (booth C02) or the EAU Booth (booth H17) in the exhibition on level S0. Excursions and Milan Information Information on Milan and excursions will be available at the Milan Info & Excursions Desk in the registration area on level N0. Exhibition An extensive technical exhibition will be held jointly with the congress. The exhibition is open to technical equipment manufacturers, pharmaceutical companies and scientific publishers. Exhibition Hours Saturday, 16 March hrs Sunday, 17 March hrs Monday, 18 March hrs First Aid There is a medical unit present for first aid on level S1 indicated on the directional signs with. In case of emergency, contact a security guard immediately or call See also Emergency Phone Numbers. Guidelines EAU Extended guidelines The EAU extended urological guidelines edition 2013, are distributed at the EAU Booth (booth H17 in the exhibition on level S0). Members can collect the guidelines free of charge. This publication is also available for purchase. EAU Pocket guidelines EAU urological guidelines in pocket format including a CD are distributed by Olympus (booth C01 in the exhibition on level S0) to EAU members only. The distribution of the EAU Pocket Guidelines 2013 is supported by OLYMPUS Historical Exhibition The EAU History Office has set up an historical exhibit located at the EAU Booth (booth H17 in the exhibition on level S0). The exhibit will present My other passion. The urologist as a collector. Hospitality Suites Companies AMS ASTELLAS COOK MEDICAL TAKEDA SANOFI Hospitality Suite 1; MiCo South Level S2 Gold View Lounge; MiCo South level S2 Panorama Lounge; MiCo South level S3 Hospitality Suite 2; MiCo South Level S2 Hospitality Suite 3: MiCo South Level S2 Hotel Accommodation The EAU has contracted the company K.I.T. Group GmbH to deal with the housing for the congress. K.I.T. staff will be available at the Hotel Desk in the registration area on level N0. Insurance The organisers do not accept responsibility for any personal damage. Participants are strongly recommended to arrange their own personal insurance. Internet Corners The EAU Internet Corners are at your disposal at different locations in the exhibition on level S0 (booth A22 and booth F54). The internet corners offer free use of internet and printers. See also WiFi / Charge and Connect Area. Language All presentations during the EAU Congress will be conducted in English, the official language of the EAU. There will be no translation provided. Learning Objectives EAU Congress The EAU Congress provides a forum for presenting original unpublished data and sharing ideas for urological innovation as well as disseminating evidence-based knowledge of primary clinical relevance. Urologists and affiliated professionals attending the EAU Congress will be able to: Review innovative techniques and scientific advances in the field of urology and its subspecialities Review the latest data and emerging trends from studies in clinical and translational research Enhance their knowledge of evidence-based approaches to the management of urological disease General EAU Milan

44 General information General Gain new knowledge on emerging diagnostic and risk-assessment strategies in the management of urological disease Enhance their practical knowledge and skills by educational activities, including hands-on-training and courses Gain exposure to new developments in drugs and new cutting edge technology in the field of pharmaceutical research and medical technology through visiting the EAU Congress Exhibition Communicate, collaborate and network with representatives of a large international audience medical professionals, national urological societies, patient groups, medical industry and the media. Lost and Found Found items should be returned to the Information Desk in the main entrance hall on level N0. If you lose something, please report to this desk for assistance. Media Policy Photography, filming and interviews during the congress (with the exception of the EAU Press Centre and EAU Press Conference Room) are prohibited without written permission from the EAU Communication Officer Ms. Ivanka Moerkerken (i.moerkerken@uroweb. org). Mobile Phones Mobile phones must be switched off during all sessions. Personal Planner Do not miss anything during this year s congress, use the EAU Personal Planner! It is fully integrated with the scientific programme of the congress. You can select your priority sessions and add your private appointments. If you are presenting at the congress your faculty appointments will be automatically displayed. You can export it to your Outlook, Google Calendar or print it out. For more information, please visit the congress website: Poster Builder Service Poster presenters who created their posters for the Milan Congress through the EAU Online Poster Builder Service, can collect their posters at the Speaker Service Centre on level N0. Poster DVD A DVD with a collection of scientific posters from the Milan Congress will be distributed by AMGEN (booth D20 in the exhibition on level S0). The EAU Poster DVD 2013 is supported by an unrestricted educational grant from AMGEN Prayer Room A special room dedicated to prayer is located on level S3 (follow the signage on this level). Presentation Training Centre Mr. Paul Casella (Iowa, USA) gives Individual Presentation Skills Training Sessions to help improve presentation and delivery skills. The one-on-one half hour sessions are free of charge and available to all speakers. Appointments for this very popular training session can be made at the Speaker Service Centre (level N0). Press Centre Journalists and medical/science writers can obtain free registration to the Congress. Journalists receive a press pack, to be collected at the EAU Press Centre in White Hall 1 on level N1. All press are invited to report to the EAU Press Centre to obtain the assistance and information they require. Internet access, printer and photocopier are provided. Resource Centre Urology Science and Learning The Resource Centre is a website ( that delivers EAU content to users on-demand and allows to select content and webcasts of lectures and presentations that might otherwise be missed. Restaurant Reservations The choices for eating out in Milan are endlessly varied. Traditional Milanese cooking is made up of unpretentious but tasty dishes offered in numerous trattorias, inns and restaurants (including very luxury ones). Popular dishes are Risotto alla Milanese (made with a bull-bodied beef broth), Cassouela (an extremely filling meat dish with cabbage and other vegetables) and Cotoletta alla Milanese (a crunchy veal cutlet). Enjoy also an aperitif during happy hour, a ritual in Milan. The local classic is a Negroni, a potent blend of bitter Campari, gin, red Martini and ice. In many bars 44 Programme Book

45 and restaurants the aperitif is accompanied by tasty appetizers. To place your restaurant booking go to the Restaurant Reservations Desk in the registration area on level N0. can be displayed in the Upcoming Meetings promotion area on level N0. It is strictly forbidden to put up promotional material at any other location in the building. Safety All bags may be subject to inspection. Security is present for your safety. Please take all personal effects with you when leaving a session room. Smoking Policy Smoking is prohibited inside the congress centre and in the exhibition area. An outside smoking area is available via an exit in the exhibition hall (level S0) between booth H01 and H02. Outside exhibition opening hours smoking is only allowed in front of the main entrance of the congress centre on level N0. Speaker Service Centre For extensive speaker information see page 46. Taxi Service There is a taxi rank available in front of the main entrance of the congress centre Via Gattamelata 5 (Gate 14). In order to book a taxi please go to the Milan Info & Excursions desk in the registration area (Level N0), they can guarantee the official rates are applied for the reservations made though them. Rates: - From the congress centre to airport Malpensa approx From the congress centre to airport Linate approx. 25/30 If you wish to book a taxi in Milan by phone we recommend to call the following companies: Yellow Taxi: or Radio Taxi / / It is also possible to book car transfers to the airports at the TBlu desk in the main entrance (level N0). Transportation Pass Congress delegates may collect a complimentary transportation pass in the registration area (level N0) which is valid for unlimited travels from March The pass covers underground, tram and bus within the city limits of Milan. The airport cannot be reached with this transportation pass. See also Airport Shuttle Bus. Upcoming Meetings Posters and other information on upcoming meetings Video Library The EAU Video Library is located on South level S2, in the passage between North and South. A wide choice of EAU videos, including all videos presented in Milan and at previous EAU Congresses, can be viewed on individual monitors. All videos can be copied to a DVD which can be collected at the ASTELLAS booth during exhibition hours (booth C20 in the exhibition on level S0), a service that is provided free of charge to all congress delegates. On Tuesday 19 March DVD s can be collected in the registration area. Video library hours: Friday, 15 March Saturday, 16 March Sunday, 17 March Monday, 18 March The Video Library is supported by an unrestricted educational grant from ASTELLAS Webcasts ( ) & Live Streams ( ) Many sessions will be webcasted via org. The webcasted sessions are indicated with a special logo in the synopsis and will be online within several hours after the session. The webcasts have not been edited and are exactly as presented. The statements and the opinions featured in the webcasts are solely those of the individual presenters and not of the European Association of Urology (EAU). Webcasts are not accredited and no CME credits can be obtained by watching the webcasts. In addition to the webcasts there will be live streams of several sessions available at the congress website: These sessions are also indicated in the synopsis with a special logo. WiFi / Charge and Connect Area Free wireless internet will be available throughout the congress centre except in the exhibition areas. Please search for the EAU WiFi. A special Charge and Connect Area with tables and power outlets is available on level N1. The Charge and Connect Area allows you to recharge your laptops and phones while using WiFi. General EAU Milan

46 General Speaker guidelines Speaker Service Centre Only digital presentations will be accepted during the congress and all presentations should be handed in at least three hours prior to the start of the session at the Speaker Service Centre (Level 0 - North Wing). Failure to do so could result in presentations not being available for projection when required. If you have an early presentation, please hand in your presentation the previous day! Opening hours Thursday, 14 March Friday, 15 March Saturday, 16 March Sunday, 17 March Monday, 18 March Tuesday, 19 March If you are a chair person Locate your session room in time. Please be in your session room at least 15 minutes prior to the start of the session. Kindly note that: Speakers should strictly observe timing. Discussants should first clearly state their name, institution and country of origin. If you are presenting a poster Posters must be put up in the room 15 minutes prior to the start of the session. The poster boards are numbered and your poster should be mounted on the board which corresponds with your abstract number. Pushpins are available in the session room. Please remove your poster immediately at the end of the session. A maximum of 5 PowerPoint slides is allowed during extended poster presentation. For standard poster presentations, a maximum of 2 PowerPoint slides is allowed. Disclose links to the industry The EAU Scientific Congress Office requests that you disclose to the audience any links you may have with the industry related to the topic of your lecture at the beginning of your session. A link can be: Being a member of an advisory board or having a consultancy agreement with a specific company. Presentation Training Centre Mr. Paul Casella (Iowa, USA) gives Individual Presentation Skills Training Sessions to help improve presentation and delivery skills. The one-on-one half hour sessions are free of charge and available to all speakers. Please go to the Speaker Service Centre to make an appointment for this popular training session. 46 Programme Book

47 CME Accreditation Accreditation of the EAU Congress The request for the European accreditation of the 28th Annual EAU Congress will be submitted to the UEMS/ EACCME. The 28th Annual EAU Congress is designated for a maximum of 27 hours of European external CME credits. Each medical specialist should claim only those hours of credit that he/she actually spent in the educational activity. CME credits The EACCME/EBU credit system is based on 1 ECMEC per hour with a maximum of 3 ECMECs for half a day and 6 ECMECs for a full-day event. Please scan your EAU congress badge when entering the lecture room to have CME credits registered automatically. The CME credit registration is carried out by the EUACME Office and during the congress you can find their desk at the registration area. CME credits per Country The EBU/EACCME CME credits are recognised by most of the national CME authorities in Europe, which have agreed to cooperate in this European system. All CME activities approved by the EBU/EACCME are recognised in the following countries: Austria, Belgium, Cyprus, Czech Republic, Finland (ProMedico), Georgia, Greece, Hungary, Ireland, Luxembourg, Malta, The Netherlands, Norway, Italy (Region Lombardia), Romania, Slovakia, Slovenia, Spain, Sweden (IPULS), Turkey and United Kingdom. CME credits per Speciality All CME activities approved by the EBU/EACCME are recognised in the following specialities: Dermatology and Venerology, Paediatric Surgery, Physical and Rehabilitation Medicine, Anaesthesiology, Child and Adolescent Psychiatry and Psychotherapy, Endocrinology, Geriatrics, Intensive Care (MJC), Internal Medicine, Neurology, Neurosurgery, Nuclear Medicine, Oral and Maxillofacial Surgery, Pathology, Plastic Surgery, Cardiology (EBAC), Sports Medicine (MJC), Genetics (MJC), Emergency Medicine (MJC), Microbiology, Hand Surgery (MJC), Pneumology (EBAP), Infectious Diseases (EBAID), Surgery, Urology, Oncology (ACCO), Vascular Surgery, Gastroenterology, Allergology. If your country or speciality is not listed above please either contact the EU-ACME Office for more information or send a copy of the attendance certificate to your National Urological Society and/or National Accreditation Body. CME credits outside Europe Through an agreement between the European Union of Medical Specialists and the American Medical Association, physicians may convert EACCME credits to an equivalent number of AMA PRA Category 1 Credits. Information on the process to convert EACCME credit to AMA credit can be found at If you attended a conference in Europe and received a certificate for EACCME credit you can convert it to the AMA PRA Category 1 Credit. To receive the credit, the conference must appear on the list of approved activities posted in the EACCME section of the UEMS Website. To apply for conversion of EACCME credit to AMA PRA Category 1 Credit, download the Application for EACCME Credit Conversion and submit the completed application by fax or mail, a copy of the EACCME credit certificate and appropriate processing fee. A certificate of AMA PRA Category 1 Credit will be mailed within four weeks. If you wish to receive information about the conversion procedure of EACCME credits to AMA PRA category 1 credits, please contact the AMA. Live educational activities, occurring outside of Canada, recognised by the UEMS-EACCME for ECMEC credits are deemed to be Accredited Group Learning Activities (Section 1) as defined by the Maintenance of Certification Program of The Royal College of Physicians and Surgeons of Canada. General EAU Milan

48 EU-ACME Programme General The EU-ACME Programme - the initiative resulting from a close collaboration between the European Board of Urology (EBU) and the European Association of Urology (EAU) - stands for European Urology - Accredited Continuing Medical Education. Its primary task is assistance in the implementation, promotion and organization of Continuing Medical Education (CME) and Continuing Professional Development (CPD) among European urologists. Urologists have access to an online system - in compliance with the EBU/UEMS regulations - which helps them to keep track of their educational activities, irrespective of the country they practice in or where they have participated in accredited CME/CPD activities. CME/CPD activities are generally geared towards practising physicians and are designed to provide information that is both relevant and essential to medical practice. The international urological societies as European Association of Urology, European Society of Paediatric Urology and International Continence Society as well as national urological societies from: Austria, Czech Republic, Cyprus, Denmark, Egypt, Estonia, Greece, Hungary, Italy, Latvia, Malta, The Netherlands, Poland, Portugal, Romania, Serbia, Slovakia, Slovenia, Spain have already joined the programme. For more information, please visit the website: Information on the EU-ACME programme, your acquired CME/CPD credits and membership cards can be obtained at the EU-ACME information desk in the registration are. The EU-ACME office acts as a central institution where all information forwarded by urologists, (inter) national urological associations and CME organisers/ providers is kept. As a service institution the EU-ACME office offers: registration of credit points for members of the urological society participating in the EU ACME programme, access to the online CME/CPD credit system via webpage the EU ACME membership card for urologist participating in the programme, yearly Credit Registry Report listing all collected CME/CPD credit points, registration of accredited on national and/or European level CME events, assistance in obtaining European Accreditation. 48 Programme Book

49 Congress hotels AC Milano Via Tazzoli, Milan T F Metro M2 Garibaldi Adi Hotel Poliziano Fiera Via Poliziano, Milan T F km walking distance Admiral Hotel Via Domodossola, Milan T F km walking distance Antares Hotel Accademia Viale Certosa, Milan T F km walking distance Antares Hotel Milan Rubens Via Rubens, Milan T F Metro M1 De Angeli Art Hotel Navigli Via Angelo Fumagalli, Milan T F Metro M2 Porta Genova ATA Hotel Executive Viale Luigi Sturzo, Milan T F Metro M2 Garibaldi ATA Hotel Expo Fiera Via Giovanni Keplero, Milan T F Metro M1 Pero ATA Hotel Quark Via Lampedusa, 11/ Milan T F Metro M2 Abbiategrasso Atlantic Quality Hotel Via Torriani Napo, Milan T F Metro M2 Centrale Auriga Hotel Via Giovanni Battista Pirelli, Milan T F Metro M2 Centrale Best Western Astoria Hotel Viale Murillo, Milan T F km walking distance Best Western Cristoforo Colombo Hotel Corso Buenos Aires, Milan T F Metro M1 Porta Venezia Best Western Felice Casati Hotel Via Felice Casati, Milan T F Metro M1 Lima Best Western Galles Hotel Piazza Lima, Milan T F Metro M1 Lima Best Western Madison Hotel Via Leopoldo Gasparotto, Milan T F Metro M3 Sondrio Best Western Major Hotel Viale Isonzo, Milan T F Metro M3 Lodi TIBB General EAU Milan

50 Congress hotels General Best Western Mozart Hotel Piazza Gerusalemme, Milan T F km walking distance Capitol World Class Hotel Via Domenico Cimarosa, Milan T F Metro M1 Pagano Carrobbio Hotel Via Medici, Milan T F Metro M3 Italia Missori Cavour Hotel Via Fatebenefratelli, Milan T F Tram 61 Via Fatebenefratelli C.so di P.ta Nuova Crowne Plaza Milan City Via Melchiorre Gioia, Milan T F Metro M3 Sondrio Dei Cavallieri Duomo Hotel Piazza Missori, Milan T F Metro M3 San Donato Doria Grand Hotel Viale Andrea Doria, Milan T F Metro M2 Caiazzo DoubleTree by Hilton Hotel Milan Via Ludovico di Breme, Milan T F Tram 14 Vle Certosa Via Casella Enterprise Hotel Corso Sempione, Milan T F km walking distance Four Points by Sheraton Milan Via Gerolamo Cardano, Milan T F Metro M2 Goioa Grand Visconti Palace Viale Isonzo, Milan T F Metro M3 Lodi TIBB Hermitage Hotel Via Messina, Milan T F Metro M2 Moscova Hilton Milan Via Luigi Galvani, Milan T F Metro M2 Gioia Holiday Inn Milan Garibaldi Station Via Ugo Bassi, 1/A Milan T F Metro M2 Garibaldi Hotel Johnny Via Giovanni Prati, Milan T F km walking distance Ibis Milano Ca Granda Viale Giovanni Suzzani, Milan T F Tram 51 V.le Suzzani V.le Berbera Ibis Milano Centro Via Camillo Finocchiaro Aprile, Milan T F Metro M3 Republica Marriott Milan Via Washington, Milan T F Metro M1 Wagner 50 Programme Book

51 Mediolanum Hotel Via Mauro Macchi, Milan T F Metro M3 Republica Melia Milano Via Tommaso Masaccio, Milan T F km walking distance Mini Hotel La Spezia Via la Spezia, Milan T F Metro M2 Famagosta Mini Hotel Portello Via G. Silva, Milan T F Metro M1 Lotto Fiera Mini Hotel Tiziano Via Tiziano, Milan T F Metro M1 Buonarroti Mirage Hotel Viale Certosa, 104/ Milan T F km walking distance Nasco Hotel Corso Sempione, Milan T F km walking distance NH Fiera Milano Viale degli Alberghi s/n Milan T F Metro M1 Rho Feira NH Grand Hotel Verdi Via Melchiorre Gioia, Milan T F Metro M2 Gioia NH Machiavelli Via Lazzaretto, Milan T F Metro M1 Porta Venezia NH Milano Touring Via Ugo Tarchetti, Milan T F Metro M3 Repubblica NH President Largo Augusto, Milan T F Metro M1 San Babila Nhow Milano Via Tortona, Milan T F Metro M2 Porta Genova Novotel Milano Ca Granda Viale Suzzani, Milan T F Metro M3 Maciachini Palazzo Delle Stelline Hotel Corso Magenta, Milan T F Metro M1 Conciliazione Radisson Blu Hotel Milan Via Villapizzone, Milan T F Metro M1 QT8 Raffaello Hotel Viale Certosa, Milan T F km walking distance Ramada Plaza Via Stamira D Ancona, 27a Milan T F metro M1 Turro General EAU Milan

52 Congress hotels General Regency Milan Hotel Via G. Arimondi, Milan T F km walking distance Regina Hotel Via Cesare Correnti, Milan T F Metro M2 Sant Ambrogio Starhotels E.C.H.O Viale Andrea Doria, Milan T F Metro M2 Caiazzo Starhotels Ritz Via Spallanzani, Milan T F Metro M1 Lima UNA Hotel Century Via Fabio Filzi, 25/B Milan T F Metro M2 Centrale UNA Hotel Cusani Via Cusani, Milan T F Metro M1 Cairoli Royal Garden Hotel Via G. Di Vittorio Milan T F Metro M2 Famagosta Sanpi Milano Hotel Via Lazzaro Palazzi, Milan T F Metro M1 Porta Venezia Sheraton Diana Majestic Viale Piave, Milan T F Metro M1 Porta Venezia Starhotels Anderson Hotel Piazza Luigi di Savoia, Milan T F Metro M2 Centrale Starhotels Rosa Grand Piazza Fontana, Milan T F Metro M1 Duomo Sunflower Piazzale Lugano, Milan T F Tram 91 P.le Lugano The Hub Hotel Via Privata Polonia, Milan T F Tram 560 Stephenson - Polonia The Westin Palace Piazza della Repubblica, Milan T F Metro M3 Repubblica UNA Hotel Mediterraneo Via L. Muratori, Milan T F Metro M3 Porta Romana UNA Hotel Scandinavia Via G.B. Fauché, Milan T F km walking distance UNA Hotel Tocq Via A. De Tocqueville, 7/D Milan T F Metro M2 Garibaldi Uptown Palace Via Santa Sofia, Milan T F Metro M3 Crocetta 52 Programme Book

53 Friday, 15 March - EAU Programme Special Session International Conference on Prostate Cancer Prevention 2013 with Consensus Conference on Chemoprevention of Prostate Cancer Amber Hall Level S Session 1: Scientific considerations in prostate cancer prevention Chair: P. Brown, Houston (US) Biology and natural history of prostate cancer - Overview L. Holmberg, Uppsala (SE) Risk prediction: Biomarkers Serum Kallikrein markers H.G. Lilja, New York (US) Friday Urinary PCA3 H. Rittenhouse, Los Osos (US) TMPRSS2-ERG S. Perner, Bonn (DE) Non-PCA3 urinary biomarkers J.A. Schalken, Nijmegen (NL) GWAS R.A. Eeles, London (GB) Break Session 2: Early detection Chair: A. Stenzl, Tübingen (DE) Screening - Current status (ERSPC) F.H. Schröder, Rotterdam (NL) Screening - Current status (PLCO) G. Andriole, St. Louis (US) Session 3: Prognosis and management of low grade disease Chair: C. Parker, London (GB) Cell cycle progression markers J. Cuzick, London (GB) Distinguishing aggressive from indolent prostate cancer Z. Culig, Innsbruck (AT) Management of Gleason 6 (PIVOT) T.J. Wilt, Minneapolis (US) EAU Milan

54 Management of Gleason 6 B. Tombal, Brussels (BE) Session 4: Review of chemoprevention trials Chair: L. Minasian, Bethesda (US) Outlook for 5a reductase inhibitors Finasteride/Dutasteride Review of data and European perspective M. Marberger, Vienna (AT) Review of data and North American perspective O.W. Brawley, Atlanta (US) Friday Vitamin E and Selenium - SELECT trial L. Ford, Bethesda (US) Other chemoprevention trials H. Parnes, Bethesda (US) Lunch and poster viewing / meet the faculty Session 5: Prostate cancer: Chemoprevention - Novel agents Chair: F. Meyskens, Irvine (US) Bisphosphonates G. Rennert, Haifa (IL) Polyamines and DFMO F. Meyskens, Irvine (US) Lycopene D. Illic, Melbourne (AU) Aspirin, NSAIDs and COX2 P. Rothwell, Oxford (GB) Antioxidants and nutrition (EPIC) T. Key, Oxford (GB) Lifestyle and dietary factors A. Wolk, Stockholm (SE) 54 Programme Book

55 Session 6: Panel discussion: Current policy for prostate cancer screening and chemoprevention Chair: O.W. Brawley, Atlanta (US) P. Brown, Houston (US) G. Gordon, Abbott Park, IL (US) F.C. Hamdy, Oxford (GB) F. Meyskens, Irvine (US) L. Minasian, Bethesda (US) C. Parker, London (GB) H. Parnes, Bethesda (US) F.H. Schröder, Rotterdam (NL) H-P. Schmid, St. Gallen (CH) R. Smith, Atlanta (US) B.J. Schmitz-Dräger, Fürth (DE) A. Stenzl, Tübingen (DE) CME Accreditation The conference has been awarded 9 credit points for continuing medical education by ACOE (Accreditation Council of Oncology in Europe) and has been granted European endorsement by the UEMS (European Union of Medical Specialists) clearing house system, the EACCME and awarded 9 European Continuing Medical Education Credits (ECMEC). An accreditation of the UEMS (EACCME) is also recognised by the AMA (American Medical Association) and the PRA (Physicians Recognition Award) in the US as well as by the respective accreditation boards in China and Japan. Co-sponsored by ISCaP, EAU, National Cancer Institute (USA), Cancer Research UK, Prostate Cancer UK, AICR Friday EAU Milan

56 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Chinese Urological Association (CUA) Brown Hall Level S2 Chairs: C.R. Chapple, Sheffield (GB) L-P. Xie, Hangzhou (CN) Session 1: Endoscopic management of complex renal calculi PCNL combined RIRS for complex renal calculi G-H. Zeng, Guangzhou (CN) Friday Retrograde flexible ureteroscopy for complex renal calculus: Current concepts and future directions O. Traxer, Paris (FR) Discussion Session 2: Reconstructive urology One stage oral mucosal graft urethroplasty for treatment of male anterior urethral strictures: A ten-year study from a single centre Y.L. Sa, Shanghai (CN) Substitution urethroplasty: Current concepts and future directions - A review of the conclusions of the International Consultation of Urethral Stricture Disease C.R. Chapple, Sheffield (GB) Discussion Session 3: Recent developments relating to surgery for benign prostatic hyperplasia Transurethral vapour enucleation and resection of the prostate with a plasma button electrode: A new technique L-P. Xie, Hangzhou (CN) Laser prostatectomy: Has this come of age? O. Reich, Munich (DE) Discussion 56 Programme Book

57 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Korean Urological Association (KUA) Brown Hall 3 - Level S2 Chairs: D. Jacqmin, Strasbourg (FR) G.T. Sung, Busan (KR) Introduction S.W. Han, Seoul (KR) D. Jacqmin, Strasbourg (FR) Session 1: Small renal masses Moderators: J. Cheon, Seoul (KR) D. Jacqmin, Strasbourg (FR) Friday Surgery or surveillance D.D. Kwon, Gwangju (KR) Percutaneous ablative therapy A. Gangi, Strasbourg (FR) Clinical cases Session 2: LUTS Case presenter: S.I. Seo, Seoul (KR) Panel: B.H. Chung, Seoul (KR) A. Gangi, Strasbourg (FR) D.D. Kwon, Gwangju (KR) Moderators: M.K. Chung, Yangsan (KR) J.M.O. N Dow, Aberdeen (GB) Medical management of LUTS J.M.O. N Dow, Aberdeen (GB) Surgical management of LUTS D.K. Kim, Daejeon (KR) Session 3: Hormone refractory prostate cancer Moderators: J. Bellmunt, Barcelona (ES) G.T. Sung, Busan (KR) What is the evidence? S.J. Hong, Seoul (KR) What is the best sequence? B. Tombal, Brussels (BE) EAU Milan

58 Clinical cases Case presenter: D-H. Seong, Incheon (KR) Panel: S.J. Hong, Seoul (KR) C. Kim, Seoul (KR) B. Tombal, Brussels (BE) Closing remarks S.W. Han, Seoul (KR) D. Jacqmin, Strasbourg (FR) Friday 58 Programme Book

59 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Urological Society of India (USI) Amber Hall Level S2 Chairs: R. Meyyappan, Chennai (IN) A. Patel, London (GB) Introduction R. Meyyappan, Chennai (IN) A. Patel, London (GB) Turning the page - Past, present and future of urological journals in Europe and India Moderators: R. Meyyappan, Chennai (IN) A. Patel, London (GB) Friday IJU perspective N. Kekre, Vellore Tamilnadu (IN) European Urology Today perspective M. Wirth, Dresden (DE) Renal disease management Moderators: T. Esen, Istanbul (TR) R. Meyyappan, Chennai (IN) European perspectives: Management of the small renal mass A. Volpe, Novara (IT) Indian perspective: Minimally invasive management of renal calculus disease in anomalous kidneys and in patients with musculo-skeletal deformities A. Srivastava, Lucknow (IN) Young Urologists Challenge Panel: M.R. Desai, Naidad (IN) T. Esen, Istanbul (TR) N. Kekre, Vellore Tamilnadu (IN) F.H. Schröder, Rotterdam (NL) High grade non-muscle invasive bladder cancer - role of second TURBT F. Sridhar, Ludhiana (IN) MRI guided focal cryo therapy: Salvage after failed radiotherapy J.P.M. Sedelaar, Nijmegen (NL) Emphysematous pyelonephritis P. Hariharan, Puducherry (IN) Is there a place for bladder screening? S. Larré, Reims (FR) EAU Milan

60 Words of Wisdom lecture 1: Percutaneous renal stone management - Evolution and current status, challenges, future prospects? M.R. Desai, Naidad (IN) Words of Wisdom lecture 2: PSA based prostate cancer screening - Current status, challenges, future prospects? F.H. Schröder, Rotterdam (NL) Conclusion R. Meyyappan, Chennai (IN) A. Patel, London (GB) Friday 60 Programme Book

61 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Iranian Urological Association (IUA) Red Hall 1 - Level N1 Chairs: W. Artibani, Verona (IT) S.J. Hosseini, Tehran (IR) Introduction W. Artibani, Verona (IT) S.J. Hosseini, Tehran (IR) Prostate cancer Moderators: W. Artibani, Verona (IT) S.J. Hosseini, Tehran (IR) Friday How to manage high risk prostate cancer A. Briganti, Milan (IT) Interactive case discussion S. Shakeri, Shiraz (IR) M. Ayati, Tehran (IR) Muscle-invasive bladder cancer Moderators: W. Artibani, Verona (IT) S.J. Hosseini, Tehran (IR) Contemporary management of muscle-invasive bladder cancer B. Djavan, Vienna (AT) Interactive case discussion A. Basiri, Tehran (IR) S.M. Sanadizadeh, Tehran (IR) Female urology Moderators: W. Artibani, Verona (IT) S.J. Hosseini, Tehran (IR) Female stress urinary incontinence surgery in 2013 W. Artibani, Verona (IT) Interactive case discussion M. Emami, Tehran (IR) S. Shakeri, Shiraz (IR) Reconstructive urology Moderators: W. Artibani, Verona (IT) S.J. Hosseini, Tehran (IR) EAU Milan

62 Posterior urethral strictures management S.J. Hosseini, Tehran (IR) Interactive case discussion E. Palminteri, Arezzo (IT) Conclusion W. Artibani, Verona (IT) S.J. Hosseini, Tehran (IR) Friday 62 Programme Book

63 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Arab Association of Urology (AAU) Yellow Hall Level N1 Chairs: H. Abol-Enein, Mansoura (EG) R.B. Khauli, Beirut (LB) M. Wirth, Dresden (DE) Welcome H. Abol-Enein, Mansoura (EG) M. Wirth, Dresden (DE) Prostate sparing cystectomy Pro G. Vallancien, Paris (FR) Friday Con H. Abol-Enein, Mansoura (EG) PT1 G3 bladder cancer Early cystectomy M. Bulbul, Beirut (LB) Conservative treatment M. Wirth, Dresden (DE) Positive margin after radical prostatectomy Adjuvant radiotherapy P. Dirix, Leuven (BE) Active surveillance D. Rabah, Riyadh (SA) Case presentations Moderators: A. Morsy, Cairo (EG) N. Msessa, Tripoli (LY) Renal cysts - How to treat? Y. Nouira, Ariana (TN) Panel: I.H. Al Nono, Sana a (YE) S.M. Moudouni, Marrakech (MA) Renal tumors, radical or partial nephrectomy A. Al Naimi, Doha (QA) Panel: M.R. El Halaby, Cairo (EG) R.B. Khauli, Beirut (LB) EAU Milan

64 Closing remarks H. Abol-Enein, Mansoura (EG) Friday 64 Programme Book

65 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Japanese Urological Association (JUA) Brown Hall Level S2 Chairs: H. Kakizaki, Asahikawa (JP) H. Van Poppel, Leuven (BE) Opening Y. Homma, Tokyo (JP) H. Van Poppel, Leuven (BE) Session 1: High risk prostate cancer Moderators: N.W. Clarke, Manchester (GB) Y. Tomita, Yamagata (JP) Friday Incidence, definition and diagnosis of high risk prostate cancer K. Ito, Gunma (JP) The place of surgery in the management of high risk prostate cancer H. Van Poppel, Leuven (BE) Session 2: Robot-assisted surgery Moderators: K. Tanabe, Tokyo (JP) H. Van Poppel, Leuven (BE) Robot assisted radical prostatectomy R. Shiroki, Aichi (JP) Robot assisted nephron sparing surgery A. Mottrie, Aalst (BE) Session 3: Metastatic prostate cancer Moderators: A. Mottrie, Aalst (BE) M. Oya, Tokyo (JP) Hormonal micro-environment of prostate cancer M. Oya, Tokyo (JP) Prediction, prevention and intervention in metastatic prostate cancer N.W. Clarke, Manchester (GB) Session 4: Voiding dysfunction Moderators: D.J.M.K. De Ridder, Leuven (BE) H. Kakizaki, Asahikawa (JP) Regenerative treatment of stress urinary incontinence using autologous adipose-derived stem cells M. Gotoh, Nagoya (JP) EAU Milan

66 Molecular mechanisms of OAB D.J.M.K. De Ridder, Leuven (BE) Session 5: Cases on RCC Moderator: Panel: Y. Tomita, Yamagata (JP) N.W. Clarke, Manchester (GB) M. Eto, Kumamoto (JP) G. Kimura, Tokyo (JP) A. Mottrie, Aalst (BE) Closing remarks Y. Homma, Tokyo (JP) H. Van Poppel, Leuven (BE) Friday 66 Programme Book

67 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Confederación Americana de Urología (CAU) Brown Hall 3 - Level S2 Chairs: F.R. Cruz, Porto (PT) H. Villavicencio Mavrich, Barcelona (ES) Welcome address F.R. Cruz, Porto (PT) H. Villavicencio Mavrich, Barcelona (ES) Surgery of prostate cancer in stage 3: Better than radiotherapy? U.E. Studer, Berne (CH) Bladder cancer: From the lab to the patient. Where are we? J. Palou, Barcelona (ES) Friday OAB: Antimuscarinics, Beta 3-agonists or Botulinum toxin: Which should be first? J.P.F.A. Heesakkers, Nijmegen (NL) Stress incontinence: From Burch to mini sling P. Palma, Campinas (BR) Endourology 2013: How are we progressing? J. Gutierrez, Guadelajara (MX) New technologies in urology J. Rassweiler, Heilbronn (DE) Urethroplasty update C.R. Chapple, Sheffield (GB) Closing remarks F.R. Cruz, Porto (PT) H. Villavicencio Mavrich, Barcelona (ES) EAU Milan

68 Friday, 15 March - EAU Programme Urology beyond Europe EAU - International: Caucasus and Central Asia Session Amber Hall Level S2 Chairs: Coordinator: M.K. Alchinbayev, Almaty (KZ) M. Marberger, Vienna (AT) I. Nusratulloev Sr., Dushanbe (TJ) N. Turmanidze, Tbilisi (GE) Hot issues in uro-gynaecology Moderators: W. Artibani, Verona (IT) Z. Tchanturaia, Tbilisi (GE) Friday Update on mesh and mesh use C.R. Chapple, Sheffield (GB) Management of uro-gynaecological fistula today B.U. Shalekenov, Almaty (KZ) Case discussion: Uro-gynaecological fistula Moderator: Panel: C.R. Chapple, Sheffield (GB) W. Artibani, Verona (IT) F. Akilov, Tashkent (UZ) R. Hovhannisyan, Yerevan (AM) Z. Khakimkhodzhaev, Bishkek (KG) The treatment of renal cell cancer is changing Moderator: G. Janetschek, Salzburg (AT) S. Javad-Zada, Baku (AZ) The management of small renal masses H-C. Klingler, Vienna (AT) Management of T1B (partical nephrectomy or nephrectomy?) A.R. Pertia, Tbilisi (GE) The limits of laparoscopic management renal masses G. Janetschek, Salzburg (AT) Case discussion: Management of localised renal tumours today Moderator: Panel: M. Marberger, Vienna (AT) G. Janetschek, Salzburg (AT) S. Javad-Zada, Baku (AZ) H-C. Klingler, Vienna (AT) D. Salikov, Dushanbe (TJ) 68 Programme Book

69 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Pan-African Urological Surgeons Association (PAUSA) Red Hall 1 - Level N1 Chairs: M. Eissa, Cairo (EG) C. Llorente, Madrid (ES) Welcome and introduction M. Eissa, Cairo (EG) C. Llorente, Madrid (ES) Guest lecture: Urology in ancient Egypt M.S Elrefaie, Alexandria (EG) Round table 1: Renal trauma Friday Moderators: S.D. Mante, Accra (GH) K. Nyarko, () Diagnosis and staging M.Y. Elgammal, Cairo (EG) Treatment J.M.O. N Dow, Aberdeen (GB) Round table 2: Avoiding complications of radical surgery Moderator: S.M. Gueye, Dakar (SN) Medical complications G.N. Thalmann, Berne (CH) Surgical complications E. Oluwabunmi Olapade-Olaopa, Ibadan (NG) Round table 3: Paediatric urology Moderators: M. Eissa, Cairo (EG) I. Vaz, Maputo (MZ) Congenital anomalies in adults I. Vaz, Maputo (MZ) Antibiotic prophylaxis M. Grabe, Malmö (SE) Pyeloplasty, open versus lap M. Eissa, Cairo (EG) Curved penis I.A.E. Mokhless, Alexandria (EG) EAU Milan

70 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Maghreb Union Countries Blue Hall Level N1 Chairs: A. Joual, Casablanca (MA) J.W. Thüroff, Mainz (DE) Introduction J.W. Thüroff, Mainz (DE) Session 1: Bladder cancer Friday Moderators: C-C. Abbou, Creteil (FR) A. Joual, Casablanca (MA) Bladder tumours in the Maghreb Y. Ahallal, Meknes (MA) Management of non invasive bladder tumours S.F. Shariat, New York (US) Radical cystectomy and bladder replacement W. Hassen, Al Ain (AE) Adjuvant and neoadjuvant chemotherapy Y. Loriot, Villejeuf (FR) Discussion Session 2: Panel case discussion Panel: K. Atallah, Tunis (TN) K. Hachi, Alger (DZ) A. Joual, Casablanca (MA) T. Lebret, Suresnes (FR) S.M. Moudouni, Marrakech (MA) S.F. Shariat, New York (US) J.W. Thüroff, Mainz (DE) Closing remarks J.W. Thüroff, Mainz (DE) 70 Programme Book

71 Friday, 15 March - EAU Programme Urology beyond Europe Joint Session of the European Association of Urology (EAU) and the Indonesian Urological Association (IUAI) Yellow Hall Level N1 Chairs: V. Mirone, Naples (IT) S. Sugandi, Bandung (ID) Introduction V. Mirone, Naples (IT) S. Sugandi, Bandung (ID) Sperm retrieval vs obstruction release in obstructive Azoospermia D.M. Soebadi, Surabaya (ID) Varicocele repair and male infertility: Indications and new evidences N. Sofikitis, Ioannina (GR) Friday The impact of medical management of BPH on erectile dysfunction P. Birowo, Jakarta (ID) New acquisitions concerning the physio-pathological correlation between LUTS and erectile dysfunction F. Giuliano, Garches (FR) The influence of hormonal changes on bladder function T. Romdam, Bandung (ID) The role of testosterone replacement therapy in the ageing male C.C. Schulman, Brussels (BE) Panel discussion and clinical case presentation Moderators: Panel: V. Mirone, Naples (IT) S. Sugandi, Bandung (ID) P. Birowo, Jakarta (ID) F. Giuliano, Garches (FR) T. Romdam, Bandung (ID) C.C. Schulman, Brussels (BE) D.M. Soebadi, Surabaya (ID) N. Sofikitis, Ioannina (GR) EAU Milan

72 Friday, 15 March - EAU Programme EAU Opening Ceremony euro Auditorium - Level S2 Performance by the Cameristi del Teatro alla Scala - Part 1 Gioachino Rossini Il barbiere di Siviglia Una voce poco fa Friday Gaetano Donizetti Don Pasquale Tornami a dir che m ami Opening addresses F. Montorsi, Milan (IT), EAU Congress President P-A. Abrahamsson, Malmö (SE), EAU Secretary General Announcement of the new EAU Honorary Members Citation by P-A. Abrahamsson, Malmö (SE) New Honorary Members: P. Rigatti, Milan (IT) I. Sinescu, Bucharest (RO) R. Umbas, Jakarta (ID) Presentation of the EAU Willy Gregoir Medal 2013 Citation by P-A. Abrahamsson, Malmö (SE) Presented to: C-C. Abbou, Creteil (FR) The EAU is proud to present the Willy Gregoir Medal to an important senior urologist who contributed in an extraordinary way to the development of urology in Europe Presentation of the EAU Frans Debruyne Life Time Achievement Award 2013 Citation by P-A. Abrahamsson, Malmö (SE) Presented to: J. Breza Sr., Bratislava (SK) The EAU wishes both to honour and acknowledge the important and longstanding contribution by a distinguished colleague to the activities and development of the EAU Presentation of the EAU Crystal Matula Award 2013 Citation by P-A. Abrahamsson, Malmö (SE) Presented to: P.J. Boström, Turku (FI) This prestigious prize is granted to a promising younger urological academician Supported by an unrestricted educational grant from LABORIE Presentation of the EAU Hans Marberger Award 2013 Citation by P-A. Abrahamsson, Malmö (SE) Presented to: J. Rassweiler, Heilbronn (DE) The Hans Marberger Award is awarded for the best European paper published in 2012 on minimally invasive surgery in urology Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG 72 Programme Book

73 Presentation of the EAU Innovators in Urology Award 2013 Citation by P-A. Abrahamsson, Malmö (SE) Presented to: U.E. Studer, Berne (CH) The Innovators in Urology Award is to acknowledge and highlight inventions and clinical contributions which have had a major impact on influencing the treatment and/or diagnosis of a urological disease Presentation of the EAU Prostate Cancer Research Award 2013 Citation by P-A. Abrahamsson, Malmö (SE) Presented to: I. Ahmad, Glasgow (GB) The EAU Prostate Cancer Research Award is awarded for the best paper published on clinical or experimental studies in prostate cancer Supported by an unrestricted educational grant from the FRITZ H. SCHRÖDER FOUNDATION Performance by the Cameristi del Teatro alla Scala Part II Giuseppe Verdi Rigoletto Caro nome La donna è mobile Giacomo Puccini Gianni Schicchi O mio babbino caro Friday Giuseppe Verdi La Traviata Libiam ai lieti calici Get-together to renew ties with colleagues from all over the world Foyer euro Auditorium Level S2 EAU Milan

74 Friday, 15 March - Sponsored Sessions Symposia Overview Extending survival outcomes in RCC and CRPC: Current evidence and future horizons page 397 Red Hall 2 - Level N1 Sponsored by BAYER HEALTHCARE New data in metastatic RCC: Applying the evidence to clinical practice page 398 Yellow Hall Level N1 Sponsored by GLAXOSMITHKLINE ONCOLOGY Urological challenges in managing patients with angiomyolipoma (AML) page 399 Amber Hall Level S2 Sponsored by NOVARTIS ONCOLOGY Innovations in clinical urology page 400 Blue Hall Level N1 Sponsored by OLYMPUS Friday Metastatic castration-resistant prostate cancer: Integrating new learnings to optimise treatment outcomes page 401 Brown Hall 3 - Level S2 Sponsored by SANOFI 74 Programme Book

75 Saturday, 16 March - EAU Programme Special Session EAU General Assembly Platinum Hall - Level S3 Welcome by the EAU Secretary General Approval minutes General Assembly of 25 February 2012, Paris, France General report by the EAU Secretary General P-A. Abrahamsson, Malmö (SE) Report by the EAU Treasurer M. Wirth, Dresden (DE) Specific reports on the EAU Offices by the EAU Executive Report by the Secretary General on the EAU Membership Office Approval new EAU members Approval new Honorary members Other business Future Congresses Presentation of the 29th Annual EAU Congress in Stockholm, April 2014 Saturday EAU Milan

76 Saturday, 16 March - EAU Programme Plenary Session Urology: From young to old euro Auditorium - Level S2 Chairs: W. Artibani, Verona (IT) D.J.M.K. De Ridder, Leuven (BE) Introduction to the plenary session W. Artibani, Verona (IT) Update The management and long-term outcomes of vesicoureteral reflux G. Lackgren, Uppsala (SE) Saturday Aims and objectives The introduction of endoscopic treatment with bulking agents and particularly the introduction of Deflux (a non-animal stabilised hyaluronic acid/dextranomer gel) has changed the treatment strategy of vesicoureteral reflux (VUR) in children. This treatment offers the chance of curing children with even high grade reflux (IV-V), and eliminating the need for long-term medication or repeat VCUGs. More importantly it reduces the number of children requiring open surgery. In our long-term follow-up (mean 16 years) study we have found that only 25% of the children with primary grade IV-V reflux have been submitted to open surgery (reimplantation) and that there are few adverse events in the long term after treatment. Results from the ongoing clinical study will be presented Update The long-term outcomes of genital surgery in boys A.R. Mundy, London (GB) Aims and objectives Other than circumcision and orchidopexy the commonest genital surgery in boys is hypospadias. This presentation will concentrate on hypospadias with some mention of extrophy/epispadias and circumcision. The long term outcome of hypospadias surgery in boys is not as good as is presented in the literature. I shall propose for discussion that excepting serious deformities genital surgery should be postponed until the boy himself can take part in his counselling process Debate Pelvic floor implants: Artificial mesh or autologous fascia? Moderator: Panel: F.R. Cruz, Porto (PT) Gynaecologist U. Peschers, Munich (DE) Urologist F. Haab, Paris (FR) Aims and objectives This session will discuss the long term data of artificial mesh implantation for correction of SUI of pelvic organ prolapse. Many patients are now expected to carry artificial meshes for several decades. The long-term results of SUI of pelvic organ prolapse with artificial mesh will be discussed. The potential consequences of a long-term exposure to foreign material during ageing will also be addressed State-of-the-art lecture Incontinence and age A. Wagg, Edmonton (CA) Aims and objectives Following this presentation the attendee will be able to demonstrate: 76 Programme Book

77 - an understanding of the impact of comorbid conditions on continence in older people - an awareness of the impact of polypharmacy on continence status is older people - the impact of anticholinergic medications for bladder dysfunction on cognitive status in older people State-of-the-art lecture Is ageing a disease? M. Kirby, London (GB) Saturday EAU Milan

78 Saturday, 16 March - EAU Programme Abstract Session Prostate cancer screening Brown Hall Level S2 Poster Session 1 Chairs: J.E. Hugosson, Gothenburg (SE) M.J. Roobol, Rotterdam (NL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 1 Screening for prostate cancer: Results of the Rotterdam section of the European Randomized study of Screening for Prostate Cancer (ERSPC) M.J. Roobol, C.H. Bangma, F.H. Schröder (Rotterdam, The Netherlands) 2 Incidence and mortality of prostate cancer after termination of PSA based screening A.L.A. Grenabo, E. Holmberg, S. Moss, J. Hugosson (Gothenburg, Sweden; London, United Kingdom) 3 Repeat transrectal prostate biopsies incorporating targeted anterior zone sampling is template biopsy really necessary? A. Pandit, H. Thomas, C. O Brien, J. Featherstone, N. Fenn, P. Bose (Swansea, United Kingdom) Saturday 4 Men with total PSA levels between ng/ml at initial screening have an elevated risk of future prostate cancer diagnosis: Results from the Gothenburg randomized screening trial M. Frånlund, S. Carlsson, H. Lilja, J. Hugosson (Gothenburg, Sweden; New York, United States of America) 5 Disease-specific survival of men with screen-detected prostate cancer: Comparison of first round vs second round cancers in an European randomized screening trial X. Zhu, M. Bul, L.P. Bokhorst, C.H. Bangma, F.H. Schröder, M.J. Roobol (Rotterdam, The Netherlands) 6 Serum cholesterol mediates in the mechanism of statins to prevent prostate cancer C. Konstantinidis Garay, I. Iztueta, F. Agreda, A. Celma, J.M. Bastarós, J. Placer, J. Planas, J. Morote (Barcelona, Spain) 7 PSA-Isoforms-Velocity. Evaluation of a novel approach in the early diagnosis of prostate cancer. Results from the Tyrol PSA screening project I. Heidegger, H. Klocker, V. Skradski, M. Ladurner, E. Steiner, G. Schaefer, W. Horninger, J. Bektic (Innsbruck, Austria) 8 Cost-benefit analysis in Japanese PSA screening in 5-years aged ranking K. Okihara, K. Ito, T. Miki, S. Kazuhiro, T. Iinuma (Kyoto, Maebashi, Tokyo, Japan) 9 Performance of inherited genetic markers to predict prostate biopsy outcomes in Chinese men H.W. Jiang, F. Liu, L. Zhang, H. Zhang, R. Na, X. Lin, Q. Ding, J. Xu (Shanghai, China) 10 Prospective randomized controlled trial of the role of PSA and PCA3 testing in a sequential manner in an opportunistic screening programme for prostate cancer J. Rubio Briones, J. Casanova, R. Dumont, A. Fernández-Serra, I. Casanova-Salas, J. Domínguez-Escrig, M. Ramírez-Backhaus, A. Collado, A. Gómez-Ferrer, I. Iborra, J.V. Ricós, J.L. Monrós, E. Solsona, J.A. López- Guerrero (Valencia, Spain) 11 One-year results of a multidisciplinary prostate cancer unit: Management changes in comparison with a monodisciplinary unit A. Sciarra, V. Gentile, S. Salciccia, A. Gentilucci, S. Cattarino, V. Gentile, V. Panebianco (Rome, Italy) 78 Programme Book

79 12 Discrepancies between guidelines and clinical practice regarding prostate-specific antigen (PSA) testing E.H.J. Hamoen, D.F.M. Reukers, J.O. Barentsz, M.M. Rovers, J.A. Witjes (Nijmegen, The Netherlands) Summary J.E. Hugosson, Gothenburg (SE) Saturday EAU Milan

80 Saturday, 16 March - EAU Programme Abstract Session Laparoscopy: Training, new technologies and techniques Brown Hall 3 - Level S2 Poster Session 2 Chairs: C-C. Abbou, Creteil (FR) H.G. Van Der Poel, Amsterdam (NL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 13 The laparoscopic training of the European urology residents results of a pan-european survey F. Furriel, M.P. Laguna, A.J.C. Figueiredo, P.T.C. Nunes, L.S.O. Marconi, J. Rassweiler (Coimbra, Portugal; Amsterdam, The Netherlands; Heilbronn, Germany) 14 Learning curves for urological procedures - a systematic review H. Abboudi, M. Khan, K. Guru, S. Froghi, G. De Win, H. Van Poppel, P. Dasgupta, K. Ahmed (Brighton, London, United Kingdom; Buffalo, United States of America; Antwerp, Leuven, Belgium) Saturday 15 Avoidable iatrogenic complications of urethral catheterisation and inadequate intern training: A 4-year follow up post implementation of an intern training programme J.F. Sullivan, J.C. Forde, A.Z. Thomas, T.C. Creagh (Dublin, Ireland) 16 Mental training or virtual reality simulation as enhancing methods to laparoscopic box training: A randomized controlled trial on novices P. Grange, D. Eldred-Evans, A. Chang, J. Makanjuola, M. Mulla, P. Rouse, D.M Sharma, M. Arya, S. Ayis, M. Immenroth (London, United Kingdom; Hamburg, Germany) 17 The importance of training in laparoscopic nephrectomy for residents before participating at the open procedure D.M. Dumitrache, C.S. Gutue, I.D. Chira, J. Aurelian, V. Jinga (Bucharest, Romania) 18 Achieving proficiency in robotically assisted minimally invasive surgery: The contribution of laparoscopic surgical experience in developing robotic proficiency H. Abdul-Muhsin, R. Smith, V. Patel (Celebration, United States of America) 19 Educational impact of robot assisted surgical training program S.A.A. Khan, S.J.R. Raza, K. Ahmed, R. Din, A. Stegemann, M. Bienko, A. Chowriappa, T. Kesavadas, M. Bhandari, K.A. Guru (London, United Kingdom; Buffalo, United States of America) 20 Fundamental Skills of Robotic Surgery (FSRS): A multi-institutional randomized controlled trial for validation of a simulation-based curriculum K. Ahmed, A. Stegemann, J. Syed, S. Rehman, K. Ghani, R. Autorino, M. Sharif, A. Rao, Y. Shi, G. Wilding, J. Hassett, A. Chowriappa, T. Kesavadas, J. Peabody, M. Menon, J. Kaouk, K. Guru (London, United Kingdom; Buffalo, Detroit, Cleveland, United States of America) 21 Effectiveness of 3D-imaging system on simple and suturing tasks for laparoscopic training M. Iwamura, A. Ito, A. Hoshi, A. Miyajima, K. Nakagawa, H. Kinoshita, Y. Arai, T. Terachi, S. Baba, T. Matsuda (Sagamihara, Sendai, Isehara, Tokyo, Hirakata, Japan) 22 A prospective randomized study of a new articulating laparoscopy device (Kymerax-Terumo) in the dry lab - part 1: Learning curve and objective skills assessment S. Hruby, R. Pann, R. Bernecker, Y. Landkammer, T. Schätz, L. Lusuardi, S. Jeschke, A. Wicker, G. Janetschek (Salzburg, Austria) 80 Programme Book

81 23 Evaluation of a new operating platform (ETHOS) for laparoscopic surgery in a training room setting A.S. Gözen, O. Plekhanova, A. Jalal, T. Tokas, J. Klein, J. Rassweiler (Heilbronn, Germany; Moscow, Russia) 24 Robotic-assisted laparoscopic suturing of an U-shaped ileum-neobladder with ENDOSEW - report of an experimental setting A. Martinschek, M. Ritter, E. Heinrich, L. Trojan (Ulm, Mannheim, Göttingen, Germany) 25 Magnetic tracking technology used to compare ergonomics of single site and conventional laparoscopic surgery: Preliminary results I. Georgiopoulos, L. Rentzos, I. Kyriazis, P. Kallidonis, G. Chryssolouris, E. Liatsikos (Patras, Greece) 26 Laparoendoscopic single-site versus conventional laparoscopic total extraperitoneal hernia repair - a prospective randomized clinical trial Y.C. Tsai (New Taipei City, Taiwan) Saturday EAU Milan

82 Saturday, 16 March - EAU Programme Abstract Session Male infertility: Basic science Amber Hall Level S2 Poster Session 3 Chairs: Z. Kopa, Budapest (HU) W.H.G. Weidner, Giessen (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 27 The sperm protamine mrna ratio as a clinical parameter to estimate the fertilizing potential of men taking part in an ART program N. Rogenhofer, T. Dansranjavin, M. Schorsch, A. Spiess, H. Wang, V. Von Schönfeldt, H. Cappallo-Obermann, V. Baukloh, H. Yang, A. Paradowska, B. Chen, C. Thaler, W. Weidner, H-C. Schuppe, K.S. Steger (Munich, Giessen, Wiesbaden, Hamburg, Germany; Shanghai, China) 28 Withdrawn Saturday 29 Testicular morphology and spermatozoids in hypertensive rats treated or not with enalapril G.R. Bechara, M. Simões, B. Felix-Patrício, J.L. Medeiros Jr, B.M. Gregório, D.B. De Souza, W.S. Costa, F.J. Sampaio (Rio de Janeiro, Brazil) 30 Diet rich in polyunsaturated fatty acid induces overweight but improves the testicular morphology in adult rats P.C. Silva, A. Furriel, N.C. Machado, E.F. Alves, D.B. De Souza, B.M. Gregório, F.J.B. Sampaio, W.S. Costa (Rio de Janeiro, Brazil) * 31 Significant role of TET2 and TET3 in production of fertile sperm: First evidence for link between 5-cytosine-hydroxymethylation and proper spermatogenesis T. Dansranjavin, K. Steger, J. Deuker, W. Weidner, A. Spiess, M. Schorsch, U. Schagdarsurengin (Giessen, Hamburg, Wiesbaden, Germany) 32 The depletion of H4K12ac within developmentally relevant promoters is not accompanied by alteration of DNA methylation in sperm of subfertile men. A. Paradowska-Dogan, M. Vieweg, K. Hortova, D. Miller, H-C. Schuppe, W. Weidner, K. Steger (Giessen, Germany; Prague, Czech Republic; Leeds, United Kingdom) 33 RAPGEF6 function in mouse spermatogenesis K. Okada, K. Yamaguchi, N. Enatsu, F. Li, K. Matsushita, K. Chiba, H. Miyake, K. Maeta, S. Bilasy, H. Edamatsu, T. Kataoka, M. Fujisawa (Kobe, Japan; Ismailia, Egypt) 34 Inhibin B predicts maturation arrest and sperm retrieval A. Ciudin, J.M. Corral, M.G. Diaconu, D. Gosalbez, M. Piqueras, J. Balasch, M. Guimerá, A. Carap, V. Constantin, R. Alvarez-Vijande, J.L. Ballesca, A. Alcaraz (Barcelona, Spain; Bucharest, Romania) 35 Candesartan ameliorates cisplatin induced testicular damage and change of expression pattern of testicular podocin N. Enatsu, K. Yamaguchi, K. Okada, K. Matsushita, F. Li, K. Chiba, H. Miyake, M. Fujisawa (Kobe City, Japan) 36 Withdrawn 82 Programme Book

83 37 Do serotonergic antidepressants affect semen quality? V. Boulos, H. Hassan (Cairo, Egypt) Summary: Words of wisdom: Future sperm management W.H.G. Weidner, Giessen (DE) Saturday EAU Milan

84 Saturday, 16 March - EAU Programme Abstract Session History of urology 1 Amber Hall Level S2 Poster Session 4 Chairs: A. Jardin, Paris (FR) D. Schultheiss, Giessen (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 38 The story of the stent C.P. Hobbs, J.R. Bhatt, I.R.G. Wood (Oxford, United Kingdom) 39 Historical development of diagnosis and treatment of bladder cancer M. Alsudani, A. Mohammed (Kettering, United Kingdom) 40 Watercolors to save lives: The original drawings of Étude sur le Rein des Urinaires painted by Joaquin María Albarrán to become Doctor at the Faculty of Medicine in Paris J.C. Angulo, M. Perez, I. Otero, L. Fariña, M. Fernandez (Madrid, Spain) Saturday 41 Practicing urology in Athens ( ) A. Rempelakos, C. Tsiamis, C. Alamanis, E. Poulakou-Rebelakou (Athens, Greece) 42 The evolution in our understanding of prostatic anatomy and its surgical management A. Christofides, J. Goddard (Leicester, United Kingdom) 43 Dimitrie Gerota anatomist in love with sculpture or urologist rebel against the king S. Poletajew, K. Poletajew, P. Radziszewski (Warsaw, Poland) 44 The evolution of penile fracture management over the last century: A short and snappy review! Z. Ali, S. Miah, I. Dukic, I. Pearce (Salford, Sheffield, Manchester, United Kingdom) 45 The urinary catheter; a relieving history I.R.G. Wood, C.P. Hobbs, J.R. Bhatt (Oxford, United Kingdom) 46 Turning points in world history. Did Napoleon Bonaparte have a cystitis during the battle of Waterloo and was the battle lost because of that? M. Hatzinger (Frankfurt, Germany) 47 Blood and grit: The impact of the bladder stone on history, music and science V. Sahdev, J.S. Thomas, A. Jones, P.V.S. Kumar (Reading, United Kingdom) 48 The use of sutures in urology A. Pai, P.V.S. Kumar, A. Jones (Reading, United Kingdom) 49 The rise and fall of Edward Gibbon s hydrocele F.K. Khan, W. Mahmalji, S. Madaan, I.K. Dickinson, S. Sriprasad (Kent, United Kingdom) 84 Programme Book

85 Saturday, 16 March - EAU Programme Abstract Session Urothelial cancer: Tumour biology and experimental therapies Silver Hall - Level N2 Poster Session 5 Chairs: M. Knowles, Leeds (GB) D. Theodorescu, Aurora (US) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 50 Silencing Notch-1 and Notch-3 promotes epithelial-to-mesenchymal transition (EMT) and self-renewal potential in human bladder cancer W. Jaeger, T. Hayashi, S. Awrey, K.M. Gust, T. Cordonnier, N. Li, R. Buttyan, T.H. Van Der Kwast, B.W. Van Rhijn, J.W. Thüroff, P.C. Black (Vancouver, Toronto, Canada; Frankfurt, Mainz, Germany; Amsterdam, The Netherlands) 51 Epigenetic alterations associated with neo-adjuvant chemotherapy resistance in bladder cancer A. Feber, W.S. Tan, P. De Winter, A. Freeman, K. King, P. Gurung, C. Jameson, R. Bryan, N. James, S. Beck, J. Kelly (London, United Kingdom) 52 MicroRNA expression signatures in bladder cancer: MicroRNA-145 function as a tumor suppressor and its mediated cancer pathways H. Yoshino, N. Seki, H. Hidaka, T. Yamasaki, T. Idesako, H. Enokida, M. Nakagawa (Kagoshima, Chiba, Japan) 53 A 4-miR signature in urine identifies recurrent bladder cancer in patients undergoing surveillance N. Sapre, H. Lewis, G. Macintyre, A. Kowlaczyk, A.J. Costello, N.M. Corcoran, C.M. Hovens (Melbourne, Australia) Saturday 54 Validation of TBX2, TBX3, GATA2, and ZIC4 as pta-specific prognostic bladder cancer markers W. Beukers, R. Kandimalla, R. Masius, M. Vermeij, E.C. Zwarthoff (Rotterdam, The Netherlands) 55 Circulating tumor cells and their prognostic significance in non-muscle invasive bladder cancer: A cell search analysis G.M. Busetto, A. Gradilone, C. Nicolazzo, A. Petracca, P. Gazzaniga, V. Gentile, E. De Berardinis (Rome, Italy) 56 Specific changes in the DNA methylation pattern enable an early assessment of the metastatic risk of primary bladder tumours B. Stubendorff, K. Wilhelm, S. Dubey, E. Dudziec, J.W.F. Catto, M. Gajda, M-O. Grimm, K. Junker (Jena, Homburg, Germany; Oxford, Sheffield, United Kingdom) 57 Ritonavir and bortezomib inhibit bladder cancer growth by inducing endoplasmic reticulum stress and ubiquitinated protein accumulation synergistically A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan) 58 DNA damage response (DDR) genes are predictive of response to radiotherapy for muscle invasive bladder cancer P.M.S. Gurung, N. Counsell, J. Douglas, W. Tan, A. Feber, S. Short, S. Crabb, C. West, P. Hoskin, L. Beltran, A. Freeman, T. Powles, J. Kelly (London, Southampton, Leeds, Manchester, United Kingdom) 59 Enhancement of γδ T cell antitumor activity against bladder cancer cell through 4-1BB and PD-1 mediated activation T. Suzuki, H. Yoshihide, K. Akihiro, N. Michio, Y. Shingo (Nishinomiya, Japan) EAU Milan

86 60 Genomic landscapes of BBN-induced bladder cancer in rodents, and its application to human bladder cancer: Gene amplification and overexpression of Cyp2a5/CYP2A6 in invasive bladder cancer K. Kazuhiro, F. Katsuhiro, O. Koji, K. Yae, K. Masaru, K. Kenjiro, N. Hitoshi (Nagoya, Tokyo, Japan) 61 UCyt+/ImmunoCyt and cytology in the detection of urothelial carcinoma: An update on 7,422 analyses E. Comploj, C. Mian, A. Spaltro Ambrosini, C. Dechet, S. Palermo, E. Trenti, M. Lodde, W. Horninger, A. Pycha (Bolzano, Italy; Salt Lake City, United States of America; Innsbruck, Austria) Saturday 86 Programme Book

87 Saturday, 16 March - EAU Programme Abstract Session Neuro-urology: Basic research Red Hall 1 - Level N1 Poster Session 6 Chairs: B. Uvelius, Lund (SE) A. Tubaro, Rome (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 62 A new cell in the urogenital tract - cholinergic chemosensory brush cells are sentinels of the urethra K. Filipski, K. Deckmann, T. Bschleipfer, G. Krasteva-Christ, T. Papadakis, A. Rafiq, M. Wolff, I. Ibanez-Tallon, B. Schütz, E. Weihe, W. Kummer (Giessen, Berlin-Buch, Marburg, Germany) 63 TRPV4 mediates bladder afferent pathways; a spinal c-fos study D.A.W. Janssen, J.G. Hoenderop, J.P. Heesakkers, J.A. Schalken (Nijmegen, The Netherlands) 64 Effects of silodosin, a selective α1a-adrenoceptor antagonist, on the single primary bladder afferent activity of the rat N. Aizawa, Y. Homma, Y. Igawa (Tokyo, Japan) * 65 Role of NGF in bladder inflammation-induced pain behavior and TRPV1 traffic A. Coelho, A.S. Wolf-Johnston, S. Shinde, A. Avelino, C.D. Cruz, F. Cruz, L. Birder (Porto, Portugal; Pittsburgh, United States of America) Saturday 66 Parathyroid hormone related peptide is endogenous relaxant of spontaneous detrusor smooth muscle contraction N Nishikawa, A. Kanematsu, H. Negoro, M. Imamura, Y. Sugino, T. Okinami, K. Yoshimura, H. Hashitani, O. Ogawa (Kyoto, Nishinomiya, Nagoya, Japan) * 67 Peripheral inhibition of fatty acid amide hydrolase depresses activities of single primary bladder mechanosensitive afferents of the rat N. Aizawa, C. Füllhase, P. Hedlund, Y. Homma, Y. Igawa (Tokyo, Japan; Munich, Germany; Milan, Italy) 68 Urodynamic effects of fatty acid amide (FAAH) inhibition are mediated via central nervous cannabinoid type 2 (CB2) receptors C. Füllhase, A. Giese, M. Schmidt, C. Gratzke, C. Stief, K.E. Andersson, P. Hedlund (Munich, Germany; Winston-Salem, United States of America; Milan, Italy) 69 The peripheral active fatty acid amide hydrolase (FAAH) inhibitor urb937 counteracts detrusor overactivity in two different animal models G. Gandaglia, F. Benigni, R. Buono, F. Mistretta, A. Nini, F. Castiglione, P. Hedlund (Milan, Italy) 70 Supraspinal control of urine storage and micturition in men an fmri study L. Michels, J. Wöllner, F. Gregorini, M. Kurz, T.M. Kessler, B. Schurch, S. Kollias, U. Mehnert (Zurich, Winterthur, Lausanne, Switzerland) 71 Piezo1, a novel mechanosensor in the bladder urothelium, transmits signals of bladder sensation T.M. Miyamoto, H. Nakagomi, S. Kira, T. Mochizuki, S. Koizumi, M. Tominaga, M. Takeda (Chuo, Okazaki, Japan) EAU Milan

88 72 Compensation mechanisms in bladder outlet obstruction (BOO): The heart-disease of the lower urinary tract S.H. Alloussi, G. Peters, W. Arafat, Y. Al-Bulushi, T. Blessig, C. Lang, S. Alloussi (Neunkirchen, Germany) 73 Withdrawn Saturday 88 Programme Book

89 Saturday, 16 March - EAU Programme Abstract Session Non-surgical treatment of advanced urothelial cancer Blue Hall Level N1 Poster Session 7 Chairs: J. Bellmunt, Barcelona (ES) P. Gontero, Turin (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 74 Interval between cystectomy and start of adjuvant chemotherapy is an independent prognostic factor for patients with locally advanced or lymph node positive carcinoma of the urinary bladder C.H. Ohlmann, J. Kamradt, B. Burgard, M. Saar, I. Azone, S. Siemer, M. Stöckle, J. Lehmann (Homburg, Kiel, Germany) 75 Eligibility for neoadjuvant/adjuvant cisplatin-based chemotherapy among radical cystectomy patients R.H. Thompson, S.A. Boorjian, S. Kim, J.C. Cheville, P. Thapa, R. Tarrel, I. Frank (Rochester, United States of America) 76 Risk factors for intravesical tumor recurrence in muscle-invasive bladder cancer patients treated with selective bladder-sparing approaches F. Koga, Y. Fujii, J-I. Ishioka, Y. Matsuoka, N. Numao, K. Saito, H. Masuda, S. Kawakami, K. Kihara (Tokyo, Japan) 77 Predicting responses to neoadjuvant chemotherapy for muscle invasive bladder cancers for prospective study Y. Kato, H. Zembutsu, R. Takata, K. Iwasaki, W. Obara, Y. Nakamura, T. Fujioka (Morioka, Sapporo, Japan; Chicago, United States of America) Saturday 78 Impact of renal function on eligibility for chemotherapy and survival in patients who underwent radical nephroureterectomy E.N. Xylinas, M. Rink, L.A. Kluth, V. Margulis, R.K. Lee, E. Comploj, G. Novara, J.D. Raman, Y. Lotan, A. Weizer, M. Roupret, A. Pycha, D. Scherr, C. Seitz, V. Ficarra, Q-D. Trinh, P.I. Karakiewicz, F. Montorsi, M. Zerbib, S.F. Shariat (New York, Dallas, Hershey, Ann Arbor, United States of America; Bolzano, Padua, Milan, Italy; Paris, France; Vienna, Austria; Montreal, Canada) 79 Sequential chemotherapy with gemcitabine plus carboplatin followed by additional docetaxel for aged patients with advanced bladder cancer T. Yoneyama, Y. Suzuki, N. Sugiyama, H. Yamamoto, A. Okamoto, Y. Tobisawa, T. Yoneyama, A. Imai, K. Mori, S. Hatakeyama, Y. Hashimoto, T. Koie, C. Ohyama (Hirosaki, Japan) * 80 Adjuvant radiotherapy with or without chemotherapy for advanced upper tract transitional cell carcinoma S. Park, M. Shim, D. Yoo, C. Song, B. Hong, J.H. Hong, C.S. Kim, H. Ahn (Seoul, South Korea) 81 Peri-operative chemotherapy or surveillance in upper tract urothelial cancer (POUT - CRUK/11/027) - a randomised controlled trial to define standard post-operative management A. Birtle, R. Lewis, J. Chester, J. Donovan, M. Johnson, R. Jones, R. Kockelbergh, T. Powles, R. Bryan, J. Catto, E. Jones, E. Hall (Preston, Surrey, Cardiff, Bristol, Newcastle, Glasgow, Leicester, London, Birmingham, Sheffield, United Kingdom) EAU Milan

90 82 Sequential chemotherapy with gemcitabine plus carboplatin, followed by additional docetaxel for aged patients with advanced upper-tract urothelial cancer T. Yoneyama, Y. Suzuki, N. Sugiyama, Y. Tobisawa, T. Yoneyama, A. Okamoto, H. Yamamoto, A. Imai, S. Hatakeyama, K. Mori, Y. Hashimoto, T. Koie, C. Ohyama (Hirosaki, Japan) 83 Long-term efficacy and safety outcomes of the modified (simplified) combination of methotrexate, vinblastine, doxorubicin, and cisplatin (MVAC) as front-line therapy for unresectable or metastatic urothelial cancer (UC) A. Necchi, L. Mariani, P. Giannatempo, D. Raggi, E. Farè, G. Pizzocaro, L. Piva, D. Biasoni, T. Torelli, M. Catanzaro, S. Stagni, A. Milani, A. Gianni, F. De Braud, N. Nicolai, R. Salvioni (Milan, Italy) 84 Comparative effectiveness of gemcitabine and paclitaxel versus best supportive care in metastatic urothelial carcinoma who have previously been treated with platinum based chemotherapy S. Kudou, H.Z. Zakouji, M.T. Takeda (Chuo Yamanashi, Japan) 85 Management of local recurrences in the irradiated bladder: A systematic review N. Sapre, P. Anderson, F.F. Foroudi (Melbourne, Australia) Saturday 90 Programme Book

91 Saturday, 16 March - EAU Programme Abstract Session Nephron sparing surgery and risk scoring systems Yellow Hall Level N1 Poster Session 8 Chairs: M.P. Laguna, Amsterdam (NL) P.J. Nyirády, Budapest (HU) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 86 Nephron sparing surgery for small renal masses: Are we doing our best? M. Ciuffreda, V.A.C. Ramani (Manchester, United Kingdom) 87 Morbidity, functional and oncological outcomes after nephron sparing surgery for ct2 renal tumours P. Bigot, J.F. Hetet, T. Fardoun, J. Rouffilange, E. Xylinas, G. Ploussard, I. Ouzaid, E. Robine, F. Audenet, O. Merigot De Treigny, C. Maurin, M. Ammi, S. Lebdai, L. Brureau, L. Bastien, J.A. Long, M. Roupret, Y. Neuzillet, P. Mongiat-Artus, G. Verhoest, M. Zerbib, V. Ravery, J. Rigaud, L. Bellec, H. Baumert, K. Bensalah, B. Escudier, N. Grenier, P. Paparel, N. Rioux-Leclercq, J.C. Bernhard, A-R. Azzouzi, M. Soulié, J.J. Patard (Angers, Nantes, Rennes, Bordeaux, Paris, Toulouse, Le Kremlin-Bicêtre, Suresnes, Grenoble, Lyon, France) 88 Functional results of partial nephrectomy in patients with renal tumors M.I. Volkova, V.B. Matveev, I.Y. Skvortsov (Moscow, Russia) 89 R.E.N.A.L. nephrometry score for laparoscopic partial nephrectomy in renal cell cancer and its correlation with ischemia time and complications B.M. Wrobel, C. Dogan, M.S. Erdogan, S. Deger (Ostfildern, Germany; Istanbul, Turkey) Saturday 90 Withdrawn * 91 Optimal outcome of laparoendoscopic single-site partial nephrectomy: Analysis of predictive factors in a multi-institutional dataset R. Autorino, F. Greco, L. Cindolo, T. Herrmann, E. Liatsikos, U. Nagele, J-U. Stolzenburg, K. Rha, I. Darweesh, S. Rais-Bahrami, Y. Sun, L. Richstone, L. Wang, S.T. Young, C. Springer, P. Kallidonis, L. Schips, P. Fornara, J. Kaouk (Cleveland, La Jolla, New Hyde Park, United States of America; Halle, Hanover, Leipzig, Germany; Vasto, Italy; Patras, Greece; Hall in Tirol, Austria; Seoul, South Korea; Shanghai, China) 92 Initial experience of an application of a novel high-speed 3-D image/volume analyzer to clampless partial nephrectomy Y. Komai, Y. Sakai, N. Gotohda, T. Kobayashi, N. Saito (Chiba, Japan) 93 Pathological characteristics and prognostic impact of peritumoral capsule penetration in renal cell carcinoma after tumor enucleation A. Minervini, M.R. Raspollini, A. Tuccio, C. Di Cristofano, G. Siena, M. Salvi, G. Vittori, L. Masieri, A. Raugei, A. Lapini, S. Serni, M. Carini (Florence, Rome, Italy) 94 Partial nephrectomy for metastatic renal cell carcinoma O. Stakhovskyi, Y. Vitruk, O. Voilenko, V. Kotov, P. Vukalovich, O. Yatsyna, E. Stakhovsky (Kiev, Ukraine) * 95 Management of renal cancer in a contemporary series of patients affected by Von Hippel-Lindau disease P. Destefanis, B. Lucatello, M. Maccario, A. Veltri, B. Pasini, A. Battaglia, M. Allasia, A. Gonella, A. Bosio, B. Lillaz, B. Frea, D. Fontana (Turin, Italy) EAU Milan

92 * 96 Partial nephrectomy for renal tumors of more than 7 cm: Oncological, morbidity and renal function outcomes J. Rouffilange, L. Donon, G. Capon, M. Vergnolles, O. Renard, L. Ferretti, G. Robert, G. Pasticier, P. Ballanger, J-M. Ferrière, J-C. Bernhard (Bordeaux, France) Discussion on poster 96 M.P. Laguna, Amsterdam (NL) Saturday 92 Programme Book

93 Saturday, 16 March - EAU Programme Special Session Residents Day - organised by the Young Urologists Office (YUO) in collaboration with the European Society of Residents in Urology (ESRU) Red Hall 2 - Level N1 Chairs: J.P.M. Sedelaar, Nijmegen (NL) Z. Tandogdu, Istanbul (TR) Introduction T. Esen, Istanbul (TR) J.P.M. Sedelaar, Nijmegen (NL) Z. Tandogdu, Istanbul (TR) Laparoscopy and robot during training Moderators: F. Furriel, Coimbra (PT) S. Hruby, Salzburg (AT) Robot assisted laparoscopy training for young trainees A. Mottrie, Aalst (BE) Basic skills video presentation for laparoscopy B.S.E.P. Van Cleynenbreugel, Leuven (BE) Post residency training Saturday Moderators: S. Larré, Reims (FR) M. Sochaj, Lodz (PL) European experience and pathway A.G. Van Der Heijden, Nijmegen (NL) North American experience and pathway G. Godoy, New York (US) Global scholarship opportunities H. Fajkovic, St. Pölten (AT) European Urology Scholarship Programme (EUSP) scholarship opportunities S. Larré, Reims (FR) Post-residency life Moderators: L.G. Martinez Bustamante, Koper (SI) J.P.M. Sedelaar, Nijmegen (NL) Academic urology S. Al-Hayek, Cambridge (GB) Private practice E.B. Cornel, Hengelo (NL) EAU Milan

94 Debate: Academic and private practice Panel: S. Al-Hayek, Cambridge (GB) E.B. Cornel, Hengelo (NL) L.G. Martinez Bustamante, Koper (SI) J.P.M. Sedelaar, Nijmegen (NL) The present and the future of the young urologist in Europe The current status of young urologists in Europe: Results of a survey F. Sanguedolce, Barcelona (ES) Comments from the panel on the present and future of young urologists Panel: T. Esen, Istanbul (TR) V. Mirone, Naples (IT) J. Palou, Barcelona (ES) What is the future for young urologists? Panel: T. Esen, Istanbul (TR) V. Mirone, Naples (IT) J. Palou, Barcelona (ES) F. Sanguedolce, Barcelona (ES) Campbell Team Challenge Quiz Saturday Quizmasters: Panel: T.N. Garmanova, Moscow (RU) J.L. Vasquez, Copenhagen (DK) L. Lund, Viborg (DK) M. Marberger, Vienna (AT) Break Progress in guidelines evidence analysis: An update K.F. Parsons, Liverpool (GB) What does a resident need to know? Moderators: K. Hendricksen, Nijmegen (NL) P.P. Swiniarski, Bydgoszcz (PL) Introduction K. Hendricksen, Nijmegen (NL) P.P. Swiniarski, Bydgoszcz (PL) Curriculum Presentation S. Müller, Bonn (DE) Debate: What should be the limits of residency training? Do you have to know it all? Are there upper and lower limits? Panel: M. Brehmer, Stockholm (SE) H.M. Çek, Istanbul (TR) S. Müller, Bonn (DE) H. Van Poppel, Leuven (BE) 94 Programme Book

95 What is the evidence? Moderators: C.G.A. Ruf, Hamburg (DE) M. Skrodzka, Białystok (PL) Oncology: How to do a TRUS guided prostate biopsy L.N. Türkeri, Istanbul (TR) Mini-Perc technique O. Traxer, Paris (FR) Genitourinary infections: Wise antibiotic use in urology patients F.M.E. Wagenlehner, Giessen (DE) Paediatrics: Trends in paediatric endourology M.S. Silay, Istanbul (TR) Infertility: Diagnostic approach to an infertile couple J.O.R. Sonksen, Herlev (DK) Functional urology: Sling surgery, indications, tips and tricks M.J. Drake, Bristol (GB) Nightmare session: Presentations of clinical problems that have perplexed residents Case presentators: Panel: T. Oedekoven, Memmingen (DE) S. Reinhardt, Herlev (DK) S.M. Monagas Arteaga, León (ES) T.E. Bjerklund Johansen, Århus (DK) T. Esen, Istanbul (TR) M. Fode, Herlev (DK) Saturday Prizes and awards EAU Milan

96 Saturday, 16 March - EAU Section Meetings Meeting of the EAU Section of Uro-Technology (ESUT) in cooperation with ERUS and EULIS What is new in endourology, laparoscopy and robotics euro Auditorium - Level S2 Chair: J. Rassweiler, Heilbronn (DE) Live broadcasts from the Department of Urology, San Raffaele Turro Hospital, Vita-Salute San Raffaele University Coordinators at San Raffaele A. Breda, Barcelona (ES) A. Cestari, Milan (IT) E. Liatsikos, Patras (GR) Coordinators in euro Auditorium V. Bucuras, Timisoara (RO) T. Frede, Müllheim (DE) R. Muschter, Rotenburg (DE) Saturday Welcome and introduction ESUT J. Rassweiler, Heilbronn (DE) ERUS P. Wiklund, Stockholm (SE) EULIS P.J. Osther, Fredericia (DK) Ethics of live surgery / Cases from last year W. Artibani, Verona (IT) A. Hoznek, Creteil (FR) Live surgery Part 1 Moderators: C-C. Abbou, Creteil (FR) T. Knoll, Sindelfingen (DE) J. Rassweiler, Heilbronn (DE) P. Wiklund, Stockholm (SE) LESS robotic pyeloplasty G. Guazzoni, Milan (IT) D retroperitoneal laparoscopic partial nephrectomy J-U. Stolzenburg, Leipzig (DE) Laparoscopic radical nephrectomy - the Gazi technique L. Tunc, Ankara (TR) Robotic partial nephrectomy - the standard technique A. Mottrie, Aalst (BE) Retrograde management of a stone in a caliceal diverticulum O. Traxer, Paris (FR) Flexible ureteroscopy and supine PCNL A. Breda, Barcelona (ES) G. Giusti, Milan (IT) 96 Programme Book

97 Laparoscopic decompression of pudendal nerve (video) T. Erdogru, Istanbul (TR) Live surgery part 2 Moderators: W. Artibani, Verona (IT) P. Dasgupta, London (GB) M.P. Laguna, Amsterdam (NL) A. Skolarikos, Athens (GR) RALP in advanced stage (part 1) P. Wiklund, Stockholm (SE) NOTES - nephrectomy with 3D A. Alcaraz, Barcelona (ES) M.J. Ribal, Barcelona (ES) Mini-laparoscopic pyeloplasty F. Porpiglia, Turin (IT) Robot-assisted extended pelvic lymph node dissection in prostate cancer P.T. Piechaud, Bordeaux (FR) NBI, PDD and digital endoscopy of the bladder B. Malavaud, Toulouse (FR) PDD, SPIES-imaging and bipolar resection of a bladder tumour - new techniques A. Lapini, Florence (IT) Live surgery Part 3 Moderators: C.M. Annerstedt, Herlev (DK) M. Burchardt, Greifswald (DE) J.J.M.C.H. De La Rosette, Amsterdam (NL) M.S. Michel, Mannheim (DE) Saturday RALP in advanced stage (part 2) P. Wiklund, Stockholm (SE) Greenlight laser of the prostate A. Bachmann, Basel (CH) A. Tubaro, Rome (IT) Urolift for BPH K-D. Sievert, Tübingen (DE) H. Woo, Sydney (AU) D - LESS - nephrectomy E. Liatsikos, Patras (GR) TULEP procedure L. Camignani, Milan (IT) Prostate vaporisation J. Pfitzenmaier, Bielefeld (DE) Robot-assisted ureteroscopy (video) R. Saglam, Ankara (TR) EAU Milan

98 ICG-assisted pelvic lymph node dissection (video) G. Janetschek, Salzburg (AT) Conclusion R.F. Van Velthoven, Brussels (BE) Aims and objectives Following a more than 10 year tradition of live surgery sessions, the EAU Section of Uro-Technology (ESUT) presents an ambitious programme focussing on novel techniques in percutaneous, endourological, laparoscopic, and robotic-assisted procedures. This year, with What is new in endourology, laparoscopy and robotics we want to focus on novel technology improving the performance of video-assisted surgery in all fields of urology. This session is conducted in collaboration with the EAU Section of Robotic Surgery in Urology (ERUS) and the EAU Section of Urolithiasis (EULIS). In the laparoscopic and robot-assisted cases, we will compare new access techniques (LESS versus SMART/ Mini-LAP versus NOTES) as well as new instruments and devices (3D imaging) improving the ergonomics of laparoscopy. Finally, the latest digital developments for flexible endoscopy of the upper urinary tract for diagnosis and treatment of tumours and calculi are demonstrated also in combination with supine PCNL using the novel split screen technology. Saturday The meeting faculty consists of internationally well-known experts serving as surgeons and moderators. The different surgical procedures will be transmitted from the San Raffaele Hospital, University of Milan in high definition quality. A split-screen will allow the delegates to follow the uncommented procedures. Traditionally, the format of ESUT live surgery will allow all delegates to directly communicate with the surgeons to ask questions and to discuss every aspect of the procedure. Moreover, the ESUT session will be available online. Supported by unrestricted educational grants from COOK, INTUITIVE SURGICAL, IPSEN, KARL STORZ GMBH & CO.KG, NEOTRACT, OLYMPUS, QUANTA SYSTEM, ROCAMED 98 Programme Book

99 Saturday, 16 March - EAU Section Meetings Meeting of the EAU Section of Female and Functional Urology (ESFFU) and the EAU Section of Urological Imaging (ESUI) Imaging in female and functional urology Brown Hall Level S2 Chairs: J.P.F.A. Heesakkers, Nijmegen (NL) J. Walz, Marseille (FR) Introduction J.P.F.A. Heesakkers, Nijmegen (NL) J. Walz, Marseille (FR) Female urology Chairs: F.R. Cruz, Porto (PT) C. Trombetta, Trieste (IT) How to visualise the female pelvic floor? Ultrasound M.X. Ferreira Coelho, Lisbon (PT) MRI M. Halaska, Prague (CZ) Saturday Video urodynamics P.F.W.M. Rosier, Utrecht (NL) What is new in the management of: Stress urinary incontinence? D.J.M.K. De Ridder, Leuven (BE) Pelvic organ prolapse? W. Artibani, Verona (IT) How to evaluate results after incontinence and prolapse surgery? Imaging in the evaluation of incontinence and prolapse surgery T. Loch, Flensburg (DE) How to correct complications after incontinence and prolapse surgery? E. Petri, Greifswald (DE) Functional urology and male incontinence Chairs: D.M Castro-Diaz, Santa Cruz de Tenerife (ES) P.A. Geavlete, Bucharest (RO) EAU Milan

100 Male incontinence Imaging for post-prostatectomy incontinence P.A. Geavlete, Bucharest (RO) Management of post-prostatectomy incontinence R. Bauer, Munich (DE) Overactive bladder and LUTS Imaging as a non-invasive diagnostic tool in LUTS H. Wijkstra, Amsterdam (NL) Imaging in the management of overactive bladder F. Farag, Nijmegen (NL) What is new in the management of LUTS and OAB? P. Radziszewski, Warsaw (PL) Break EAU Section of Urological Imaging (ESUI) Chairs: B.M. Carey, Leeds (GB) J. Walz, Marseille (FR) Saturday ESUI Vision Award 2013 Sponsored by an unrestricted educational grant from HITACHI MEDICAL SYSTEMS EUROPE What is new in imaging in 2013? Prostate H. Heynemann, Halle/Saale (DE) Kidney; Bladder S. Siracusano, Trieste (IT) Lymph nodes; Testis and penis G. Salomon, Hamburg (DE) EAU Section of Female and Functional Urology (ESFFU) What is new in neurourology in 2013? Chair: J.P.F.A. Heesakkers, Nijmegen (NL) FMRI T.M. Kessler, Zürich (CH) New treatment options R. Hamid, London (GB) Summary J.P.F.A. Heesakkers, Nijmegen (NL) J. Walz, Marseille (FR) 100 Programme Book

101 Aims and objectives The role of imaging in the study of female pelvic floor is fundamental. Every urologist has to know how to visualise the female pelvic floor by means of ultrasound, MRI and video urodynamics. Moreover today imaging is also mandatory in the evaluation of female incontinence and prolapse surgery, male incontinence, overactive bladder and LUTS expecially to evaluate the results of more recent surgical and non surgical therapies. During the session the ESUI Vision Award will be given to the author of the most innovative imaging study published in the last year. Saturday EAU Milan

102 Saturday, 16 March - EAU Section Meetings Meeting of the EAU Section of Urolithiasis (EULIS) Urolithiasis - on our way to personalised management Brown Hall 3 - Level S2 Chair: P.J. Osther, Fredericia (DK) Introduction P.J. Osther, Fredericia (DK) Increasing stone prevention compliance through patient education Moderators: T. Bach, Hamburg (DE) S. Oehlschläger, Dresden (DE) J.M. Reis Santos, Lisbon (PT) How precisely do we really inform our patients regarding pathophysiology, nutrition and medication? B. Hess, Zurich (CH) Rapid screening of diet in renal stone formers A. Trinchieri, Lecco (IT) Saturday Modulation of urolithiasis risk through lifestyle changes: An internet based tool for patient selfmanagement D.J. Kok, Rotterdam (NL) Role of stone analysis in the personalised management of upper urinary tract stone disease Moderators: H-M. Fritsche, Regensburg (DE) C.M. Scoffone, Turin (IT) R. Siener, Bonn (DE) Recent changes in renal stone compositions: Data from over 2000,000 stone analyses T. Knoll, Sindelfingen (DE) Imaging for pre-treatment evaluation of stone composition and fragility J.C. Williams, Indianapolis (US) ERA lecture: How can stone analysis guide you towards effective metaphylaxis? G. Gambaro, Rome (IT) Complications in stone management: Individualised treatment strategies besed on case presentations: Metabolic/medical headaches; SWL catastrophes; Nightmare scenarios of endoscopic stone removal Moderators: Panel: P.J. Osther, Fredericia (DK) J. Rassweiler, Heilbronn (DE) N.N-P. Buchholz, London (GB) J.J.M.C.H. De La Rosette, Amsterdam (NL) F. Keeley, Bristol (GB) S. Lahme, Pforzheim (DE) K. Sarica, Istanbul (TR) A. Skolarikos, Athens (GR) M. Straub, Munich (DE) H.G. Tiselius, Stockholm (SE) 102 Programme Book

103 Announcements and final remarks P.J. Osther, Fredericia (DK) Aims and objectives The stone disease is extremely diverse from single stone formers with spontaneous stone passage to staghorn stones and stone diseases associated with severe metabolic abnormalities such as renal tubular acidosis and primary hyperoxaluria. It is obvious that these different conditions should be dealt with selectively. For elimination of stones present in the upper urinary tract we have a multitude of modalities including SWL, PCNL, flexible and semirigid URS, litholysis etc. Recent years have brought us powerful tools to select the right patient for the right treatment. In this EULIS session we will explore into the modern concept of personalised stone management including life-style management, role of imaging and stone analysis as well as individualised complication management. Saturday EAU Milan

104 Saturday, 16 March - EAU Section Meetings Meeting of the EAU Section of Transplantation Urology (ESTU) Improving outcomes in kidney transplantation Red Hall 1 - Level N1 Chairs: A.J. Figueiredo, Coimbra (PT) E. Lledo García, Madrid (ES) Introduction A.J. Figueiredo, Coimbra (PT) E. Lledo García, Madrid (ES) Organ donation Moderators: F.J. Burgos Revilla, Madrid (ES) K. Dreikorn, Bremen (DE) National Spanish Consensus Document of expanded criteria donor kidneys E. Lledo García, Madrid (ES) Saturday NHBD: Technique of organ retrieval and choice of the optimal recipient C. Terrone, Turin (IT) Altruistic paired donation: Where do we stand? O. Rodriguez Faba, Barcelona (ES) Matching of donor and recipient: Immunology, age, BMI, gender F.J. Burgos Revilla, Madrid (ES) Discussion Immunology Moderators: E. Lledo García, Madrid (ES) P. Di Tonno, Bari (IT) Transplant tolerance: Myth or reality? A.B. Chkhotua, Tbilisi (GE) Protocol biopsies - when, how, why / complications and management A.J. Figueiredo, Coimbra (PT) CMV in KTX - prophylaxis and therapy F. Kleinclauss, Besançon (FR) Attitude towards the non-functioning graft: Removal or persistence? P.T. Coelho Nunes, Coimbra (PT) Discussion Management of the transplanted patient Moderators: A.J. Figueiredo, Coimbra (PT) M. Giessing, Düsseldorf (DE) 104 Programme Book

105 Robotic prostatectomy after KTX G. Karam, Nantes (FR) Psychological impact and QoL of recipients of deceased donor kidneys V. Gomez, Madrid (ES) Dermatology: Skin cancer and KTX S. Piaserico, Padova (IT) Discussion Closing remarks A.J. Figueiredo, Coimbra (PT) E. Lledo García, Madrid (ES) Aims and objectives Organ transplantation is a fascinating area of medicine and advances come about in several complementary fields. All starts in donation and there are many ways of increasing the number of donors, both deceased ones and living donors. Advances in the understanding of transplant immunology are fundamental for achieving better results. On top of all that, looking beyond the graft in the management of the transplanted patient is paramount for the success of the transplantation. Saturday EAU Milan

106 Saturday, 16 March - EAU Section Meetings Meeting of the EAU Section of Infections in Urology (ESIU) and the EAU Section of Andrological Urology (ESAU) Urogenital infections and andrology Yellow Hall Level N1 Chairs: T.E. Bjerklund Johansen, Århus (DK) W.H.G. Weidner, Giessen (DE) Welcome and introduction T.E. Bjerklund Johansen, Århus (DK) ESIU: 10 years GPIU anniversary programme Chairs: M. Grabe, Malmö (SE) P. Tenke, Budapest (HU) Urosepsis - the real emergency F.M.E. Wagenlehner, Giessen (DE) Saturday Fournier s gangrene - the most lethal acute situation R. Bartoletti, Florence (IT) Use of antibiotics and the role of guidelines Z. Tandogdu, Istanbul (TR) Prevalence, susceptibility and resistance in urogenital infections H.M. Çek, Istanbul (TR) Prevention and control of antimicrobial resistance in Europe: The role of ECDC D. Monnet, Stockholm (SE) Discussion Joint session ESIU and ESAU: Urogenital infections in andrology Chairs: ESIU K.G. Naber, Straubing (DE) ESAU D. Ralph, London (GB) Prostatitis R.S. Pickard, Newcastle upon Tyne (GB) Epididymo-orchitis and male infertility N. Sofikitis, Ioannina (GR) Infections of the penile shaft and outcome for sexual function C. Bettocchi, Bari (IT) 106 Programme Book

107 Discussion ESAU: News for the andrologist in 2013 Chairs: N. Sofikitis, Ioannina (GR) E. Wespes, Charleroi (BE) Varicocele therapy improves the male fertility status: What is proven? G.R. Dohle, Rotterdam (NL) Metabolic syndrome and erectile dysfunction/hypogonadism E.J.H. Meuleman, Amsterdam (NL) New drugs in male infertility, ejaculatory and erectile dysfunction F. Fusco, Naples (IT) Whats is new in Peyronie s disease? A. Kadioglu, Istanbul (TR) New aspects of sexual medicine for the andrological urologist E.A. Jannini, L Aquila (IT) Discussion Conclusion W.H.G. Weidner, Giessen (DE) Aims and objectives This joint section session will provide an up-to-date discussion of the most lethal infective complications in urology, raising antimicrobial resistance and the prudent use of antibiotics. Infections and infective complications in all male sex organs will be discussed from an infectious and andrological perspective. An extensive update will be given on the most important topics in andrology like varicocele, metabolic syndrome, erectile dysfunction, Peyronie`s disease and sexual medicine. All topics will be addressed by key international experts and opinion leaders. Saturday Upon the completion of this joint session, the delegates will know how to deal with urosepsis and Fournier`s gangrene and understand the basis for prudent use of antibiotics. The delegates will be educated on how to avoid and treat infective complications in andrological surgery and be familiar with state of the art diagnostic work-up and treatment of the most important conditions in andrology. EAU Milan

108 Saturday, 16 March - EAU Section Meetings Joint Meeting of the European Organisation for Research and Treatment of Cancer Genito- Urinary Cancer Group (EORTC GUCG), the EAU Section of Urological Research (ESUR), the EAU Section of Oncological Urology (ESOU) and the EAU Section of Uropathology (ESUP) Silver Hall - Level N EORTC GUCG Group and ESUR: Personalised medicine Chairs: Z. Culig, Innsbruck (AT) B. Tombal, Brussels (BE) Introduction Z. Culig, Innsbruck (AT)) B. Tombal, Brussels (BE) Saturday Personalised medicine in prostate cancer T. Van Der Kwast, Toronto (CA) EORTC risk calculator and beyond; How to improve strategies to individualise therapy in NMIBC R.J. Sylvester, Brussels (BE) Personalised approach in renal cancer B. Escudier, Villejuif (FR) Personalising surgery in advanced renal cell carcinoma A. Bex, Amsterdam (NL) Individual approach in bladder cancer D. Theodorescu, Aurora (US) Postoperative radiotherapy after radical prostatectomy: What has been learned from prospective trials and will never be learned from retrospective ones? N.W. Clarke, Manchester (GB) Close Z. Culig, Innsbruck (AT)) B. Tombal, Brussels (BE) ESOU and ESUP: Clinical forum in prostate and renal cancer Chairs: M. Brausi, Modena (IT) A. Lopez-Beltran, Cordoba (ES) Introduction M. Brausi, Modena (IT) A. Lopez-Beltran, Cordoba (ES) 108 Programme Book

109 Clinical forum: Diagnosis and treatment of small foci of PCa Moderator: M. Brausi, Modena (IT) New tools for diagnosis G. Villeirs, Ghent (BE) Pathologic characteristics of low risk PCa: Multifocality and prognostic factors R. Montironi, Torrette Di Ancona (IT) Treatments of low risk PCa B. Djavan, Vienna (AT) Discussion Clinical forum: Locally advanced renal cancer Moderator: A. Lopez-Beltran, Cordoba (ES) The role of biopsy in renal masses A. Volpe, Novara (IT) Pathological prognostic factors F. Algaba, Barcelona (ES) Treatment of small renal masses H.A. Özen, Ankara (TR) Discussion Close Saturday M. Brausi, Modena (IT) A. Lopez-Beltran, Cordoba (ES) Aims and objectives EORTC GUCG and ESUR: Clinical trials should be based on targeting molecules which are overexpressed in a disease and functionally associated with its development and progression. In several human cancers, expression of target candidates is specific in individual patient tissues and not the same in primary lesions and metastases of one patient. The purpose of the joint session is to convince the audience that biologically-based clinical trials should be carried out. Results obtained with experimental models open the ways to use novel agents in cancer therapy, however there should be an appropriate information about expression of possible targets and related signaling pathways in clinical specimens available. In addition, new trial methodologies will have to be developed to clinically assess the response of the cancer to these drugs. This will be done by embedding traditional endpoints, such as progression free survival and overall survival, with modern functional imaging endpoints. EAU Milan

110 Saturday, 16 March - EAU Section Meetings Meeting of the EAU Section of Genito-Urinary Reconstructive Surgeons (ESGURS) Urethral reconstruction and complication management after radical prostatectomy Blue Hall Level N1 Chair: S. Deger, Ostfildern (DE) Debate: Dorsal versus ventral grafting for urethroplasty Moderator: M.M. Fisch, Hamburg (DE) Dorsal grafting D.E. Andrich, London (GB) Ventral grafting, when and why? E. Palminteri, Arezzo (IT) Saturday Closing remarks from chair and panel D.E. Andrich, Kingston upon Thames (GB) M.M. Fisch, Hamburg (DE) A.R. Mundy, London (GB) E. Palminteri, Arezzo (IT) Part 2 Moderators: B.M. Alici, Istanbul (TR) O.Z. Shenfeld, Jerusalem (IL) Failed IPP surgery R.P. Djinovic, Belgrade (RS) Management of cavernosal tissue fibrosis after failed IPP treatment I. Moncada, Madrid (ES) Hypospadias cripple - which techniques are optimal for initial repair and re-dos A. Zhivov, St. Petersburg (RU) Part 3 Moderators: S. Deger, Ostfildern (DE) O. Demirkesen, Istanbul (TR) The posterior urethral complications of the treatment of prostate cancer A.R. Mundy, London (GB) Endoscopic management of vesicourethral anasthomosis contracture? York-Mason procedure with buccal mucosa for a recto urinary fistula V. Pansadoro, Rome (IT) Discussion A tribute to Edoardo Austoni, the urologist; a man; our friend V. Pansadoro, Rome (IT) 110 Programme Book

111 Part 4 Moderators: D.E. Andrich, London (GB) K-D. Sievert, Tübingen (DE) Grafts in urethral reconstruction: Which grafts? How to harvest? N. Lumen, Ghent (BE) Penile skin replacement with reversed mesh graft P. Hoebeke, Ghent (BE) First results of the urethroplasty with tissue engineered buccal mucosa R. Dahlem, Hamburg (DE) Buccal mucosa after radiation therapy? S. Ahyai, Hamburg (DE) ESGURS activities S. Deger, Ostfildern (DE) Aims and objectives We want to share new developments in grafts for urethral reconstruction and go for an interesting debate on dorsal versus ventral grafting. Penile surgery for IPP will be another interesting part. Facing complications for radical prostatectomy can always be challenging. Options and tips will be presented from experts. Saturday EAU Milan

112 Saturday, 16 March - EAU Programme Special Session Urology in Italian art Green Hall 1 - Level N1 Chair: D. Schultheiss, Giessen (DE) State-of-the-art-lecture Castrati singers and the birth of opera M. Hatzinger, Frankfurt (DE) State-of-the-art-lecture Urological aspects in the anatomical work of Leonardo da Vinci D. Schultheiss, Giessen (DE) State-of-the-art-lecture The phallus in Italian art J. Mattelaer, Kortrijk (BE) Saturday 112 Programme Book

113 Saturday, 16 March - EAU Programme Abstract Session LESS & NOTES Platinum Hall - Level S3 Video Session 1 Chairs: H-P. Beerlage, s-hertogenbosch (NL) R. Rabenalt, Düsseldorf (DE) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V1 V2 V3 Clampless laparoendoscopic single-site partial nephrectomy for renal cancer with low PADUA score: Technique and surgical outcomes F. Greco, D. Veneziano, C. Springer, A. Inferrera, P. Fornara (Halle Saale, Germany) Robotic transrectal hybrid NOTES nephrectomy: Initial experience in a cadaver model R. Eyraud, H. Laydner, R. Autorino, S. Hillyer, J.A. Long, K. Panumatrassamee, A. Khalifeh, R. Stein, G.P. Haber, J. Kaouk (Cleveland, United States of America) First clinical application: Transvaginal hybrid NOTES robotic donor nephrectomy R. Autorino, A. Khalifeh, H. Laydner, S. Hillyer, D. Samarasekera, K. Panumatrassamee, H. Goldman, C. Modlin, J. Kaouk (Cleveland, United States of America) V4 V5 Hybrid transvaginal nephrectomy: Development of our technique I. Georgiopoulos, P. Kallidonis, I. Kyriazis, J-U. Stolzenburg, E. Liatsikos (Patras, Greece; Leipzig, Germany) Umbilical laparoendoscopic radical nephrectomy (LESS-RN) with KeyPort system and duo-rotate instruments P.M. Cabrera, F. Caceres, E. Mateo, J.M. Garcia-Mediero, F. Lista, J.C. Angulo (Madrid, Spain) Saturday V6 V7 V8 V9 Laparo-endoscopic single site transvesical bladder cuff excision R. Sotelo Noguera, G. Fernandez, J. Arriaga, O. Carmona, R. De Andrade, C. Giedelman, Z. Pascal, B. Irwin, A. Monish, M. Desai, I. Gill, J. Saavedra (Caracas, Venezuela; Los Angeles, United States of America) Umbilical radical nephroureterectomy, bladder cuff excision and lymphadenectomy with KeyPort system in a case of upper urinary tract urothelial cancer F. Caceres, P. Cabrera, A. García-Tello, G. Andres, E. Mateo, J.C. Angulo (Madrid, Spain) Laparoendoscopic radical cystectomy with orthotopic ileal neobladder through umbilical single port F. Caceres, P.M. Cabrera, A. Garcia-Tello, I. Arance, I. Romero, J.C. Angulo (Madrid, Spain) LESS partial cystectomy with extended pelvic lymph node dissection for invasive bladder cancer in a diverticulum P.M. Cabrera, F. Caceres, F. Ramon De Fata, A. Garcia-Tello, H. Gimbernat, J.C. Angulo (Madrid, Spain) EAU Milan

114 Saturday, 16 March - EAU Programme Abstract Session New therapies in castration resistant prostate cancer Brown Hall Level S2 Poster Session 9 Chairs: T.A. Borkowski, Warsaw (PL) M. De Santis, Vienna (AT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 97 Updated interim analysis (IA): Results of randomized phase 3 study COU-AA-302 of abiraterone acetate (AA) in metastatic castration-resistant prostate cancer (mcrpc) patients (pts) without prior chemotherapy H. Van Poppel, D. Rathkopf, M.R. Smith, J.S. De Bono, C.J. Logothetis, N.D. Shore, P. De Souza, K. Fizazi, P.F.A. Mulders, P. Mainwaring, J.D. Hainsworth, T.M. Beer, S. North, Y. Fradet, T. Griffin, Y.C. Park, T. Kheoh, E.J. Small, H.I. Scher, A. Molina, C.J. Ryan (Leuven, Belgium; New York, Boston, Houston, Myrtle Beach, Nashville, Portland, Los Angeles, Raritan, San Francisco, United States of America; Sutton, United Kingdom; Liverpool, Brisbane, Australia; Villejuif, France; Nijmegen, The Netherlands; Edmonton, Quebec, Canada) Saturday * 98 Combination therapy of peptide vaccines and dexamethasone for chemotherapy naïve castration resistant prostate cancer - a randomized phase-2 study H. Uemura, T. Kimura, K. Yoshimura, T. Minami, M. Nozawa, T. Nakagawa, H. Fujimoto, S. Egawa, A. Yamada, K. Itoh (Osaka, Tokyo, Fukuoka, Japan) 99 The impact of bone metastases on pain: Results from a phase III denosumab study in men with nonmetastatic castration-resistant prostate cancer D. Patrick, M.R. Smith, C. Cleeland, L. Fallowfield, B. Tombal, S. Oudard, N. Shore, F. Saad, G. Marx, R. Coleman, F. Gómez-Veiga, R. Damião, Y. Zhou, J. Arellano, A. Braun, Y. Qian (Seattle, Boston, Houston, Myrtle Beach, Thousand Oaks, United States of America; Brighton, Sheffield, United Kingdom; Brussels, Belgium; Paris, France; Montreal, Canada; Wahroonga, Australia; A Coruna, Spain; Rio de Janeiro, Brazil) 100 Investigational single agent orteronel (ortl, TAK-700) in patients with nonmetastatic castration-resistant prostate cancer (nmcrpc): Updated results M. Hussain, P.G. Corn, D. Michaelson, H.J. Hammers, J.J. Alumkal, C.J. Ryan, J.Y. Bruce, S. Moran, D. Maclean, S-Y. Lee, P. Mortimer, D.J. George (Ann Arbor, Houston, Boston, Baltimore, Portland, San Francisco, Madison, Cambridge, Durham, United States of America; London, United Kingdom) 101 Updated analysis of radium-223 dichloride (Ra-223) impact on pain, skeletal-related events (SRE), and survival from the phase 3 randomized trial (ALSYMPCA) in patients with castration-resistant prostate cancer (CRPC) and bone metastases D. Heinrich, S.I. Helle, A. Chodacki, P. Wiechno, J. Garcia-Vargas, K. Staudacher, C. Parker (Lørenskog, Bergen, Oslo, Norway; Chomutov, Czech Republic; Warsaw, Poland; Montville, New Jersey, United States of America; Sutton, United Kingdom) 102 GTx-758, an ERα agonist, reduces serum free testosterone lower than can be achieved by leuprolide with a significantly lower rate of hot flashes in men with advanced prostate cancer R.H. Getzenberg, C.C. Coss, M.L. Hancock, J.T. Dalton, M.S. Steiner (Memphis, United States of America) 103 P10-1 open-label, multicenter study of sipuleucel-t in metastatic castrate-resistant prostate cancer (mcrpc) patients (pts) previously treated with sipuleucel-t: Evaluation of antigen-presenting cell (APC) activation and cellular immune response data T.M. Beer, J. Corman, R. Sims, Y. Wang, C. De La Rosa, N. Sheikh (Portland, Seattle, United States of America) 114 Programme Book

115 104 Overall survival with cabazitaxel is strongly related to PSA response: Results of a retrospective registry in metastatic castration resistant prostate cancer (mcrpc) A. Angelergues, F. Mercier, A. Flechon, A. Guillot, S. Le Moulec, G. Gravis, P. Beuzeboc, C. Massard, K. Fizazi, T. De La Motte Rouge, R. Elaidi, S. Oudard (Paris, Port-Mort, Lyon, St-Etienne, Marseille, Villejuif, France) 105 Exploratory analysis of the visceral disease patient subset in COU-AA-301, a phase III study of abiraterone acetate (AA) in metastatic castration-resistant prostate cancer (mcrpc) H. Suttmann, P.F.A. Mulders, A. Molina, O.B. Goodman, Jr., T.W. Flaig, J. Li, T. Kheoh, J.S. De Bono, H.I. Scher (Hamburg, Germany; Nijmegen, The Netherlands; Los Angeles, Las Vegas, Aurora, Raritan, New York, United States of America; Sutton, United Kingdom) 106 Cabazitaxel adverse events are manageable in senior adults with metastatic castration-resistant prostate cancer (mcrpc): Results of the European Compassionate Use Programme A. Heidenreich, S. Bracarda, M. Mason, H. Ozen, L. Sengelov, W. Gerritsen, C. Papandreou, S. Fossa, S. Hitier, M. Climent (Aachen, Germany; Arezzo, Italy; Wales, United Kingdom; Ankara, Turkey; Herlev, Denmark; Nijmegen, The Netherlands; Larissa, Greece; Olso, Norway; Paris, France; Valencia, Spain) 107 Evaluation of circulating tumor cells to predict metastatic progression in men treated with abirateron acetat for castration resistant prostate cancer: A sub-analysis of the German named patient program T. Steuber, P. Stroelin, T. Schlomm, H. Heinzer, K. Pantel, S. Riethdorf (Hamburg, Germany) 108 Denosumab in men with non-metastatic castration-resistant prostate cancer (CRPC) and PSA doubling time (PSADT) 6 months K. Miller, M.R. Smith, D. Dearnaley, L. Dogliotti, B. Egerdie, K. Fizazi, F. Kueppers, L. Montes De Oca, J. Morote, I. Pavlik, P. Sieber, T.L. Tammela, H. Van Poppel, M. Wirth, S. Wong, Z. Ye, A. Braun (Berlin, Dresden, Germany; Boston, Lancaster, Thousand Oaks, United States of America; Sutton, United Kingdom; Orbassano, Italy; Kitchener, Canada; Villejuif, France; Christchurch, New Zealand; Buenos Aires, Argentina; Barcelona, Spain; Prague, Czech Republic; Tampere, Finland; Leuven, Belgium; Footscray, Australia) Saturday EAU Milan

116 Saturday, 16 March - EAU Programme Abstract Session Pelvic organ prolapse: From bench to bedside Amber Hall Level S2 Poster Session 10 Chairs: V. Gomez Dos Santos, Madrid (ES) F. Haab, Paris (FR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 109 In vivo assessment of the acute host response against a novel tissue engineered to treat stress urinary incontinence and pelvic organ prolapse S. Roman, N. Osman, A.J. Bullock, C.R. Chapple, S. Macneil (Sheffield, United Kingdom) 110 Development of tissue engineered bio-absorbable cellularised mesh for stress urinary incontinence and pelvic organ prolapse: The effect of chemical and mechanical stimulation on improving tensile properties N. Osman, S. Roman, G. Gigliobianco, A. Bullock, C. Chapple, S. Macneil (Sheffield, United Kingdom) Saturday 111 A novel technique for anterior vaginal wall prolapse repair; anterior vaginal wall darn (AVWD) O. Köse, H.S. Saglam, S. Kumsar, S. Budak, Ö. Adsan (Sakarya, Turkey) 112 Impact of laparoscopic sacrocolpopexy: A multicentric prospective analysis F.J.P. Thibault, L. Wagner, R. Thanigasalam, G. Seni, M. Brouzyine, L. Cayzergues, R. De Tayrac, S. Droupy, P. Costa (Vandoeuvre Les Nancy, Nîmes, Paris, La Talaudière, France) 113 A.M.I. pelvic floor repair system. A novel system for full reconstruction of complex pelvic floor prolapse E.A. Fes Ascanio, D. Alonso Rodriguez, L. Fernandez Barranco, T. Vicens Vicens, F. Garcia Montes (Palma de Mallorca, Spain) 114 Quality of life after an anterior vaginal wall suspension procedure to correct urinary incontinence with concomitant anterior compartment prolapse based on type of incontinence at baseline P. Zimmern, C. Bascu, B.E. Dillon, D. Lee, A. Christie, X-J. Xie (Dallas, United States of America) * 115 Risk factors associated with perioperative and mesh-related complications for patients undergoing pelvic organ prolapse surgery: Analysis of 677 cases G.R. Kasyan, K.N. Abramyan, A.A. Popov, D.Y. Pushkar (Moscow, Russia) 116 Impact of midurethral sling procedure on couple s sexual function P.H. Song, J.W. Choi, Y.S. Ji, Y.H. Ko, K.H. Moon, H.C. Jung (Daegu, South Korea) 117 Evaluation of sexual functions in females receiving renal replacement therapies R. Demir, Y. Bostanci, F. Atac, E. Ozden, C. Kaya, S. Sarikaya, Y.K. Yakupoglu (Samsun, Turkey) 118 Withdrawn 119 Utilization and peri-operative outcomes of robot-assisted and open vaginal vault suspension H. Li, J.D. Sammon, M. Ehlert, K.R. Ghani, S. Sukumar, H. Atiemo, M. Menon (Detroit, United States of America) Discussion on robotics, is it the future? F. Haab, Paris (FR) 116 Programme Book

117 Saturday, 16 March - EAU Programme Abstract Session Men s sexual health Amber Hall Level S2 Poster Session 11 Chairs: I. Gruenwald, Haifa (IL) Y. Reisman, Amstelveen (NL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 120 The risk of developing erectile dysfunction increases successively with increasing age: A longitudinal study in men aged 45 years and above C.J. Stranne, U.G.H. Malmsten, B. Areskoug, I. Milsom, U. Molander, R. Peeker (Gothenburg, Sweden) 121 Expectations for sexual life after radical prostatectomy: Dissociation between patients and partners Y. Sato, H. Tanda, H. Nakajima, T. Nitta, K. Akagashi, T. Hanzawa, M. Tobe, K. Haga, K. Uchida, I. Honma (Sapporo, Japan) 122 Treatment effect of PDE5-inhibitors may improve with time following radical prostatectomy M. Fode, J. Sønksen, H. Jakobsen (Herlev, Denmark) 123 Withdrawn 124 Serum C-reactive protein levels and response rate to tadalafil 5 mg once daily in erectile dysfunction patients with diabetes H.J. Park, N.C. Park, S.M. Kang (Busan, South Korea) Saturday 125 Prospective evaluation of the systemic mistakes in oral intake of the phosphodiesterase inhibitors ten years after their release B. García Gómez, J. Romero Otero, E. Jiménez Alcaide, L. García González, E. García Cruz, A. Leibar Tamayo, A. Rodríguez Antolín (Madrid, Spain) 126 The frequencies and characteristics of men receiving medical intervention for erectile dysfunction: Analysis of 6.2 million patients O. Cakir, H. Aurora, T. Helfand, T. McVary (Chicago, Evanston, United States of America) 127 Erectile function after nerve-sparing radical prostatectomy: Concepts for rehabilitation in Germany A. Bannowsky, S. Ückert, N. Mosaheb, A. Raileanu, H. Van Ahlen (Osnabrück, Hanover, Germany) 128 The correlation between obstructive sleep apnea syndrome and erectile dysfunction H. Tokgoz, E. Akyurek, T. Ornek, R. Altin, B. Akduman, N.A. Mungan (Zonguldak, Turkey) 129 Penile prosthesis insertion in patients with refractory ischemic priapism: Immediate versus delayed implantation E. Zacharakis, G. Garaffa, A.A. Raheem, A. Muneer, N. Christopher, S. Minhas, D. Ralph (London, United Kingdom) 130 Does psychosexual counselling significantly influence organic and erotic functions after penile prosthesis implantation? Preliminary results of a two-arm controlled trial F. Pisano, C. Fiorito, F. Soria, A.M. Abbona, F. Peraldo, P. Gontero (Turin, Italy) EAU Milan

118 131 Mid-term analysis (6 months) of the effect of penile low intensity shock-wave therapy for ED patients with varying etiology and severity B. Appel, I. Gruenwald, Y. Vardi (Haifa, Israel) 132 Cavernous vein leakage: Diagnosis with 3D CT cavernosography reveals promising treatment by DVC bunching Y. Kawanishi, R. Tomida, H. Mori, T. Nakashima, H. Yamamoto, M. Yamanaka, H. Muguruma, S. Kawanishi (Takamatsu, Japan) Saturday 118 Programme Book

119 Saturday, 16 March - EAU Programme Abstract Session Diagnostics in early prostate cancer Silver Hall - Level N2 Poster Session 12 Chairs: A. Govorov, Moscow (RU) A. Villers, Lille (FR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 133 PSA-pyramid in men with low range PSA: PCa incidence and mortality - a plea for risk-based prostate cancer screening strategy in the European Randomized study of Screening for Prostate Cancer (ERSPC), Aarau M. Randazzo, D Seiler, J. Beatrice, M. Baumgartner, A. Huber, R. Grobholz, L. Manka, F. Recker, M. Kwiatkowski (Aarau, Switzerland; Braunschweig, Germany) 134 Withdrawn 135 Psychological impact of PSA testing and biopsy using the impact of event scale E.T. Kok, E.L. Turner, M.J. Davis, C. Metcalfe, J.A. Lane, D.E. Neal, F.C. Hamdy, J.L. Donovan (Utrecht, The Netherlands; Bristol, Cambridge, Oxford, United Kingdom) 136 A randomized multicenter trial comparing 12 to 20-core prostate biopsy protocol J. Irani, P. Blanchet, L. Salomon, P. Coloby, J. Hubert, B. Malavaud, N. Mottet (Poitiers, Guadeloupe, Creteil, Pontoise, Nancy, Toulouse, Saint-Etienne, France) Saturday 137 PHI (Prostate Health Index) and %p2psa for prediction of prostate cancer in men younger than 60 years of age. A nested-case control study from PROpsa Multicentric European Study (PROMEtheuS project) T. McNicholas, M. Lazzeri, A. Haese, A. De La Taille, J. Palou, G. Lughezzani, V. Scattoni, G. Lista, A. Larcher, A. Cestari, N. Buffi, M. Freschi, L. Fowler, J.W. Roux, A. Renter, M. Graefen, P.O. Bosset, P. Le Corvoisier, A. Breda, P. De La Torre, V. Bini, G. Guazzoni (Stevenage, United Kingdom; Milan, Perugia, Italy; Hamburg, Germany; Creteil, France; Barcelona, Spain) * 138 Standards in reporting of MRI-targeted prostate biopsies (START): Recommendations from an international working party V. Kasivisvanathan, C.M. Moore, S. Eggener, M. Emberton, J.F. Futterer, I. Gill, R. Grubb, B. Hadaschik, L. Klotz, D. Margolis, L. Marks, J. Melamed, A. Oto, S. Palmer, P. Pinto, P. Pueche, S. Punwani, A. Rosenkrantz, I. Shoots, R. Simon, S. Taneja, B. Turkbey, O. Ukimura, J. Van Der Meulen, A. Villers, Y. Watanabe (London, Chicago, United Kingdom; Nijmegen, Rotterdam, The Netherlands; Los Angeles, St Louis, New York, Chicago, Bethesda, United States of America; Heidelberg, Germany; Toronto, Canada; Lille, France; Kurashiki, Japan) 139 Reducing unnecessary biopsies for suspicion of prostate cancer: Extension and validation of an ERSPC based risk calculator with Phi M.J. Roobol, D. Nieboer, A. Houlgatte, S. Vincendeau, M. Lazzeri, G. Guazzoni, C. Stephan, A. Semjonow, A. Haese, M. Graefen, E.W. Steyerberg (Rotterdam, The Netherlands; Paris, Rennes, France; Milan, Italy; Berlin, Munster, Hamburg, Germany) 140 Diabetes mellitus increases the risk of poorly differentiated tumor in prostate cancer patients A. Nini, M. Sun, P.I. Karakiewicz, M. Bianchi, N.M. Passoni, A. Salonia, A. Galllina, F. Castiglione, N. Fossati, R. Matloob, G. La Croce, F. Abdollah (Milan, Italy; Montreal, Canada) EAU Milan

120 141 Pre-biopsy magnetic resonance imaging and prostate cancer detection: Comparison of random and MRItargeted biopsies using three different techniques of MRI-TRUS image registration N. Barry Delongchamps, M. Peyromaure, A. Schull, F. Beuvon, N. Bouazza, T. Flam, M. Zerbib, P. Legman, F. Cornud (Paris, France) * 142 Performance of MRI-TRUS fusion in transperineal template prostate re-biopsy S.Y.W. Tang, E.M. Lawrence, B. Koo, A.W. Nelson, K. Wadhwa, T. Barrett, A. Warren, R. Axell, A. Doble, F.A. Gallagher, V.J. Gnanapragasam, E. Sala, C. Kastner (Cambridge, United Kingdom) 143 An evaluation of Real-Time-Elastography (RTE): Its detection rate of prostate cancer compared to multiple core biopsies and its dependance of PSA and the volume of the prostate O. Lenherr, A. Fayyazi, P. Liske, S. Lahme (Pforzheim, Germany) Summary - How reliable is imaging for screening A. Villers, Lille (FR) Saturday 120 Programme Book

121 Saturday, 16 March - EAU Programme Abstract Session Bladder cancer: Gene expression and molecular classification Red Hall 1 - Level N1 Poster Session 13 Chairs: P.J. Boström, Turku (FI) M. Sanchez-Carbayo, Madrid (ES) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 144 Bortezomib synergizes with vorinostat to cause ubiquitinated protein accumulation and histone acetylation in bladder cancer cells A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan) 145 Whole transcriptome sequencing reveals dynamic changes in gene expression of progressive, lethal bladder cancer N. Sapre, G. Macintyre, J. Pedersen, A. Ryan, A. Kowalczyk, P. Anderson, A.J. Costello, N.M. Corcoran, C.M. Hovens (Melbourne, Australia) 146 Cell membrane glycosphingolipids are involved in the control of bladder cancer invasive properties A. Bettiga, M. Aureli, G. Colciago, D. Canals, M. Moschini, P. Hedlund, S. Sonnino, Y.A. Hannon, F. Benigni (Milan, Italy; Charleston, South Carolina, United States of America) 147 In vitro cell viability and proliferation of electrospun scaffold made of PCL and PHBV for tissue engineered urinary diversions A. Vianello, A. Giannantoni, V. Maulà, C. Del Gaudio, A. Bianco, G. Bellezza, M. Porena (Perugia, Rome, Italy) Saturday 148 B-cell translocation gene 2: A tumor suppressor gene is upregulated by resveratrol in bladder carcinoma cells H-H. Juang, P-L. Chang, K-H. Tsui (Kwei-Shan, Tao-Yuan, Taiwan) 149 CIP2A is associated with human bladder cancer aggressivity Y. Xue, X. Zou, B. Jiang, G. Zhang, Y. Liao, G. Wu, X. Wang, F. Liu, J. Yang, H. Xu, M. Liu (Ganzhou, China) 150 High expression of HuR in cytoplasm, but not nuclei, associated with malignant aggressiveness and prognosis in non-muscle invasive bladder cancer Y. Miyata, K. Ohba, T. Matsuo, K. Mitsunari, Y. Sagara, H. Sakai (Nagasaki, Japan) 151 Association of the expression of T-cell coregulatory proteins with clinical outcomes in patients with urothelial carcinoma of the bladder E.N. Xylinas, B.D. Robinson, L.A. Kluth, G. Volkmer, R. Hautmann, R. Kufer, M. Zerbib, E. Kwon, H. Thompson, S.A. Boorjian, S.F. Shariat (New York, Rochester, United States of America; Kassel, Ulm, Göppingen, Germany; Paris, France) 152 Targeting DNA repair mechanisms increases efficiency of intravesical chemotherapy in an orthotopic rat bladder cancer model C.J. Arum, O.A. Gederaas, S. Bachke, T. Viset, M. Otterlei (Trondheim, Norway) 153 The effect of photochemical internalization of bleomycin in the treatment of urothelial carcinoma of the bladder: An in vitro study H.C. Arentsen, J. Falke, A. Høgset, E. Oosterwijk, J.A. Witjes (Nijmegen, The Netherlands; Oslo, Norway) EAU Milan

122 154 MAC387 positive tumor-associated macrophage count is an independent predictor of poor survival after radical cystectomy for urothelial bladder cancer M.M. Boström, P.J. Boström, H. Irjala, T. Mirtti, P. Taimen, S. Jalkanen (Turku, Finland) 155 The expression of the receptor of hyaluronan mediated motility (RHAMM) is associated with reduced disease-specific survival in patients with bladder cancer C. Niedworok, I. Kretschmer, F. Vom Dorp, T. Szarvas, J. Heß, T. Freudenberger, A. Melchior-Becker, J.W. Fischer, H. Rübben (Essen, Düsseldorf, Germany) 156 Prediction and reversibility of cisplatin-resistance in bladder cancer: HOXA9 a novel epigenetic biomarker E.N. Xylinas, T. Clozel, D. Zhuang, J.J. Crivelli, L.A. Kluth, B.D. Robinson, D.S. Scherr, O. Elemento, S.F. Shariat (New York, United States of America) 157 Differential expression of Oct4 variants in urothelial cancer F. Wezel, J. Pearson, L. Kirkwood, J. Southgate (York, United Kingdom) Saturday 122 Programme Book

123 Saturday, 16 March - EAU Programme Abstract Session Urological infection innovations Blue Hall Level N1 Poster Session 14 Chairs: M. Chrisofos, Athens (GR) M. Grabe, Malmö (SE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 158 Socioeconomic trends and utilization in the emergency department treatment of urinary tract infections J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of America) 159 The etiology of recurrent urinary tract infections in women and relation with recurrence rate M. Kolesnyk, N. Stepanova, V. Kruglikov, L. Lebid, O. Romanenko (Kiev, Ukraine) * 160 Risk factors analysis in patients with chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS) from Finland, Germany, Italy and Switzerland: Results of a multinational observational study F.M.E. Wagenlehner, M. Spangenberg, V. Magri, A. Mehik, W. Hochreiter, H. Bödecker, W. Weidner, G. Perletti (Giessen, Germany; Milan, Busto A./Varese, Italy; Oulu, Finland; Aarau, Switzerland) 161 A pilot study of the ageing urinary microbiome J.P. Williams, D. Lewis, R. Brown, J.R. Marchesi, M.J. Drake (Bristol, United Kingdom) Saturday 162 The influence of urinary ph on ciprofloxacin efficacy against bacterial uropathogen biofilms L. Yang, K. Wang, H. Li, H.S. Chen, J. Denstedt, P. Cadieux (Chengdu, China; London, Canada) 163 Risk factors for systemic inflammatory response syndrome following percutaneous nephrolithotomy T. Erdil, Y. Bostanci, E. Ozden, F. Atac, Y.K. Yakupoglu, A.F. Yilmaz, S. Sarikaya (Samsun, Turkey) 164 Withdrawn 165 Excellent control of infective complications after transrectal prostate biopsy with cephalosporin-based prophylactic antibiotics and the simple use of suppository-type povidone-iodine O. Jong Jin, D.S. Park, J.H. Hwang, Y.K. Hong, S.J. Park (Seongnam, Seoul, South Korea) 166 Biofilm producing bacteria and chronic bacterial prostatitis: Results from a longitudinal cohort study R. Bartoletti, T. Cai, C. D Elia, N. Mondaini, G. Nesi, S. Mazzoli, K. Naber (Florence, Trento, Italy; Munich, Germany) 167 Application of isothermal microcalorimetry for rapid mycobacterial detection and anti-tuberculosis drug susceptibility testing - implication for urogenital tuberculosis and other mycobacterial infections G. Bonkat, A. Solokhina, M. Rieken, G. Müller, S. Wyler, T. Gasser, A. Bachmann (Basel, Switzerland) * 168 Influence of time course antibiotic administration on growth and biofilm formation from bacteria related to urinary tract infections in women L. Gandee, J.T. Hsieh, V. Sperandio, C. Moreira, P. Zimmern (Dallas, United States of America) EAU Milan

124 169 Spectrum and antibiotic resistance dynamics of uropathogens isolated from children and adolescents with community-acquired urinary tract infections in Russia: I. Palagin, M. Sukhorukova, M. Edelstein, R. Kozlov, A. Shevelev, T. Perepanova, A. Grinyov, A. Dekhnich (Smolensk, Moscow, Russia) Saturday 124 Programme Book

125 Saturday, 16 March - EAU Programme Abstract Session Partial nephrectomy and surveillance: Surveys and comparisons Yellow Hall Level N1 Poster Session 15 Chairs: J.J. Patard, Le Kremin Bicetre (FR) D. Rengifo Abbad, Madrid (ES) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 170 National survey on the use of partial nephrectomy in France. Data from the multicenter prospective NEPHRON study J-C. Bernhard, G. Pignot, H. Lang, P. Bigot, M. Crepel, J. Rigaud, L. Bellec, P. Gimel, L. Zini, L. Salomon, C. Vaessen, J. Berger, F. Bruyere, X. Martin, M. Zerbib, M. Rouprêt, F. Salome, J-L. Jung, J. Hubert, C. Pfister, N. Mottet, H. Baumert, A. Mejean, J-J. Patard (Bordeaux, Le Kremlin Bicetre, Strasbourg, Angers, Rennes, Toulouse, Cabestany, Lille, Creteil, Paris, Limoges, Tours, Lyon, Colmar, Nancy, Rouen, Saint-Etienne, France) 171 Partial nephrectomy (PN): Complications and warm ischemia time in a French multicentre study H. Baumert, N. Korahanis, R. Thanigasalam, A. Mejean, J.M. Lang, J.C. Bernhard, G. Pignot, L. Zini, M. Crepel, J. Rigaud, L. Salomon, L. Bellec, C. Vaessen, M. Rouprêt, J.L. Jung, E. Mourey, X. Martin, P. Bigot, F. Bruyere, J. Berger, J.P. Ansieau, P. Gimel, F. Salome, J. Hubert, C. Pfister, F. Trifard, J.J. Patard (Paris, Strasbourg, Bordeaux, Lille, Reims, Nantes, Creteil, Toulouse, Colmar, Dijon, Lyon, Angers, Tours, Limoges, Mulhouse, Cabestany, Vandoeuvre Les Nancy, Rouen, Saint-Brieuc, France) * 172 Simple enucleation versus standard partial nephrectomy for clinical T1 renal tumors: Intraoperative, early post-operative and pathological outcomes from a prospective multicenter comparative study (RECORd Project) P. Verze, F. Fusco, A. Minervini, A. Antonelli, G. Bianchi, A. Bocciardi, S. Cosciani Cunico, V. Ficarra, C. Fiori, S. Giancane, N. Longo, G. Martorana, G. Novara, F. Porpiglia, F. Rocco, B. Rovereto, R. Schiavina, S. Serni, C. Simeone, A. Volpe, M. Carini (Naples, Florence, Brescia, Modena, Pavia, Padua, Bologna, Turin, Milan, Novara, Italy) Saturday 173 Renal and cardiovascular morbidity after partial or radical nephrectomy in patients with kidney tumors up to 7 centimeters: Implications on overall mortality M. Roscigno, R. Naspro, U. Capitanio, R. Matloob, C. Carenzi, E. Di Trapani, F. Ceresoli, M. Nicolai, G. Deiana, P. Rigatti, F. Montorsi, L.F. Da Pozzo, R. Bertini (Bergamo, Milan, Italy) 174 Active surveillance of small renal masses: First Italian prospective study A. Volpe, S. Munegato, L. Zegna, A. Di Domenico, P. De Angelis, P. Mondino, C. Terrone (Novara, Italy) 175 A treatment delay in surgical intervention for elderly patients with small renal masses does not impact oncological outcomes A. Becker, A. Abdo, M. Meskawi, F. Roghmann, Z. Tian, H. Lavigueur-Blouin, M. Sun (Montreal, Canada; Herne, Germany) 176 Partial nephrectomy: Is there a center effect? J-P. Couapel, J-C. Bernhard, G. Pignot, L. Zini, H. Lang, J. Rigaud, L. Salomon, L. Bellec, M. Soulié, C. Vaessen, M. Rouprêt, J-L. Jung, E. Mourey, P. Bigot, F. Bruyère, J. Berger, J-P. Ansieau, P. Gimel, F. Salome, J. Hubert, C. Pfister, H. Baumert, A. Méjean, J.J. Patard, K. Bensalah (Rennes, Bordeaux, Paris, Lille, Strasbourg, Nantes, Creteil, Toulouse, Colmar, Dijon, Angers, Tours, Limoges, Mulhouse, Cabestany, Vandoeuvre-Lès-Nancy, Rouen, France) EAU Milan

126 177 Analysis of Fuhrman grade according to the anatomic location in clinical stage T1 clear cell renal cell carcinoma W.S. Ham, T.Y. Shin, J. Kim, K.H. Rha, S.C. Yang, S.J. Hong, Y.D. Choi, S.Y. Park (Seoul, South Korea) * 178 A postoperative morbidity assessment amongst elderly T1 renal cell carcinoma individuals: Comparison between laparoscopic radical nephrectomy vs partial nephrectomy A. Becker, F. Roghmann, Z. Tian, M. Meskawi, A. Abdo, P.I. Karakiewicz, M. Sun (Montreal, Canada; Herne, Germany) * 179 Nephrectomy versus active surveillance for small renal masses: Cancer-specific mortality and competingrisks of death M. Sun, H. Lavigueur-Blouin, F. Abdollah, Q-D. Trinh (Montreal, Canada; Milan, Italy) Discussion on posters 178 & 179 J.J. Patard, Le Kremin Bicetre (FR) Saturday 126 Programme Book

127 Saturday, 16 March - EAU Programme Abstract Session Improving minimally invasive radical prostatectomy Platinum Hall - Level S3 Video Session 2 Chairs: I.J. De Jong, Groningen (NL) R.J.A. Van Moorselaar, Amsterdam (NL) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V10 V11 Nuances in nerve sparing during RARP C. Giedelman, H. Abdul Muhsin, O. Schatloff, S. Chauhan, A. Sivaraman, R. Coelho, B. Rocco, S. Samavedi, K. Palmer, V. Patel (Celebration, United States of America) Robotic extended modified lymph node dissection during radical prostatectomy: Points of technique F. Porpiglia, I. Morra, M. Poggio, S. Grande, F. Mele, M. Manfredi, D. Garrou, R. Bertolo, M. Lucci Chiarissi, C. Fiori (Orbassano, Italy) V12 V13 V14 Novel tissue simulator for robotic assisted radical prostatectomy: Face, content, and construct validation and stepwise instructions for creation M. Alemozaffar, R. Narayanan, A. Percy, B. Minnillo, K. Matthes, A. Wagner (Los Angeles, Boston, United States of America) Use of the prostatic vasculature for refining nerve sparing during robot assisted radical prostatectomy O. Schatloff, S. Samavedi, H. Abdul-Muhsin, K. Palmer, V. Patel (Celebration, United States of America) Bimanual examination of retrieved specimen and selective hypothermia during robot-assisted radical prostatectomy W. Jeong, K.R. Ghani, A. Sood, R.K. Kumar, S. Dusik, N.S. Gupta, P. Dasgupta, C.G. Rogers, J.O. Peabody, M. Menon (Detroit, United States of America; London, United Kingdom) Saturday V15 V16 Technical challenges of salvage robotic assisted radical prostatectomy A.E. El Hajj, A. De Fourmestraux, J. Rode, D. Vordos, A. Hoznek, L. Salomon, C.C. Abbou, A. De La Taille (Creteil, France) Failure analysis and management of iatrogenic injuries occurring during robot assisted radical prostatectomy M. Addali, V. Zugor, A. Abdulhak, S. Poth, A. Schütte, C. Wagner, J.H. Witt (Gronau (Westfalen), Germany) V17 Intrafascial nerve-sparing endoscopic extraperitoneal radical prostatectomy (nseerpe) with 3-D visualisation J.U. Stolzenburg, M. Do, T. Haefner, A. Dietel, R.M. Long, E. Liatsikos, R. Ganzer, H. Qazi (Leipzig, Regensburg, Germany; Patras, Greece) EAU Milan

128 Saturday, 16 March - EAU Programme Abstract Session Radical treatment of prostate cancer, beyond prostatectomy Brown Hall Level S2 Poster Session 16 Chairs: A. Bossi, Villejuif (FR) A.S. Merseburger, Hanover (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 180 Radical prostatectomy versus high intensity focused ultrasound: Oncological results of 723 patients treated between 2000 and 2005 in the same department S. Crouzet, J-M. Marechal, M. Colombel, R. Bouvier, F. Mege-Lechevallier, O. Rouviere, X. Martin, A. Gelet (Lyon, France) 181 Can the findings of randomised clinical trials concerning the efficacy of prostate cancer therapy in men with early disease be replicated in national cancer registries? P. Cathcart, J. Van Der Meulen, M. Emberton (London, United Kingdom) Saturday 182 Development and internal validation of a nomogram predicting biochemical recurrence after early salvage radiotherapy in prostate cancer patients treated with radical prostatectomy A. Briganti, M. Bianchi, S. Joniau, C. Cozzarini, B. Tombal, K. Haustermans, W. Hinkelbein, N. Di Muzio, N. Suardi, H. Van Poppel, T. Wiegel (Milan, Italy; Leuven, Brussels, Belgium; Ulm, Germany) 183 Pelvic lymph-nodal irradiation improves biochemical relapse-free survival of node-negative patients treated with high-dose salvage radiotherapy after radical prostatectomy. A single-institute analysis of 206 patients F. Zerbetto, C. Cozzarini, C. Fiorino, M. La Macchia, N.A. Iacovelli, A. Bolognesi, A. Chiara, A. Briganti, A. Gallina, P. Rigatti, N.G. Di Muzio (Milan, Italy) 184 Factors predicting severe (Grade 3-4) late urinary toxicity after post-prostatectomy irradiation. A single institution analysis of 1151 patients treated with adjuvant or salvage radiotherapy with different radiation techniques and fractionations C. Cozzarini, C. Fiorino, A. Briganti, V. Carillo, C. Deantoni, M. La Macchia, B. Noris Chiorda, N. Suardi, F. Zerbetto, P. Rigatti, N.G. Di Muzio (Milan, Italy) 185 Reliability and ideal cut-off of PSA doubling time in patients candidate to timely salvage radiotherapy for a biochemical recurrence after prostatectomy P. Rancoita, C. Cozzarini, F. Zerbetto, A. Briganti, F. Abdollah, A. Nonis, C. Deantoni, N.A. Iacovelli, P. Rigatti, C. Di Serio, N.G. Di Muzio (Milan, Italy) 186 Indication and extension of pelvic lymph node dissection during robot-assisted radical prostatectomy. An analysis of 5 institutions N. Suardi, A. Haese, V. Ficarra, A. Govorov, N.M. Buffi, J. Walz, B. Rocco, M. Borghesi, A.Mottrie, T. Steuber, G. Guazzoni, D. Pushkar, H. Van Der Poel (Milan, Padua, Italy; Hamburg, Germany; Moscow, Russia; Marseille, France; Aalst, Belgium; Amsterdam, The Netherlands) 187 A competing risks analysis of long term survival on node positive prostate cancer patients treated with radical prostatectomy F. Abdollah, R.J. Karnes, M. Bianchi, A. Gallina, G. La Croce, N.M. Passoni, C. Cozzarini, N. Di Muzio, R. Lucianò, M. Freschi, A. Salonia, P. Rigatti, A. Briganti (Milan, Italy; Rochester, United States of America) 128 Programme Book

129 188 Salvage lymph node dissection for patients treated with radical prostatectomy with biochemical recurrence and imaging-detected nodal metastases N. Suardi, J.R. Karnes, S. Joniau, K.A. Touijer, D. Osmonov, A. Aksenov, A. Briganti, P. Rigatti, H. Van Poppel, K.P. Jünemann (Milan, Italy; Rochester, New York, United States of America; Leuven, Belgium; Kiel, Germany) 189 Is a fatal family history or the apparent mode of disease transmission of prostate cancer a prognostic factor for survival? K. Herkommer, E. Donel, J.E. Gschwend, M. Kron (Munich, Ulm, Germany) 190 Radical prostate cancer therapy is associated with a survival benefit in the older man J. Cathcart, J. Van Der Meulen (London, United Kingdom) 191 High-dose intensity-modulated arc radiotherapy for lymph node metastasized prostate cancer: Toxicity and early clinical outcome V. Fonteyne, N. Lumen, C. Van Praet, P. Ost, K. Decaestecker, G. De Meerleer (Ghent, Belgium) 192 The 10-years follow-up of the ARO 96-02/AUO AP 09/95 trial on adjuvant radiotherapy (ART) versus waitand-see (WS) after prostatectomy for pt3 cancer subgroup analysis T. Wiegel, D. Bottke, D. Bartkowiak, C. Bronner, U. Steiner, A. Siegmann, R. Golz, S. Störkel, N. Willich, A. Semjonow, M. Stöckle, C. Rübe, P. Althaus, U. Rebmann, T. Kälble, H.J. Feldmann, M. Wirth, A. Hinke, W. Hinkelbein, K. Miller (Ulm, Berlin, Wuppertal, Münster, Homburg Saar, Dessau, Fulda, Dresden, Langenfeld, Germany) Discussion on poster 192 A. Bossi, Villejuif (FR) Saturday EAU Milan

130 Saturday, 16 March - EAU Programme Abstract Session Renal tumours: Basic research in prognostic markers Amber Hall Level S2 Poster Session 17 Chairs: P.F.A. Mulders, Nijmegen (NL) S. Zastrow, Dresden (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 193 High cytoplasmic and low nuclear expression of HIF-2α are associated with worse cancer specific survival (CSS) in clear cell renal cell carcinoma N. Kroeger, D.B. Seligson, S. Signoretti, H. Yu, F.D. Birkhäuser, C.E. Magyar, J. Huang, J. Riss, F.F. Kabbinavar, A.S. Belldegrun, A.J. Pantuck (Los Angeles and Greifswald, Los Angeles, Boston, United States of America) 194 Identification of high risk patients with clear cell renal cell carcinoma based on interphase-fish J. Sanjmyatav, S. Matthes, M. Mühr, D. Sava, M. Sternal, H. Wunderlich, M. Gajda, M-O. Grimm, K. Junker (Jena, Eisenach, Homburg, Germany) Saturday 195 Prognostic significance of EpCAM expression in renal tumors: A clinicopathological study of 948 cases M. Maruschke, A. Zimpfer, S. Rehn, G. Kundt, A. Litzensberger, F. Dammert, H. Zettl, C. Stephan, A. Erbersdobler, O.W. Hakenberg (Rostock, Berlin, Germany) 196 Prognostic significance of platelet derived growth factor-β receptor in localized clear cell renal cell carcinoma S. Park, M. Shim, D. Yoo, C. Song, B. Hong, J.H. Hong, C-S. Kim, H. Ahn (Seoul, South Korea) 197 Aberrant glycosylation of N-glycan on immunoglobulin closely relates survival of the patients with renal cell carcinoma S. Hatakeyama, Y. Tobisawa, T. Yoneyama, K. Mori, T. Yoneyama, Y. Hashimoto, T. Koie, N. Tsuchiya, T. Habuchi, M. Amano, S-I. Nishimura, C. Ohyama (Hirosaki, Akita, Hokkaido, Japan) * 198 Hsa-mir CpG island methylation is associated with advanced tumours and disease recurrence of patients with clear cell renal cell carcinoma H. Tezval, K. Gebauer, I. Peters, N. Dubrowinskaja, J. Hennenlotter, M. Abbas, R. Scherer, A.S. Merseburger, A. Stenzl, M.A. Kuczyk, J. Serth (Hanover, Tübingen, Germany) 199 Vasohibin-1 is a novel independent predictor of disease-free survival in curatively operated renal cell carcinoma patients Y. Miyaji, N. Kanomata, Y. Sato, S. Kin, S. Ohira, M. Fujita, H. Yakushiji, K. Fukumoto, S. Shimizu, M. Kaifu, T. Fujii, Y. Jo, T. Yokoyama, T. Moriya, A. Nagai (Kurashiki, Sendai, Japan) 200 Expression of MHC molecule CD1d in renal cell carcinoma (RCC) is associated poorer cancer-specific and overall survival T.W. Chong, M.Y. Sim, H.H. Huang, A.R. Lazaro, A.A. Thike, P.H. Tan (Singapore, Singapore) 201 Withdrawn 202 Phosphodiesterase-5- inhibition protects against ischemia-reperfusion acute kidney injury: In-vivo study O. Nativ, I. Sukhotnik, R. Suhotnik, H. Awad, S. Heyman, Z. Abassi, O. Nativ (Haifa, Jerusalem, Israel) 130 Programme Book

131 203 Partial nephrectomy compared to total unilateral nephrectomy slows down atherosclerosis progression in apolipoprotein E deficient mice O. Ivanovski, I.G. Nikolov, O. Davceva, K. Gjorgjievska, G. Petrusevska (Skopje, Macedonia) 204 Kidney injury following clampless laparoscopic partial nephrectomy: Is an early detection of acute postoperative damage possible? A preliminary experience F. Porpiglia, D. Amparore, R. Bertolo, E. Aroasio, F. Ragni, C. Fiori (Orbassano (Turin), Italy) Summary P.F.A. Mulders, Nijmegen (NL) Saturday EAU Milan

132 Saturday, 16 March - EAU Programme Abstract Session Men s sexual health: Testosterone and premature ejaculation Amber Hall Level S2 Poster Session 18 Chairs: B. Cuzin, Lyon (FR) K. Hatzimouratidis, Pefka (GR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 205 Withdrawn * 206 Results of the CO-SDT study: Prevalence and risk factors of coronary artery disease in a cohort of 2508 men with testosterone deficiency syndrome E. García-Cruz, O. Cardeñosa, M.P. Luque, A. Alcaraz (Barcelona, Spain) Saturday * 207 Effects of long-term treatment with testosterone undecanoate injections in hypogonadal men on waist circumference, body weight and BMI D.J. Yassin, A. Haider, M. Zitzmann, A. Yassin, P.G. Hammerer, F. Saad (Braunschweig, Bremerhaven, Münster, Norderstedt, Berlin, Germany) 208 Relationship between erectile dysfunction and coronary anatomy in patients with ischemic heart disease debut E. Garcia-Cruz, A. Bonet, I. Asiain, P. Luque, R. Freixa, A. Alcaraz (Barcelona, Sant Joan Despí, Spain) 209 The characteristics of testosterone deficiency syndrome in men with end-stage renal disease and male renal transplant recipients; a cross-sectional study M.G. Park, J.K. Yeo, W.Y. Cho, D.Y. Cho (Seoul, Busan, South Korea) 210 Endothelial function in patients with metabolic syndrome and erectile dysfunction: A question of Angiopoietin imbalance? N. Tomada, I. Tomada, F. Botelho, L. Pacheco-Figueiredo, T. Lopes, R. Negrão, F. Cruz (Porto, Portugal) 211 Sexual dysfunction, aging male symptoms and their relationship to testosterone (T) in the Registry of Hypogonadism in Men (RHYME) R.C. Rosen, S. Arver, H.M. Behre, R. Chang, T. Curto, T.H. Jones, M. Maggi, J. Martha, A. Martin-Morales, E.J. Meuleman, H. Porst, F.C.W. Wu, A.B. Araujo (Watertown, Massachusetts, United States of America; Stockholm, Sweden; Halle, Hamburg, Germany; South Yorkshire, Manchester, United Kingdom; Florence, Italy; Malaga, Spain; Amsterdam, The Netherlands) 212 A new indication for varicocelectomy? A.A. Afoko, H. De Wall, M. Kogan (Tamale, Ghana; Rostov on Don, Russia) 213 Comparison between on-demand dosing of dapoxetine alone and dapoxetine plus mirodenafil in patients with lifelong premature ejaculation; multicenter, prospective, randomized, double-blind, and placebocontrolled C. Yoo, W.Y. Cho, J.S. Cho, W.K. Lee, S.K. Lee, Y.G. Lee, Y.S. Lee, K.K. Kim, D.Y. Yang, H.Y. Kim, S.Y. Kim (Anyang, Busan, Chuncheon, Seoul, South Korea) 132 Programme Book

133 214 On demand use of tramadol, sildenafil, paroxetine or local anesthetics for management of premature ejaculation, a randomized placebo-controlled clinical trial T.A. Gameel, A.M. Tawfik, M.G. Soliman, M.A. El-Bendary, M. Abo-Elenen, T.I. Tawfik, A. El-Gamasy (Tanta, Egypt) 215 A real-time motion analysis of human ejaculation with Turbo-FLASH MR imaging system J.S. Jintetsu, Y. Naya, O Ochiai, Y. Naitoh, N. Kanemitsu, K. Kamoi, A. Kawauchi, T. Miki (Kyoto, Japan) 216 Associations between asymptomatic prostatitis and erectile dysfunction in middle-aged male K. Ausmees, R. Mändar, G. Timberg, M. Punab (Tartu, Estonia) Saturday EAU Milan

134 Saturday, 16 March - EAU Programme Abstract Session Improving diagnosis in prostate cancer Silver Hall - Level N2 Poster Session 19 Chairs: P. Macek, Prague (CZ) M.P. Matikainen, Helsinki (FI) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 217 Structured reporting of multiparametric MRI in detecting prostate cancer: Accuracy and inter-observer variability R. Van Soest, R.S. Dwarkasing, G.J.L.H. Van Leenders, H.J. Teertstra, P. De Koekkoek, S.W.T.P. Heijmink, M. Wildhagen, H.G. Van Der Poel, E.W. Steyerberg, C.H. Bangma (Rotterdam, Amsterdam, The Netherlands) 218 Association of level of suspicion of prostate cancer on multi-parametric MRI with detection rate of prostate cancer V. Kasivisvanathan, R. Dufour, C.M. Moore, H.U. Ahmed, M.A. Abd-Alazeez, S. Charman, A. Freeman, A. Kirkham, C. Allen, J. Van Der Meulen, M. Emberton (London, United Kingdom) Saturday * 219 Diagnostic accuracy of multiparametric MRI in detection of clinically significant prostate cancer F. Porpiglia, C. Fiori, F. Mele, M. Manfredi, R. Bertolo, S. Grande, M. Poggio, D. Garrou, G. Cattaneo, E. Bollito, M. Papotti, F. Russo, D. Regge (Orbassano (Turin), Candiolo (Turin), Italy) 220 Initial experience of 200 men undergoing 3 dimensional ultrasound prostate biopsy in analysis between systematic and MR-fusion biopsy A. Marien, A. Villers, S. Palmer, S. Leslie, H. Ahmadi, A.L. De Castro Abreu, S. Shoji, M. Aron, M.M. Desai, I.S. Gill, O. Ukimura (Los Angeles, United States of America; Lille, France) 221 Diagnosis of anterior prostate cancer using MRI/TRUS soft image fusion E. Baco, E. Rud, D. Klotz, H.B. Eggesbø (Oslo, Norway) * 222 Detecting clinically significant prostate cancer by MRI-targeted TRUS-guided transperineal fusion biopsy T.H. Kuru, M. Roethke, T. Simpfendoerfer, S. Boxler, J. Seidenader, H-P. Schlemmer, M. Hohenfellner, B. Hadaschik (Heidelberg, Germany) 223 Objective differentiation of prostate cancer from normal prostate tissue: Diagnostic usefulness of discriminant analysis of T2 and diffusion-weighted MR imaging R. Nemoto (Tottori, Japan) * 224 Incremental benefit of 3T diffusion weighted MRI for pre-operative prostate cancer staging: A prospective dual reader study E.M. Lawrence, F.A. Gallagher, T. Barrett, A. Warren, A.N. Priest, E. Sala, V.J. Gnanapragasam (Cambridge, United Kingdom; Toronto, Canada; New York, United States of America) 225 Identification of patient subgroups with the highest benefit from real-time-sonoelastography (RTE) targeted biopsy of the prostate J. Bründl, H-M. Fritsche, M. Gierth, A. Brandtner, W.F. Wieland, R. Ganzer (Regensburg, Germany) 134 Programme Book

135 226 Shearwave elastography of the prostate: Assessment of prostate cancer nodules elasticity thresholds and localization of cancer lesions: Implication for targeted biopsies and active surveillance protocols K. Boehm, G. Salomon, B. Beyer, J. Schiffmann, H. Isbarn, M. Sandmann, L. Budaeus (Hamburg, Germany) 227 [ 68 Ga]Gallium labelled ligands of the prostate specific membrane antigen as novel validated PET-tracer for the diagnosis of prostate cancer S. Boxler, T.H. Kuru, A. Afshar-Oromieh, M. Hohenfellner, U. Haberkorn, B.A. Hadaschik (Heidelberg, Germany) 228 Console-integrated stereoscopic OsiriX 3D volume-rendered images for da Vinci S robotic-assisted radical prostatectomy Y. Shiga, M. Sugimoto, S. Minagawa, H. Morikawa, S. Okada, Y. Kawano, H. Yokoyama, K. Umeda, K. Hariu, Y. Ooiwa, H. Watanabe, M. Shimbori, R. Yamamoto, K. Yoshioka (Tokyo, Kobe, Japan) Saturday EAU Milan

136 Saturday, 16 March - EAU Programme Abstract Session Bladder cancer demographics and biomarkers Red Hall 1 - Level N1 Poster Session 20 Chairs: P. Bastian, Düsseldorf (DE) R. Bryan, Birmingham (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 229 Work in the textile and bladder cancer D. Garcia-Rojo, C. Serra, M. Kogevinas, D. Silverman, N. Malats, A. Gelabert, A. Carrato, N. Rothman, O. Bielsa, J. Prats, R. Abascal, L. Ceccini, A. Prera, F. Taño, J.M. Rodriguez De Vera, J.L. Guate, J. Fernandez, M. Rivas, A. Mateos, J.M. Malet, P. Muntañola, M. Cespedes, J.F. Gonzalez Huergo, J. Mosquera, C. Abad, F.X. Real (Sabadell, Barcelona, Elche, Oviedo, Badalona, Santa Cruz de Tenerife, Aviles, Gijon, Manresa, Mieres, Sant Boli Llobregat, Coaña, Cangas, Spain; Bethesda, United States of America) 230 Bladder cancer incidence is falling, but mortality is static in significant subgroups of the English population M.F. Eylert, L.S. Hounsome, J. Verne, A. Bahl, E.R. Jefferies, R.A. Persad, H. Mostafid (Swansea, Bristol, Cheltenham, Basingstoke, United Kingdom) Saturday 231 What do patients know about the causal role of cigarette smoking in bladder cancer? R. Rogel Berto, J.L. Ruiz Cerda, A. Polo Rodrigo, B. Plaza Viguer, A.M. Soto Poveda, J.L. Pontones Moreno, F. Boronat Tormo (Valencia, Spain) 232 Clinical and pathological features of newly diagnosed bladder cancer in Spain B. Miñana, J.M. Cozar, J. Palou, R. Medina, J. Subirá, F. De La Rosa, V. Chantada, F. Lozano, M.J. Ribal (Murcia, Granada, Barcelona, Sevilla, Zaragoza, Madrid, La Coruña, Spain) 233 Distribution of metastatic sites in bladder cancer: A population-based analysis A. Abdo, M. Meskawi, H. Lavigueur-Blouin, F. Roghmann, P.I. Karakiewicz, Q-D. Trinh (Montreal, Canada; Herne, Germany) 234 Identification and clinical outcomes of aristolochic acid-induced upper tract urothelial carcinoma C.H. Chen, K.G. Dickman, C.Y. Huang, C.T. Shun, A.P. Grollman, Y.S. Pu (Taipei, Taiwan; New York, United States of America) 235 Should we systematically screen for HNPCC in patients with upper urinary tract transitional cell carcinoma? G. Pignot, A. Rouquette, A. Vieillefond, G. Olagui, D. Amsellem-Ouazana, N. Barry De Longchamps, M. Zerbib, B. Terris (Le Kremlin Bicetre, Paris, France) 236 Using microrna profiling in urine samples to develop a non-invasive test for bladder cancer L. Mengual, J.J. Lozano, M. Ingelmo-Torres, C. Gazquez, M.J. Ribal, A. Alcaraz (Barcelona, Spain) 237 MicroRNA signature associated with poor outcome in upper urinary tract tumours L. Izquierdo Reyes, M. Ingelmo, C. Mallofre, J.J. Lozano, M. Verhasselt-Crinquette, X. Leroy, P. Colin, E. Comperat, M. Rouprêt, A. Alcaraz, L. Mengual (Barcelona, Spain; Lille, Paris, France) 238 Urinary biomarkers in the follow-up of low grade non-muscle invasive bladder cancer patients: Update on the FP7 UROMOL project T.C.M. Zuiverloon, W. Beukers, K.A. Van Der Keur, N. Malats, P. Malmstrom, U. Segersten, L. Dyrskjot, T. Orntoft, E.C. Zwarthoff (The Hague, The Netherlands; Madrid, Spain; Uppsala, Sweden; Århus, Denmark) 136 Programme Book

137 239 The unattainability of bladder cancer biomarkers: Utility-based assessment of a hypothetical non-invasive surveillance tool for bladder cancer recurrence D. Nekeman, L.J. Billingham, N.K. Aaronson, N.D. James, K.K. Cheng, R.T. Bryan, M.P.A. Zeegers (Birmingham, United Kingdom; Amsterdam, The Netherlands) 240 The ADC value is a prognostic biomarker of upper urinary tract cancer: Potential application to preoperative risk stratification S. Yoshida, S. Kobayashi, F. Koga, J. Ishioka, C. Ishii, H. Tanaka, Y. Nakanishi, Y. Matsuoka, N. Numao, K. Saito, H. Masuda, Y. Fujii, K. Kihara (Tokyo, Japan) 241 Preoperativ serum C-reactive protein: A prognostic marker in patients with upper urinary tract urothelial carcinoma B. Stein, A.J. Schrader, G. Wegener, C. Seidel, M.A. Kuczyk, S. Steffens (Hanover, Ulm, Germany) 242 The predictive value of C-reactive protein on prognosis of patients with upper tract urothelial carcinoma treated with radical nephroureterectomy: Multi-institutional study E. Kikuchi, N. Tanaka, S. Shirotake, K. Matsumoto, H. Kobayashi, Y. Miyazaki, H. Ide, J. Obata, K. Hoshino, N. Hayakawa, Y. Ito, K. Kanao, A. Miyajima, T. Momma, K. Nakagawa, M. Ueno, M. Oya (Tokyo, Saitama, Japan) Saturday EAU Milan

138 Saturday, 16 March - EAU Programme Abstract Session Cell based therapy in pelvic floor dysfunction Blue Hall Level N1 Poster Session 21 Chairs: K-E. Andersson, Winston Salem (US) D. Eberli, Zurich (CH) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 243 Effects of injected undifferentiated or differentiated mesenchymal stem cells on the continence mechanism L. Lisa, M. Martin, S. Sabine, A. Stenzl, K-D. Sievert (Tübingen, Germany) * 244 Stem cell therapy for stress urinary incontinence: Comparison of bone marrow and adipose derived stem cells in animal model O. El Yazami Adli, O. Loutochin, R. Caremel, J. Corcos (Montreal, Canada) Saturday 245 Urodynamic and histologic effects of autologous adipose derived stem cells endoscopically injected in a porcin model of intrinsic sphincter deficiency R. Boissier, L. Giraudo, J. Veran, J. Magalon, F. Sabatier, S. Giusiano, S. Garcia, L. Arnaud, F. Dignat-George, G. Magalon, E. Lechevallier, S. Berdah, G. Karsenty (Marseille, France) 246 The role of donor age and gender on the success of autologous human muscle precursor cell transplantation for sphincter insufficiency M.N.L. Stölting, L.J. Hefermehl, M. Tremp, F.Z. Azzabi, T. Sulser, D. Eberli (Zürich, Switzerland) 247 A novel three-dimensional tubular biodegradable scaffolds for tissue engineering of the urethra X.Q. Wang, Q.H. Chen, J.H. Hu, Y.C. Hou, C.X. Wang (Changchun, China) 248 Stabilization strategies of tissue engineered urothelium and its application in nude rats and minipigs M. Vaegler, S. Maurer, L. Daum, K-D. Sievert (Tübingen, Germany) 249 Proliferation and contractility modulation of bladder smooth muscle cells under physiological stretch K.J. Wang, T. Wu, Y. Tian, X. Yue, L. Cheng, H. Li (Chengdu, China) 250 Tubular matrices for biohybrids V. Seifarth, J. Grosse, M. Gossmann, I. Heschel, W. Zang, G.M. Artmann, A.T. Artmann (Jülich, Aachen, Herzogenrath, Germany) 251 Improving bioperformance of meshes for SUI and POP by coating with autologous plasma - results of a long term animal study H.G. Gerullis, M. Boros, B. Klosterhalfen, G. Heusch, E. Georgas, C. Eimer, T. Otto (Neuss, Düren, Essen, Germany; Szeged, Hungary) 252 High-frequency micro-ultrasound, spot test, bladder leakage capacity, and time to leakage to determine the functional alteration in different rat models of stress urinary incontinence L. Hakim, M. Endo, A. Feola, P. Uvin, D. Soebadi, J. Deprest, D. De Ridder, M. Albersen, F. Van Der Aa (Leuven, Belgium; Surabaya, Indonesia) 138 Programme Book

139 253 Synergistic property of triple combination pre-differentiated cell transplantation for urethral sphincter regeneration B.S. Kim, J.N. Lee, S.Y. Kwon, H.T. Kim, E.S. Yoo, S.K. Chung, B.W. Kim, Y.K. Park, J.Y. Choi, S.H. Choi, T.H. Kim, J.B. Kwon, T.G. Kwon (Daegu, South Korea) Summary on stem cell therapy in the near future? D. Eberli, Zurich (CH) Saturday EAU Milan

140 Saturday, 16 March - EAU Programme Abstract Session Robot-assisted partial nephrectomy Yellow Hall Level N1 Poster Session 22 Chairs: H. Baumert, Paris (FR) M.E. Sullivan, Oxford (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 254 Margin, Ischemia, and Complications (MIC) System to report perioperative outcomes of robot-assisted partial nephrectomy: An European Multicenter Observational Study (EMOS project) N.M. Buffi, G. Lista, V. Ficarra, A. Mottrie, J. Porter, G. Lughezzani, A. Larcher, F.A. Mistretta, A. Cestari, M. Lazzeri, G. Guazzoni (Milan, Padua, Italy; Aalst, Belgium; Seattle, United States of America) 255 Robotic partial nephrectomy for completely endophytic renal masses R. Autorino, A. Khalifeh, H. Laydner, D. Samarasekera, R. Stein, G-P. Haber, J. Kaouk (Cleveland, United States of America) Saturday 256 Robot assisted partial nephrectomy for hilar tumors: Perioperative outcomes R. Eyraud, J-A. Long, S-L. Devon, R. Autorino, S. Hillyer, J. Klink, E. Rizkala, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States of America) 257 Robotic partial nephrectomy: Imperative vs elective indications J-A. Long, B. Lee, R. Eyraud, R. Autorino, S. Hillyer, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States of America) 258 Functional outcome six months after robot-assisted partial nephrectomy V. Ficarra, E. Frumenzio, M. Borghesi, M. Gan, G. Novara, A. Mottrie (Aalst, Belgium; Padua, Italy) * 259 Robotic-assisted versus open partial nephrectomy: A prospective multicenter comparison study of perioperative outcomes (AGILE project) A. Minervini, G. Vittori, A. Antonelli, A. Celia, S. Crivellaro, D. Dente, V. Di Santo, B. Frea, M. Gacci, A. Gritti, L. Masieri, A. Morlacco, A. Porreca, B. Rocco, P. Parma, S. Serni, C. Simeone, S. Zaramella, M. Carini (Florence, Brescia, Bassano del Grappa, Udine, Abano Terme, Milan, Mantova, Novara, Italy) 260 Outcomes for open and minimally invasive partial nephrectomy since the introduction of robotic partial nephrectomy: Results from the Nationwide Inpatient Sample K.R. Ghani, S. Sukumar, J.D. Sammon, W. Jeong, C.G. Rogers, M. Menon (Detroit, United States of America) * 261 A prospective comparison of surgical and pathological outcomes obtained after robot-assisted or pure laparoscopic partial nephrectomy in moderate to complex renal tumors: Results from a French multicentric collaborative study A. Masson-Lecomte, K. Bensalah, E. Seringe, C. Vaessen, A. De La Taille, N. Doumerc, P. Rischmann, F. Bruyere, L. Soustelle, S. Droupy, M. Rouprêt (Creteil, Rennes, Paris, Toulouse, Tours, Nîmes, France) 262 Postoperative complications after open, robotic-assisted, and laparoscopic partial nephrectomy in elderly patients F. Roghmann, H. Lavigueur-Blouin, M. Meskawi, Z. Tian, A. Abdo, M. Sun (Montreal, Canada) 140 Programme Book

141 263 Laparoscopic vs open partial nephrectomy for T1 renal tumors: Evaluation of the long-term oncologic and functional outcomes in 340 patients C. Springer, P. Fornara, F. Greco (Halle Saale, Austria) 264 Open versus laparoscopic partial nephrectomy for clinical T1a renal tumors: A prospective multicenter comparative study (RECORd project) A. Minervini, S. Serni, A. Antonelli, G. Bianchi, A.M. Bocciardi, A. Chindemi, R. Fantechi, V. Ficarra, C. Fiori, G. Martorana, M. Medica, V. Mirone, G. Novara, F. Porpiglia, B. Rovereto, R. Schiavina, C. Simeone, C. Terrone, A. Volpe, M. Carini (Florence, Brescia, Modena, Milan, Padua, Turin, Bologna, Sestri Levante, Naples, Pavia, Novara, Italy) Summary H. Baumert, Paris (FR). Saturday EAU Milan

142 Saturday, 16 March - Sponsored Sessions Workshop Overview Holmium Life Enhancing Plan (HoLEP) - The real BPH lifetime solution page 407 Amber Hall 6 - Level S2 Sponsored by LUMENIS Symposia Overview Navigating the new landscape in CRPC page 402 euro Auditorium - Level S2 Sponsored by ASTELLAS LUTS/BPH and sexual health - Bridging the gap page 403 Brown Hall Level S2 Sponsored by ELI LILLY AND COMPANY Risk stratification to optimize the management of men with symptomatic BPH at risk of progression page 404 Platinum Hall - Level S3 Sponsored by GLAXOSMITHKLINE Increasing evidence of effectiveness of GAG therapy in different forms of cystitis page 405 Amber Hall Level S2 Sponsored by IBSA INSTITUT BIOCHIMIQUE Saturday Transurethral resection of bladder tumor: How to reach excellence page 406 Brown Hall 3 - Level S2 Sponsored by IPSEN Premature ejaculation treatment: New perspectives for the couple page 408 Yellow Hall Level N1 Sponsored by MENARINI 142 Programme Book

143 Sunday, 17 March - EAU Programme Plenary Session Upper urinary tract euro Auditorium - Level S2 Chairs: F.C. Hamdy, Oxford (GB) F. Montorsi, Milan (IT) Highlight session 1 Prostate disease A. Descazeaud, Limoges (FR) Female urology H. Hashim, Bristol (GB) Reconstruction C. Surcel, Bucharest (RO) Introduction to the plenary session F. Montorsi, Milan (IT) Update The dilemmas in diagnosing upper tract urothelial cancer M.P. Laguna, Amsterdam (NL) Aims and objectives Upper tract urothelial cancer accounts for a very small percentage of all urological malignancies. It has traditionally been characterised for an aggressive phenotype and late diagnosis. However advances in cross sectional imaging, miniaturisation of endoscopic instruments, and developments of additional optical visualisation methods and cytological biomarkers has resulted in a shift in stage at presentation. Accuracy and opportunity of the different diagnostic methods from suspicion of upper urinary tract tumor to confirmation of urothelial cancer will be discussed Debate How much surgery for upper tract urothelial cancer? Moderator: T.S. O Brien, London (GB) Sunday Nephroureterectomy or partial ureterectomy? S.F. Shariat, New York (US) Endoscopy is enough O. Traxer, Paris (FR) Lymphadenectomy helps the patients? M. Brausi, Modena (IT) Aims and objectives Delegates will hear the pros and cons of organ sparing approaches in UUTUC debated. Does nephron sparing surgery deserve a more prominent role in the management of UUTUC? The place of conservative ureteric excision with re-implantation, and endoscopic ablation will be critically addressed. Which patients are suitable for which approach? When patients have to undergo radical surgery, how radical does that surgery need to be? The place of lymphadenectomy is debated in all urological cancers and UUTUC is no different. Prof Brausi will address EAU Milan

144 the evidence for lymphadenectomy and delegates should leave with a clear understanding of which patients have most to gain from lymphatic clearance and how extensive that clearance needs to be EAU Guidelines Office case discussion Upper urinary tract tumours Moderator: Panel: M. Rouprêt, Paris (FR) J. Palou, Barcelona (ES) R.E. Zigeuner, Graz (AT) Aims and objectives The new version of the European Association of Urology (EAU) guidelines on upper urinary tract tumours known as urothelial carcinomas of the upper tract (UTUCs) are likely to be released in The EAU Guideline working group for UTUCs has prepared current guidelines to provide evidence-based information for the clinical management of these rare tumours and to help clinicians incorporate these recommendations into their practice. Through clinical cases, we will emphasize the most important Take-Home messages and address concrete issues Société Internationale d Urologie (SIU) lecture The role of ESWL in upper urinary tract stones M.R. Desai, Naidad (IN) Update Interventional imaging in upper urinary tract stone disease: What s new? C.M. Scoffone, Turin (IT) Aims and objectives Endourological treatment of urolithiasis is a field where the concept of image-guided therapy has the chance to display all its value. In fact, interventional imaging during the endoscopic treatment of ureteral and pyelocalyceal stones is fundamental for the performance of a safe and effective procedure. The integrated use of fluoroscopy, ultrasound, computed tomography, magnetic resonance and endoscopic vision will be discussed, as well as the most recent advances and innovations regarding these consolidated techniques (rotational 3D fluoroscopy, Doppler, 3D and 4D ultrasound, flat-panel volume CT and CT/pyelography, open configuration MRI, image fusion techniques, HD endoscopic imaging) and the need for a multidisciplinary cooperation between endourologist and radiologist. The issue of radioprotection will also be addressed (including the X-ray-free percutaneous access), as well as the correlation of the mentioned tools with preoperative diagnostic work up. Sunday Case discussion From above or below: Flexible, rigid or percutaneous management of upper urinary tract stones Moderator: P.J. Osther, Fredericia (DK) PCNL A. Skolarikos, Athens (GR) Flexible E.K. Bres-Niewada, Warsaw (PL) What is the best energy for fragmentation? T. Bach, Hamburg (DE) Aims and objectives Rapid technological developments continuously set new standards in stone treatment. The combined introduction of digital flexible ureteroscopes, new laser settings, superflexible utensils and pressurecontrolled irrigation with the possibility of on-demand flushing clearly has expanded the indications for ureteroscopic renal stone management. In complex cases combined (antegrade retrograde) procedures are increasingly being used. In this session we will through case discussions explore pros and cons of different approaches to the endourological treatment of renal stones: which cases are most suitable for a 144 Programme Book

145 combined approach?, which cases are best treated from below or from above?, and which type of stone fragmentation energy should be applied in the different situations? Update Observation and deferred intervention in the management of stones T. Knoll, Sindelfingen (DE) Aims and objectives Is it all about intervention? This lecture reviews current concepts of stone observation and medical expulsive therapy. It will try to give decision algorithms when active treatment should be initiated and which treatment options could be chosen. Sunday EAU Milan

146 Sunday, 17 March - EAU Programme Abstract Session Robot-assisted kidney surgery Platinum Hall - Level S3 Video Session 3 Chairs: A. Carbone, Latina (IT) P.T. Piechaud, Bordeaux (FR) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V18 V19 V20 V21 V22 Robot-assisted partial nephrectomy: Fluorescence imaging and zero ischemia for complex hilar and intrarenal tumours N. Harke, A. Kunz, F. Schiefelbein, G. Schoen (Würzburg, Germany) Robotic anatrophic incision for nephron sparing surgery for complete intrarenal tumor in the renal sinus R. Sotelo Noguera, R. Cisneros, O. Carmona, R. De Andrade, G. Fernández, J. Castro, R. Garza (Caracas, Venezuela) The use of semiflexible and flexible intraoperative laparoscopic ultrasound transducers during robotassisted laparoscopic partial nephrectomy S. Poth, C. Wagner, A.P. Labanaris, A. Schütte, J.H. Witt (Gronau (Westfalen), Germany) New 3-dimensional head-mounted display system (RoboSurgeon system) applied to gasless, single-port access, clampless partial nephrectomy K. Kihara, Y. Fujii, H. Masuda, K. Saito, F. Koga, N. Numao, Y. Matsuoka (Tokyo, Japan) Robot-assisted suturless unclamped partial nephrectomy by enucleation R. Eyraud, E. Rizkala, R. Autorino, H. Laydner, A. Khalifeh, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States of America) Sunday V23 V24 Zero ischemia robot assisted laparoscopic partial nephrectomy for a totally endophytic renal tumor G. Simone, R. Papalia, M. Ferriero, S. Guaglianone, M. Costantini, E. Forastiere, M. Gallucci (Rome, Italy) Complications during robot-assisted kidney surgery R.K. Kumar, B.F. Kaczmarek, M. Menon, C.G. Rogers (Detroit, United States of America) V25 Robotic partial nephrectomy with cold ischemia and early tumor extraction: Recapitulating the open approach C.G. Rogers, R.K. Kumar, K.R. Ghani, W. Jeong, M. Menon (Detroit, United States of America) 146 Programme Book

147 Sunday, 17 March - EAU Programme Abstract Session Prostate cancer: Active surveillance Brown Hall Level S2 Poster Session 23 Chairs: L.M. Campos Pinheiro, Lisboa (PT) T.M. De Reijke, Amsterdam (NL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 265 Monitoring of three-dimensionally mapped biopsy-proven image-visible lesions of prostate cancer on active surveillance: 11 year experience S. Shoji, O. Ukimura, A.L. De Castroabreu, S. Leslie, T. Uchida, I. Gill, D. Bahn (Los Angeles, United States of America; Hachioji, Japan) * 266 Role of multiparametric 3.0 Tesla magnetic resonance imaging in prostate cancer patients eligible for active surveillance B.H. Park, S.H. Choo, H.J. Jang, Y.S. Suh, U.S. Jeong, W. Song, H.G. Jeon, B.C. Jeong, S.I. Seo, S.S. Jeon, H.Y. Choi, K.S. Lee, H.M. Lee (Seoul, South Korea) 267 Radiological progression in men with prostate cancer on active surveillance A.J. Ridout, D. Stevens, C. Allen, A. Kirkham, A. Freeman, C. Jamieson, M. Emberton, C.M. Moore (London, United Kingdom) 268 Impact of multiparametric prostate MRI on the selection of active surveillance patients F. Sanguedolce, A.R. Padhani, N. Anyamene, J. Beatty, G. Hellawell (London, United Kingdom) 269 Low risk prostate cancer patients without visible tumor (T1c) on diffusion-weighted MRI could qualify for active surveillance candidate regardless of inclusion criteria of active surveillance protocol D.H. Lee, K.H. Kim, S.H. Lee, K.H. Rha, Y.D. Choi, S.J. Hong, B.H. Chung (Seoul, South Korea) 270 The significance of finding no prostate cancer on the active surveillance confirmatory biopsy: Implications for pathological re-classification L.M. Wong, G. Trottier, N. Lawrentschuk, N.E. Fleshner, G. Kulkarni, A.R. Zlotta, J. Trachtenberg, A. Toi, N. Timilshina, A. Finelli (Toronto, Canada) Sunday 271 The value of histological revision of biopsy cores in patients suitable for active surveillance: Comparison with surgical specimens after radical prostatectomy and clinical follow-up R. Schiavina, M. Fiorentino, E. Brunocilla, M.S. Rossi, S. Rizzi, D. Romagnoli, L. Bianchi, M. Borghesi, D. Diazzi, H. Dababneh, G. Passaretti, G. Martorana (Bologna, Italy) 272 The HAROW study - an observational health service study, capturing current low-risk-prostate cancer treatment practice patterns in Germany A. Becker, L.A. Kluth, S. Beermann, D. Seiler, F. Recker, F.K. Chun, L. Weissbach (Hamburg, Berlin, Germany; Aarau, Switzerland) * 273 Is PSA doubling time reliable as a progression risk criterion for patients with low-risk prostate cancer in an active surveillance programme? F.B. Thomsen, I.J. Christensen, M.A. Røder, K. Brasso, P. Iversen (Copenhagen, Denmark) EAU Milan

148 * 274 Prostate cancer active surveillance: Health-related quality of life in the Finnish arm of the prospective PRIAS-study. Three year update U. Lokman, H. Vasarainen, K. Lahdensuo, A.M. Erickson, K. Taari, T.K. Mirtti, A. Rannikko (Helsinki, Finland) 275 The prevalence of depression and anxiety in men undergoing active surveillance for prostate cancer S.D. Watts, G. Leydon, A.J. Ridout, E.J. Arden-Close, C.M. Moore, A. Richardson, B. Birch, G. Lewith (Southampton, London, United Kingdom) Sunday 148 Programme Book

149 Sunday, 17 March - EAU Programme Abstract Session Bladder cancer: Pathology Brown Hall 3 - Level S2 Poster Session 24 Chairs: P-U. Malmström, Uppsala (SE) Y.M. Osman, Mansoura (EG) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 276 Impact of histological variants on oncological outcomes of patients with urothelial carcinoma of the bladder treated with radical cystectomy E.N. Xylinas, M. Rink, L. Kluth, B.D. Robinson, Y. Lotan, M. Babjuk, A. Brisuda, D.A. Green, A. Pycha, Y. Fradet, R.K. Lee, P.I. Karakiewicz, M. Zerbib, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of America; Prague, Czech Republic; Bolzano, Italy; Quebec City, Montreal, Canada; Paris, France) 277 Methylation of tumor suppressor genes predict recurrence and subclassify non muscle-invasive disease: PTA low grade versus pt1 low grade and pt1 high grade bladder tumors R. Sacristan, C. Gonzalez, J.M. Fernandez-Gomez, F. Fresno, S. Escaf, M. Sanchez-Carbayo (Madrid, Spain) 278 Could a mutational status of fibroblast growth factor receptor 3 (FGFR3) gene in bladder cancer tissue improve accuracy of clinical staging? A.I. Rolevich, M.P. Smal, S.A. Krasny, R.I. Goncharova, S.L. Polyakov, T.I. Nabebina (Minsk, Belarus) 279 Practical potential of immunohistochemical staining with anti-smoothelin, anti-vimentin and anticaldesmon antibodies in pathological staging of urothelial bladder carcinoma S. Poletajew, E. Wilczek, D. Łukasik, A. Wasiutynski, B. Górnicka (Warsaw, Poland) 280 Micropapillary variant of urothelial carcinoma in the upper urinary tract H.H. Sung, J.J. Kim, K.S. Lee, S.H. Choo, H.J. Jang, Y.S. Suh, S. Jeong, W. Song, J. Cho, G.Y. Kwon, H.G. Jeon, B.C. Jeong, S.I. Seo, S.S. Jeon, H-Y. Choi, H.M. Lee (Seoul, South Korea) 281 Multivariate analysis of clinical and pathological predictive factors of understaging, in patients undergoing radical cystectomy A. De Gracia, O. Rodriguez Faba, J. Palou, F. Algaba, J.M. Gaya, A. Breda, L.I. Gausa, A. Wong, H. Villavicencio (Barcelona, Spain) Sunday 282 Outcome of radical cystectomy for muscle-invasive bladder cancer secondary to previous non muscleinvasive stages is comparable to primary muscle-invasive bladder cancer and impacted by EORTC riskscore A. Aziz, M. Gierth, H-M. Fritsche, M. May, W. Otto, W. Wieland, S. Denzinger, A. Merseburger, H. Riedmiller, A. Kocot, M. Burger (Regensburg, Straubing, Hanover, Würzburg, Germany) EAU Milan

150 283 Incidence and prognostic impact of prostate cancer on cystectomy specimens: Results of a French multicenter study G. Pignot, L. Salomon, Y. Neuzillet, A. Masson-Lecomte, C. Lebacle, J-J. Patard, P. Lunardi, P. Rischmann, G. Pasticier, J-C. Bernhard, J. Cohen, M-O. Timsit, B. Peyronnet, G. Verhoest, C. Legoux, M. Zerbib, F. Brecheteau, P. Bigot, S. Larre, T. Murez, R. Thuret, E. Lacarriere, C. Champy, M. Rouprêt, E. Comperat, J. Berger, A. Descazeaud, S. Lavilledieu, C. Avances, F. Delage, A. Valeri, B. Molimard, X. Durand, A. Houlgatte, P. Gres, A. Donnaint, F. Kleinclauss, S. Legal, A. Doerfler, N. Koutlidis, L. Cormier, J-F. Hetet, P. Colls, A. Arvin-Berod, J-J. Rambeaud, H. Quintens, M. Soulie, C. Pfister (Le Kremlin Bicetre, Creteil, Suresnes, Toulouse, Bordeaux, Paris, Rennes, Angers, Montpellier, Rouen, Limoges, Nimes, Brest, Niort, Besançon, Caen, Dijon, Nantes, Grenoble, Saint-Laurent-Du-Var, France) * 284 The role of preoperative prostatic urethral biopsy in clinical decision-making at the time of radical cystectomy J.M. Gaya, G.M. Badalato, G. Hruby, D.D. Holder, J.M. McKiernan (Barcelona, Spain; New York, United States of America) 285 Precystectomy nomogram predicting risk of regional lymph node metastases in bladder cancer patients L.V. Mirylenka, O.G. Sukonko, A.V. Pravorov, A.I. Rolevich (Minsk Region, Belarus) 286 Clinical and pathological nodal staging score for urothelial carcinoma of the bladder are valid decision tools for risk assessment and clinical decision-making: An external validation M.S. Gierth, H.M. Fritsche, H. Buchner, M. May, A. Aziz, W. Otto, C. Bolenz, L. Trojan, E. Hermann, A. Tiemann, S.C. Müller, J Ellinger, S. Brookman-May, C. Stief, D. Tilki, P. Nuhn, T. Höfner, M. Hohenfellner, A. Haferkamp, J. Roigas, M. Zacharias, W.F. Wieland, H. Riedmiller, S. Denzinger, P. Bastian, M. Burger (Regensburg, Munich, Straubing, Mannheim, Göttingen, Münster, Bonn, Heidelberg, Frankfurt, Berlin, Würzburg, Germany) 287 A consensus study on invasiveness of bladder cancer using virtual microscopy and heatmaps (pt1 ENUP (European Network of UroPathology) study E. Compérat, L. Egevad, A. Lopez-Beltran, P. Camparo, F. Algaba, M. Amin, J. Epstein, H. Hamberg, C. Hulsbergen-Van De Kaa, G. Kristiansen, R. Montironi, C.C. Pan, K. Treurniet, J. Sykes, T. Van Der Kwast (Paris, Amiens, France; Stockholm, Uppsala, Sweden; Cordoba, Barcelona, Spain; Los Angeles, Baltimore, United States of America; Nijmegen, Rotterdam, The Netherlands; Bonn, Germany; Ancona, Italy; Tapei, Taiwan; Toronto, Canada) Sunday 150 Programme Book

151 Sunday, 17 March - EAU Programme Abstract Session Prostate cancer: Surgery outcomes Silver Hall - Level N2 Poster Session 25 Chairs: R. Ganzer, Regensburg (DE) E. Liatsikos, Patras (GR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 288 Urodynamic evaluation of urethral function after robot-assisted laparoscopic radical prostatectomy: A comparison with laparoscopic radical prostatectomy Y. Matsukawa, Y. Yoshino, M. Kato, N. Sassa, K. Matsuo, S. Takai, M. Gotoh (Nagoya, Japan) 289 Preoperative functional status predicts urinary continence recovery after radical prostatectomy P. Dell Oglio, G. Gandaglia, U. Capitanio, V. Scattoni, N. Suardi, A. Russo, N.M. Passoni, F. Abdollah, A. Salonia, V. Mirone, R. Damiano, G. Guazzoni, A. Gallina (Milan, Naples, Catanzaro, Italy) * 290 Survival, continence and potency (SCP) outcomes 5-years after robot-assisted radical prostatectomy A. Mottrie, M. Borghesi, E. Frumenzio, G. Novara, M. Gan, V. Ficarra (Aalst, Belgium; Padua, Italy) 291 Quality of life and treatment options for low risk prostate cancer I.C. Acar, C. Schoffelmeer, C. Tillier, W. De Blok, E. Van Muilekom, H. Van Der Poel (Amsterdam, The Netherlands) 292 Delay of curative treatment for prostate cancer and outcomes: Cohort analysis and literature review R.C.N. Van Den Bergh, C. Schoffelmeer, H.G. Van Der Poel (Utrecht, Amsterdam, The Netherlands) 293 Secondary radiotherapy after radical prostatectomy does not compromise urinary continence M. Adam, P. Wenzel, D. Lanwehr, M. Graefen, U. Michl, A. Faried, H. Huland, T. Schlomm, P. Tennstedt, A. Becker, R. Schwarz (Hamburg, Germany) 294 Capsular incision during radical prostatectomy does not affect early biochemical recurrence rates P. Tennstedt, A. Haese, M. Graefen (Hamburg, Germany) Sunday 295 Inverse stage migration of clinically localized prostate cancer still continues and is most pronounced in elder patients M.C. Butea-Bocu, H. Huland, U. Michl, G. Salomon, T. Steuber (Hamburg, Germany) 296 The Worcestershire prostate cancer survivorship programme: A new concept for holistic long term support and follow up S. Goonewardene, M. Symons, A. Sullivan, V. Milner, G. McCormack, A. Makar (Worcester, United Kingdom) 297 Accuracy of phased-array 3.0-T MR imaging in predicting extracapsular extension and influence on the decision to preserve neurovascular bundles at robotic assisted laparoscopic radical prostatectomy B.H. Park, S.H. Choo, H.J. Jang, Y.S. Suh, U.S. Jeong, W. Song, H.G. Jeon, B.C. Jeong, S.I. Seo, H.Y. Choi, H.M. Lee, K.S. Lee, S.S. Jeon (Seoul, South Korea) 298 PUKA study: A snapshot of radical prostatectomy practice in the UK A. Laird, S. Fowler, D. Cahill, S.F. Brewster, T. O Brien, S.A. McNeill (Edinburgh, London, Oxford, United Kingdom) EAU Milan

152 299 Perioperative, functional and oncological outcomes after robot-assisted radical prostatectomy in men 70 years of age and over with localized prostate cancer C. Giedelman, H. Abdul-Muhsin, O. Schatloff, S. Samavedi, R. Coelho, A. Sivaraman, S. Chauhan, K.J. Palmer, G. Ebra, V. Patel (Celebration, United States of America) Sunday 152 Programme Book

153 Sunday, 17 March - EAU Programme Abstract Session Treatment of neurogenic LUTD Red Hall 1 - Level N1 Poster Session 26 Chairs: V.W. Nitti, New York (US) A. Reitz, Zurich (CH) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 300 Desmopressin in the treatment of nocturia in patients affected by Parkinson s disease S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, A. Giannantoni (Rozzano, Perugia, Italy) 301 Treatment of neurogenic detrusor overactivity (NDO) by combined low dosed antimuscarinics: Four years experience M. Spinelli, M. Citeri, C. Guerrer, L. Zanollo (Milan, Italy) 302 Lower urinary tract symptoms and urodynamic dysfunctions in clinically isolated syndromes suggestive of multiple sclerosis S. Proietti, M. Di Filippo, P. Sarchielli, M Gubbiotti, J.A. Rossi De Vermandois, L. Gaetani, P. Calabresi, A. Giannantoni (Milan, Perugia, Italy) 303 Urinary symptoms and sexual dysfunction in patients affected by multiple sclerosis A. Giannantoni, S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, M. Porena (Perugia, Rozzano (mi), Italy) * 304 Long term functional outcomes after continent cutaneous urinary diversion in patients with neurological disease: A monocentric experience M.A. Perrouin-Verbe, V. Phé, M. Rouprêt, A. Even, F. Giuliano, G. Robain, P. Denys, M-O. Bitker, E. Chartier- Kastler (Paris, Garches, France) 305 Effects of anticholinergic agents on efficacy of penile vibratory stimulation to obtain ejaculation in spinal cord injured males M. Spinelli, C. Guerrer, L. Zanollo, M. Citeri, L. Rizzato (Milan, Italy) Sunday 306 Investigation to restore innervation of the lower urinary tract of spinal cord injured patients: A European single-center retrospective study with long-term follow-up K-D. Sievert, B. Amend, F. Roser, A. Badke, A. Baron, J. Bedke, S. Kruck, H. Kaps, A. Stenzl, M. Tatagiba (Tübingen, Germany) 307 PNE versus staged test trials for sacral neuromodulation: Sensitivity, specificity and predictive values of each technique A. Banakhar, M. Hassouna (Jeddah, Saudi Arabia; Toronto, Canada) 308 Patient-reported goal achievement after onabotulinumtoxina treatment in patients with neurogenic detrusor overactivity E. Chartier-Kastler, V. Khullar, E. Rovner, M. Chancellor, C. Corbell, J. Jin, D. Globe (Paris, France; London, United Kingdom; Charleston, Royal Oak, Irvine, United States of America) EAU Milan

154 309 Withdrawn 310 Sacral neuromodulation for refractory lower urinary tract dysfunction: A prospective series of 98 patients undergoing tined lead test stimulation at a single center D.S. Engeler, D. Abt, D. Meyer, H-P. Schmid (St. Gallen, Switzerland) Summary - How to improve the treatment of neurogenic LUTD? V.W. Nitti, New York (US) Sunday 154 Programme Book

155 Sunday, 17 March - EAU Programme Abstract Session Stones: Basic research, imaging and training models Red Hall 2 - Level N1 Poster Session 27 Chairs: S. Oehlschläger, Dresden (DE) T. Sulser, Zürich (CH) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 311 Active phagocytosis and processing of calcium oxalate monohydrate crystals in an in vitro macrophage model A. Okada, T. Yasui, L. Zuo, K. Taguchi, Y. Fujii, Y. Itoh, Y. Hirose, M. Usami, K. Niimi, R. Ando, T. Kobayashi, S. Hamamoto, M. Hirose, Y. Itoh, K. Tozawa, K. Kohri (Nagoya, Japan) 312 Effects of aminobisphosphonates and thiazides in patients with hypercalciuria, recurrent renal calcium lithiasis and osteopenia/osteoporosis M.A. Arrabal Polo, S. Gonzalez-Torres, F. Lopez Carmona, C. Lahoz Garcia, J. Moreno Jimenez, A. Zuluaga Gomez, M. Arrabal Martin (Granada, Spain) 313 The Randall plaques - a new marker for metabolic syndrome? A. Ciudin, P. Luque, M.G. Diaconu, R. Salvador, A. Franco, R. Alvarez-Vijande, C. Nicolau, A. Alcaraz (Barcelona, Spain) 314 Using bisphosphonates to effectively inhibit calcium oxalate crystal aggregation S.E. Allen, S. Choong, C.H. Fry, W.G. Robertson (London, United Kingdom) 315 Detecting micro stones in urine after ESWL with quantitative micro-raman spectroscopy Y.C. Chiu, H.K. Chiang, S-H. Lu, A.W. Chiu (Taipei, Taiwan) 316 What is the best method to evaluate urine ph? A trial of three clinical urine ph measurement devices in a stone clinic R. Ilyas, K. Chow, J.G. Young (Manchester, United Kingdom) Sunday 317 In vitro study on ureteral smooth muscle relaxation with tamsulosin, nifedipine, and terpene mixure (Rowatinex ) J.W. Lee, M.Y. Lee, S.C. Park, J.S. Rim, I.Y. Seo (Iksan, South Korea) 318 Incidence of Computed Tomography (CT) detected urolithiasis: An update S.L. Lee, L.T. Koh, K.K. Ng, F.C. Ng (Singapore, Singapore) 319 Radiation exposure of the patient submitted to endourologic treatment for ureteral calculi F. Nigro, P. Ferrarese, G. Benedetto, E. Bratti, E. Scremin, S. Savastano, A. Tasca (Vicenza, Italy) 320 Evaluation of a novel fascial dilator modified with scale marker in PCNL for reduction of x-ray exposure: A randomized clinical study Z. Guohua, Z. Zhao, W. Zhong, W. Chen, W. Wu, D. Qi, C. Xiao, Y. Liu (Guangzhou, China) 321 Customized protocols for the Uro Dyna-CT reduce radiation exposure of endourological patients M-C. Rassweiler, R. Banckwitz, C. Koehler, B. Mueller-Allisaat, M.S. Michel, A. Haecker, M. Ritter (Mannheim, Forchheim, Germany) EAU Milan

156 322 Accuracy in measuring renal stones using the Uro Dyna-CT B. Meister, M-C. Rassweiler, C. Weiss, M.-S. Michel, A. Häcker, M. Ritter (Mannheim, Germany) 323 Stones of different compositions depiction in the Uro Dyna-CT B. Meister, M-C. Rassweiler, M-S. Michel, M. Ritter (Mannheim, Germany) Sunday 156 Programme Book

157 Sunday, 17 March - EAU Programme Abstract Session Preclinical innovation - the future of erectile dysfunction treatment? Blue Hall Level N1 Poster Session 28 Chairs: C.S.R. Costa, Porto (PT) E. Wespes, Brussels (BE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 324 Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile function in a rat model of Peyronie s disease F. Castiglione, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium; Baltimore, United States of America) * 325 Repair of erectile dysfunction using transplantation of human mesenchymal stem cells cultivated on the surface of nanofibrous meshes in rats with cavernous nerve injury Y.S. Song, H.J. Lee, J. An, J.H. Yun, J.H. Kim, S.W. Doo, W.J. Yang, S.U. Kim (Seoul, South Korea) 326 Galanin, a trophic neuropeptide, is upregulated in the rat major pelvic ganglia following cavernous nerve crush injury M. Albersen, J. Hannan, L. Hakim, X. Liu, F. Castiglione, F. Van Der Aa, P. Hedlund, T.J. Bivalacqua (Leuven, Belgium; Baltimore, United States of America; Milan, Italy) 327 Time-dependent changes in the regulation of neurotrophin expression and neurite sprouting in the rat major pelvic ganglion following cavernous nerve injury J. Hannan, M. Albersen, B.L. Stopak, X. Liu, A.L. Burnett, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua (Baltimore, United States of America; Leuven, Belgium; Milan, Italy) 328 Inhibition of the fatty acid amide hydrolase (FAAH) reduces in vivo spontaneous seminal vesicle contractions and increases latency to apomorphine-induced ejaculation G. La Croce, A. Bettiga, R. Buono, G. Colciago, F. Benigni, F. Mistretta, F. Castiglione, M. Albersen, P. Hedlund (Milan, Italy; Leuven, Belgium) Sunday 329 Expression of the transient receptor potential cationic channel A1 (TRPA1) in the human seminal vesicles - an immunohistochemical and molecular biology study S. Ückert, A. Simon, J.E. Sonnenberg, A.S. Merseburger, M.A. Kuczyk, P. Hedlund (Hanover, Barsinghausen, Germany; Milan, Italy) 330 Occlusion of the seminal vesicles increases sexual activity in male mice: Results of a novel mouse experiment F.D. Birkhäuser, C. Schumacher, R. Seiler, L. De Meuron, P. Zehnder, B. Roth, A. Wetterwald, G.N. Thalmann, M.G. Cecchini, U.E. Studer (Berne, Switzerland) 331 Cannabinoid receptors in the human seminal vesicles M. Moschini, A. Bettiga, R. Luciano, M. Freschi, P. Hedlund, S. Uckert (Milan, Italy; Hanover, Germany) 332 Involvement of Rho-kinase/LIM-kinase/cofilin signaling pathway in erectile dysfunction and corporal fibrosis after cavernous nerve injury in male rats M.C. Cho, S.H. Song, S.Y. Cho, K. Park, S.W. Kim, J-S. Paick (Goyang, Seoul, South Korea) EAU Milan

158 333 Adrenomedullin and angiopoietin-1 additively restore erectile function in diabetic rats: Comparison with the combination therapy with vascular endothelial growth factor and angiopoietin-1 H. Nishimatsu, E. Suzuki, A. Nomiya, A. Niimi, H. Fukuhara, T. Fujimura, M. Suzuki, H. Kume, Y. Homma (Tokyo, Kawasaki, Japan) 334 Usefulness of tropomyosin as a marker of response to 5-phosphodiesterase inhibitors R. Brime Menendez, L. San José Manso, I. Galante Romo, J.J. Leon Zamorano, P. Rodriguez Sierra, P. Jimenez Mateos-Cáceres, L. Calatrava Ledrado, P. Anastasio De Las Heras, A. Lopez Farre, C. Olivier Gómez (Madrid, Spain) 335 Testosterone replacement therapy can increase circulating endothelial progenitor cell number in men with late-onset hypogonadism C.T. Wu, C.H. Liao, S.P. Liu, Y.N. Wu, H.S. Chiang (Taipei, New Taipei City, Taiwan) Sunday 158 Programme Book

159 Sunday, 17 March - EAU Programme Abstract Session Renal tumour diagnosis: From new techniques to follow-up Yellow Hall Level N1 Poster Session 29 Chairs: A. Cestari, Milan (IT) J.M. De La Morena Gallego, Madrid (ES) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 336 Sorafenib decreases Indium-111-girentuximab tumor uptake in clear cell renal cell carcinoma patients C.H.J. Muselaers, O.C. Boerman, A.B. Stillebroer, I.M.E. Desar, M.J. Boers-Sonderen, C.M.L. Van Herpen, J.F. Langenhuijsen, E. Oosterwijk, W.P.J. Leenders, W.J.G. Oyen, P.F.A. Mulders (Nijmegen, The Netherlands) 337 Clinicopathological characteristics of Xp11 translocation renal cell carcinoma in adults: Diagnosis using FISH analysis in conjunction with TFE3 immunostaining M. Hirobe, N. Masumori, T. Tanaka, H. Kitamura, A. Tonooka, T. Hasegawa, T. Tsukamoto (Sapporo, Japan) 338 Do small renal cell carcinomas have a higher prevalance of locally advanced growth and distant metastases? A large multicentre study S. Steffens, M. Janssen, F.C. Roos, F. Becker, S. Schumacher, R. Hofmann, G. Wegener, S. Siemer, M. Stöckle, J.W. Thüroff, M. Schrader, K. Junker, M.A. Kuczyk, A.J. Schrader (Hanover, Homburg/Saar, Mainz, Homburg, Ulm, Marburg, Germany) 339 Histopathological and molecular predictors of chronic kidney disease progression and its related mortality after radical nephrectomy T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, A. Takenaka (Yonago, Japan) 340 Independent validation of the 2010 TNM staging system for renal cell carcinoma: Does it improves predictive accuracy in cancer-specific mortality compared to 2002 TNM? M. Roscigno, S. Shariat, M. May, R. Zigeuner, T. Chromecki, C. Stief, L. Schips, O. De Cobelli, B. Rocco, C. De Nunzio, B. Feciche, M. Truss, S. Pahernik, S. Zastrow, G. Novara, A. Minervini, A. Antonelli, V. Mirone, A. Simonato, R. Bertini, V. Ficarra, S. Brookman-May (Bergamo, Vasto, Milan, Rome, Padua, Florence, Brescia, Naples, Genova, Italy; New York, United States of America; Straubing, Munich, Dortmund, Heidelberg, Dresden, Regensburg, Germany; Graz, Austria; Cluj-Napoca, Romania; Aalst, Belgium) Sunday 341 Interdisciplinary counseling service for renal malignancies: Patients and physicians view of a new model of care J. Huber, A. Ihrig, E. Winkler, C. Gruellich, P. Hallscheidt, M. Zeier, S. Pahernik, M. Hohenfellner (Heidelberg, Germany) 342 Is it necessary to perform long term follow up in patients after surgery for renal cell carcinoma pt1 and pt2? S. Nestler (Mainz, Germany) 343 Prevalence of Computed Tomography (CT) detected solid renal masses: An update S.L. Lee, L.T. Koh, K.K. Ng, F.C. Ng (Singapore, Singapore) 344 Preoperative decision-making for renal cell carcinoma: Cystic morphology in cross sectional imaging predicts lower malignant potential J. Huber, A. Winkler, T. Bruckner, W. Roth, P. Hallscheidt, K. Daneshvar, M. Hohenfellner, S. Pahernik (Heidelberg, Germany) EAU Milan

160 345 Diffusion weigthed MRI of the kidney as surrogate marker for the prediction of the aggressiveness of renal carcinoma S. Sevcenco, F.E. Kuehhas, P. Weibl, T. Szarvas, G. Kramer, G. Heinz-Peer, D. Javor, L. Ponhold, P. Baltzer, H.C. Klingler (Vienna, Austria) 346 Use of contrast-enhanced ultrasonography in diagnosis of renal masses and concordance with computed tomography S. Alvarez Rodríguez, E. Sanz Mayayo, L. López-Fando Lavalle, L.A. Córdoba Martínez, V. Hevia Palacios, F. Arias Fúnez, R. Rodríguez-Patrón Rodríguez, F.J. Burgos Revilla (Madrid, Spain) 347 A large scale validation study proposes high pre-operative plasma fibrinogen levels as an independent negative prognostic factor regarding cancer-specific, metastasis-free, as well as overall survival in a European cohort of renal cell carcinoma patients G.C. Hutterer, M. Pichler, C. Stoeckigt, T. Chromecki, T. Stojakovic, S. Golbeck, S. Mannweiler, K. Pummer, R. Zigeuner (Graz, Austria) 348 Validation of CRP as prognostic marker for renal cell carcinoma in a large series of patients S. Steffens, A. Köhler, R. Rudolph, H. Eggers, C. Seidel, M. Janssen, G. Wegener, M. Schrader, M.A. Kuczyk, A.J. Schrader (Hanover, Ulm, Homburg, Germany) 349 Clinical significance of preoperative thrombocytosis in patient performed radical nephrectomy for nonmetastatic renal cell carcinoma P.H. Song, Y.S. Ji, K.H. Kim, Y.H. Ko, K.H. Moon, H.C. Jung (Daegu, Gyeongju, South Korea) Sunday 160 Programme Book

161 Sunday, 17 March - EAU Programme Thematic Session EAU Guidelines Office: Recommendation updates 2013 Brown Hall Level S2 Chair: K.F. Parsons, Liverpool (GB) Update Renal cell cancer guidelines B. Ljungberg, Umeå (SE) Aims and objectives The current update 2013 of the guidelines on Renal Cell Carcinoma is a first attempt to use a systematic review strategy of available literature. The literature search strategy includes the construction of screening questions using PICO elements for the evaluation. Using structured screening, flow diagrams present eligibility of studies, and data from included studies will be summarized. Based on the results recommendations can be presented based on the current knowledge. The update presents recommendations on diagnosis, treatment strategies including last releases on medical therapy used in renal cell carcinoma Update Imaging in Urology a European and United States perspective P. Fulgham, Dallas (US) Aims and objectives This portion of the lecture will demonstrate the variability of imaging terminology used in a single document regarding imaging in the management of ureteral calculous disease. The technology assessment analysed was written by four authors considered experts on urologic imaging, working closely together as the Ureteral Imaging Task Force under the aegis of the American Urological Association Guidelines Panel. We show that a single imaging modality such as computed tomography may have as many as 16 variations within a single document. Analysis of root terms and synonyms provides insight into how these varied terms may be subcategorised. A standardised nomenclature would facilitate the meta-analysis of the world s literature regarding that imaging modality and thereby produce more robust recommendations for its use. Standardisation of imaging nomenclature would be particularly helpful in developing guidelines shared by varied organisations. Although currently primarily descriptive, a standardised imaging terminology could become prescriptive if combined with performance parameters. T. Loch, Flensburg (DE) Sunday Aims and objectives With the evolution of imaging in Urology, there has been an exponential growth in research and considerable clinical interest in utilizing imaging techniques in clinical practice. It is a multidisciplinary process with contributions from investigators and clinicians of varied backgrounds: physics and engineering, informatics, urology, and radiology. However, the terminology used in this area is not uniform. As a consequence, there are often multiple abbreviations and synonyms for similar investigations with overlapping definitions that can potentially confuse or misdirect clinicians and researchers alike. As a contribution to the literature, clinical practice, and investigative urology, the Guideline Office (GO) of the EAU with its imaging panel has compiled a standard set of medical terms that are recommended to be used in clinical and investigative urology practice Update The pros and cons of urological thromboprophylaxis K.A.O. Tikkinen, Helsinki (FI) EAU Milan

162 Aims and objectives Decisions regarding both nonpharmacologic and pharmacologic peri-operative prophylaxis to prevent venous thromboembolism in patients undergoing urologic surgery are controversial, and practices differ substantially. Reasons for not using thromboprophylaxis include increased risk of bleeding, burden of interventions, and lack of knowledge. We will present the first EAU Guideline addressing thromboprophylaxis: provide evidence-based recommendations based on a systematic literature search. Our goals include estimation of baseline risk of symptomatic VTE and bleeding, and estimation of treatment effects of thromboprophylaxis. Finally, we will also present guidance on management of patients using anticoagulant medication for other reasons (bridging therapy). Sunday 162 Programme Book

163 Sunday, 17 March - EAU Programme Thematic Session What are the limitations of minimally invasive surgery? Yellow Hall Level N1 Chair: A. Breda, Barcelona (ES) State-of-the art lecture Do long-term outcomes of robot-assisted radical prostatectomy justify the costs? M. Stöckle, Homburg (DE) State-of-the-art lecture What are the limits of laparoscopic nephron-sparing surgery? A. Volpe, Novara (IT) Aims and objectives In experienced hands laparoscopic partial nephrectomy (LPN) for localised renal tumors achieves similar oncologic outcomes of open partial nephrectomy, with the known advantages of minimal invasiveness. However, LPN is a challenging technique which is associated with a higher risk of complications and a longer warm ischemia time, with the related potential effects on postoperative renal function. Modern techniques can limit or even avoid ischemia during LPN, but their feasibility in the hands of less experienced surgeons has not been assessed. Overall, the limits of LPN significantly depend on the laparoscopic experience and skills of each single surgeon. Although formal cost analysis and longer follow-up are needed, the ability of robotic assistance to reduce the technical challenges and overcome the limits of the pure laparoscopic approach are already being realised and are likely to become more evident with time and increasing expertise State-of-the-art lecture Open vs robot-assisted radical cystectomy and urinary diversion P. Wiklund, Stockholm (SE) Abstract presentations: Special selection from the poster sessions 261 A prospective comparison of surgical and pathological outcomes obtained after robot-assisted or pure laparoscopic partial nephrectomy in moderate to complex renal tumors: Results from a French multicentric collaborative study A. Masson-Lecomte, K. Bensalah, E. Seringe, C. Vaessen, A. De La Taille, N. Doumerc, P. Rischmann, F. Bruyere, L. Soustelle, S. Droupy, M. Rouprêt (Creteil, Rennes, Paris, Toulouse, Tours, Nîmes, France) Sunday 1017 Prospective randomised study comparing transperitoneal and extraperitoneal approach during robotic prostatectomy: Anesthesiologic effects F. Dal Moro, C. Valotto, A. Mangano, R. Soncin, A. Crestani, A. Guttilla, G.M. Pittoni, F. Zattoni (Padova, Italy) EAU Milan

164 Sunday, 17 March - EAU Programme Thematic Session From bench to bedside: What will be replacing PSA? Blue Hall Level N1 Chair: Z. Culig, Innsbruck (AT) State-of-the-art lecture Gene fusions in prostate cancer: Is it helping? T. Visakorpi, Tampere (FI) Aims and objectives The finding of TMPRSS2:ERG fusion immediately raised the question could it be utilized in the treatment of prostate cancer, either as a drug target or as a biomarker. What is good about the fusion genes as biomarkers, is that they are genetic alterations. As such they are cancer specific and do not exist in normal cells. There has been a large number of publications interrogating whether the TMPRSS2:ERG fusion detected in tissue specimen is associated with prognosis. Most of the studies suggest it is not. There have also been a few studies detecting the fusion from blood, circulating tumor cells (CTCs), and urine. And, it seems that in a combination with PCA3, TMPRSS2:ERG could improve the utility of serum PSA to detect clinically significant cancer. Also other fusion genes than TMPRSS2:ERG have been and will be identified in prostate cancer. Common factor for these fusions is that they are rare. Thus, they will unlikely have a potential of being biomarkers alone. However, they may turn out to be useful in selecting targeted drugs if available State-of-the-art lecture The role of the pathologist in clinical prognosis G. Kristiansen, Bonn (DE) State-of-the-art lecture MicroRNA in prostate cancer diagnosis H. Sültmann, Heidelberg (DE) Sunday Aims and objectives mirnas are small non-coding RNAs involved in posttranscriptional regulation of gene expression. While recent studies have suggested the usefulness of mirnas in tissues and body fluids for tumor diagnosis, prognosis, and prediction, technical parameters, e.g. nucleic acid recovery from limited sources of biomaterial, sample standardisation, data normalisation, as well as independent validation of screening data, are still challenging. The presentation will highlight the potential as well as obstacles for translating mirna markers into diagnostic applications for prostate cancer Abstract presentations: Special selection from the poster sessions 1045 Urinary PCA3 and TMPRSS2:ERG help predict biopsy outcome prior to initial prostate biopsy using a risk group analysis J.R. Day, L.A. Jones, S.E. Meyer, P.N. Hodge, J. Aussie, D.R. Saltzstein, J.C. Groskopf (San Diego, San Antonio, United States of America) 139 Reducing unnecessary biopsies for suspicion of prostate cancer: Extension and validation of an ERSPC based risk calculator with Phi M.J. Roobol, D. Nieboer, A. Houlgatte, S. Vincendeau, M. Lazzeri, G. Guazzoni, C. Stephan, A. Semjonow, A. Haese, M. Graefen, E.W. Steyerberg (Rotterdam, The Netherlands; Paris, Rennes, France; Milan, Italy; Berlin, Munster, Hamburg, Germany) 164 Programme Book

165 Sunday, 17 March - EAU Programme Thematic Session Non-muscle invasive bladder cancer Silver Hall - Level N2 Chair: J.W.F. Catto, Sheffield (GB) State-of-the-art lecture Molecular sub-classification of bladder cancer M. Sanchez-Carbayo, Madrid (ES) Aims and objectives As early events in bladder carcinogenesis, methylation and other epigenetic alterations would provide diagnostic power complementing previously described genetic factors. As related to different steps in tumor progression, they could also provide clinical utility for tumour sub-classification. Our group has been working over the past years on characterising whether hypermethylation of profiles, focused panels of tumor suppressor genes and individual candidates could classify bladder cancer subgroups according not only to pathologic or clinical criteria but also to patient outcome. Part of our studies is aiming to evaluate the clinical utility of CpG hypermethylation for the molecular classification of bladder tumours based on their aggressiveness and clinical behaviour: from comprehensive CpG array methylation profiling, to several multiplexed panels of TSGs, and finally characterising specific individual methylated candidates. In this talk, the major results of these three strategies for bladder cancer sub-classification will be summarised: using CpG arrays, methylation specific multiplex ligation-dependent probe amplification (MS-MLPA), and methylation specific polymerase chain reactions (MS-PCR) analyses State-of-the-art lecture Photodynamic diagnosis: Fact or fiction? M. Burger, Würzburg (DE) Aims and objectives The aims of this presentation is a comprehensive depiction of currently available data on the use of photodynamic diagnosis in bladder cancer and a critical debate and evaluation of the evidence. The first objective is the depiction of the potential impact of any method improving cystoscopic detection of bladder cancer. The second objective is the description, the mode of action and debate of the feasibility of photodynamic diagnosis. The third objective is an overview of currently available data on potential improvements of detection and recurrence rates compared to standard white light cystoscopy. The fourth objective is the debate of potential overall benefit for patients. The fifth objective is to pinpoint questions unanswered to date and the sixth objective is the critical evaluation of what we know so far and a debate on potential benefits and uncertainties. Sunday State-of-the-art lecture New advances in perioperative instillation therapy in NMIBC J.A. Witjes, Nijmegen (NL) Aims and objectives The initial resection of bladder tumors is a very important diagnostic and therapeutic tool. Therefore, optimal initial treatment, including pre-, per-, or postoperative intravesical instillations or other means of help, is an absolute must in bladder cancer treatment EAU Milan

166 Abstract presentations: Special selection from the poster sessions 708 Side effects of BCG in the treatment of intermediate and high risk Ta T1 papillary carcinoma of the bladder: Results from EORTC GU Cancers Group randomised study comparing 1/3 dose vs full dose during 1 or 3 years M. Brausi, J. Oddens, R. Sylvester, S. Colette, P. Gontero, A. Bono, L. Turkeri (Modena, Torino, Varese, Italy; s-hertogenbosch, The Netherlands; Brussels, Belgium; Istanbul, Turkey) 74 Interval between cystectomy and start of adjuvant chemotherapy is an independent prognostic factor for patients with locally advanced or lymph node positive carcinoma of the urinary bladder C.H. Ohlmann, J. Kamradt, B. Burgard, M. Saar, I. Azone, S. Siemer, M. Stöckle, J. Lehmann (Homburg, Kiel, Germany) Sunday 166 Programme Book

167 Sunday, 17 March - EAU Programme Thematic Session Joint session with the European Society of Nuclear Medicine: Diagnostics and therapy of bone metastases in patients with advanced prostate cancer Red Hall 2 - Level N1 Chairs: A. Chiti, Rozzano (IT) M. Wirth, Dresden (DE) Choline & Fluoride imaging of bone metastases in prostate cancer W. Langsteger, Linz (AT) Treatment of bone metastases B. Djavan, Vienna Alpharadin: New horizons in systemic therapy C. Parker, London (GB) Aims and objectives Radium-223 is a novel alpha-pharmaceutical that has been tested in men with bone metastases from advanced prostate cancer. Radium-223 is very similar to calcium, and so is rapidly taken up in bone, and particularly in bone metastases. It emits very high-energy alpha particles that cause lethal damage to adjacent tumour cells. The ALSYMPCA trial was a Phase III, randomised, double-blind, placebo-controlled study of radium-223 plus best standard care compared with placebo plus best standard care in 921 patients with castrate resistant prostate cancer (CRPC) and bone metastases. Radium-223 was associated with an overall survival benefit, a delay in time to first skeletal-related event, an improvement in quality of life and a favourable safety profile. These results suggest that radium-223 may provide a new standard of care for the treatment of men with CRPC and bone metastases. Sunday EAU Milan

168 Sunday, 17 March - EAU Programme Thematic Session Small renal masses: To treat or not to treat? euro Auditorium - Level S2 Chair: P.F.A. Mulders, Nijmegen (NL) State-of-the-art lecture Needle biopsy of renal masses: When and how M. Kuczyk, Hanover (DE) Aims and objectives During recent years a revival of the biopsy of renal masses can be observed. On one hand this is due to the increasing frequency of incidentally detected small renal masses that are, in part, treated by ablative techniques. However, the histological differentiation of small renal masses is benign in up to 30% of cases. The individual patient should not be subjected to a treatment that is associated with a distinct complication rate until malignancy has been proven. Today, an organ-preserving strategy is the standard of care during the treatment of small renal masses. In case of an unfavourable localisation of renal tumours that might make organ-preservation difficult, biopsy can be recommended to prove a malignant differentiation upfront surgery Case presentation: A patient with an incidentaloma of the kidney P.F.A. Mulders, Nijmegen (NL) Debate How to survive a small renal mass Pro Observation M. Jewett, Toronto (CA) Sunday Aims and objectives Small Renal Mass (SRM) is the most common presentation for RCC but not all SRMs are malignant. Needle core biopsy is an accurate and safe diagnostic method that is underutilised. The standard for treatment is partial nephrectomy with ablation in selected cases. Most RCC SRMs grow slowly so that initial active surveillance (AS) using serial imaging with delayed treatment for progression is an option, particularly in the older and infirm. Markers of progression are poorly understood and currently we depend on rapid growth as the main trigger for treatment. We are in the early phase of personalising AS strategies by tumour characteristics including histology and host comorbidity status. Urologists should have a current understanding of this new clinical entity SRM to better manage new RCC patients with a disease that is increasing due to image detection of incidental lesions. Most are RCC which is the most lethal of GU malignancies and can not be cured if metastatic. This concern is probably leading to unnecessary treatment of many SRM that could be managed by AS Con Minimally invasive partial nephrectomy I.S. Gill, Los Angeles (US) Aims and objectives My lecture will present the data and the rationale for surgical treatment of small renal masses in the healthy patient with projected longevity. Pros and cons of active surveillance will be presented. The inadequacy of imaging in diagnosing cancer, and the emerging role of needle biopsy will be discussed. 168 Programme Book

169 Rebuttal I.S. Gill, Los Angeles (US) M. Jewett, Toronto (CA) Sunday EAU Milan

170 Sunday, 17 March - EAU Programme Thematic Session Management of surgical complications Brown Hall 3 - Level S2 Chairs: J. Rassweiler, Heilbronn (DE) R.F. Van Velthoven, Brussels (BE) Tips and tricks Bowel perforation during puncture (suprapubic + percutaneous catheter) A. Skolarikos, Athens (GR) Tips and tricks Hemorrhagic cystitis M. Brausi, Modena (IT) Tips and tricks Complications of flank incisions M.S. Michel, Mannheim (DE) Aims and objectives Still in the era of laparoscopy and robotics flank incisions represents the predominantly used access for open access to the upper urinary tract. However, it is associated with complications effecting quality of life - the most important being paraesthesia, neuralgia, hernia, and flank bulge. Concerning flank bulge, an incidence of up to 50% has been described. For most of these complications bounded nerve function is suggested as underlying mechanism. The lecture summarises the underlying relevant anatomy of the flank with special regard to the nervous system. Furthermore it deals with the aetiology and incidence of the complications caused by flank incision. It presents the current available literature in the field, shows how to identify patients at risk and explains how to manage existing complications. Finally it gives the most important information which is: How best to prevent them. Sunday Tips and tricks Symptomatic lymphocele D.A. Schilling, Tübingen (DE) Aims and objectives Lymphoceles following retroperitoneal surgery are frequent and can be bothersome and evoke severe complications such as thromboebolic disease. Objective of the lecture is to identify risk factors for lymphocele formation, discuss preventive measures and point out treatment strategies in persisting symptomatic lymphorrhoea. 170 Programme Book

171 Sunday, 17 March - EAU Programme Thematic Session Paediatric urology Red Hall 1 - Level N1 Chair: W.F.J. Feitz, Nijmegen (NL) State-of-the-art lecture Update on minimal-invasive treatment options R. Subramaniam, Leeds (GB) Aims and objectives Present an appraisal of minimally invasive treatment options that are applicable to children. I shall present some videos of procedures and talk about different approaches used in the procedures. We will also look at the evidence for the application of minimally invasive procedures and discuss the pros and cons State-of-the-art lecture Neuropathic bladders: Treatment strategies and transfer in adulthood R. Stein, Mainz (DE) Aims and objectives Close follow-up (ultrasound of the upper and lower urinary tract, urodynamic investigations starting shortly after birth) is essential. There are 4 different types of bladder sphincter dysfunction in patients with NB. 2 major pillars of conservative treatment: clean intermittent catheterisation (CIC) and treatment with anticholinergics/antimuscarinics. As long as the patient is under the care of their parents or other caregivers, compliance is generally good. During adolescence, patients prefer more independence and compliance relating to medical treatment and regular CIC decreases as does the sense of importance for regular follow-up investigations. This usually leads to a deterioration of upper and lower urinary tract function. It is our responsibility to guarantee lifelong follow-up for these patients to prevent complications State-of-the-art lecture Hypospadias in children, adolescents and adults G.A. Manzoni, Milan (IT) Aims and objectives This presentation will provide an overview of present strategies in modern treatment of hypospadias in the pediatric population with definition of the timing and type of surgical repairs. A critical analysis of present and most popular techniques will be discussed. Goals and importance of long-term follow-up will be stressed with special relevance for the adolescent patient (functional and psycho-sexual aspects). Finally the adult hypospadias problems will be discussed both for the controversial aspects of long-term complications and for the virgin patient presenting in adulthood. Sunday State-of-the-art lecture Regenerative urology for children and adults D. Eberli, Zürich (CH) Aims and objectives Tissue Engineering is one of the major approaches of regenerative medicine and a growing and exciting field of research. In combination with better understanding of structure, biology, physiology and cell culture techniques tissue engineering may offer new treatment options for patients in need of replacement or repair of a deteriorated organ. The principle is to dissociate cells from a tissue biopsy, to expand these cells in culture, and to seed them onto the scaffold material in vitro in order to form a living tissue construct prior to implantation into the recipient. EAU Milan

172 Sunday, 17 March - EAU Programme Special Session Surgery in Motion Platinum Hall - Level S3 Moderators: M. Graefen, Hamburg (DE) F. Montorsi, Milan (IT) A. Mottrie, Aalst (BE) H.G. Van Der Poel, Amsterdam (NL) P. Wiklund, Stockholm (SE) Introduction F. Montorsi, Milan (IT) H.G. Van Der Poel, Amsterdam (NL) Neurovascular structure adjacent frozen-section examination (neurosafe) increases nerve-sparing frequency and reduces positive surgical margins in open and robot-assisted laparoscopic radical prostatectomy. Experience after 11,069 consecutive patients T. Schlomm, Hamburg (DE) Robot assisted laparoscopic partial nephrectomy: Step by step contemporary technique and surgical outcomes at a single high-volume institution J.H. Kaouk, Cleveland (US) LESS partial nephrectomy without ischemia for very small, exophytic renal masses: Surgical details and functional outcomes L. Schips, Vasto (IT) Robotic intracorporeal orthotopic ileal neobladder: Replicating open surgical principles A. Goh, Houston (US) Discussion Sunday 172 Programme Book

173 Sunday, 17 March - EAU Programme Special Session D Video and live narration - da Vinci partial nephrectomy with Firefly fluorescence imaging Platinum Hall - Level S3 Operator: Moderators: G. Schön, Würzburg (DE) A. Mottrie, Aalst (BE) J. Porter, Seattle (US) C. Vaessen, Paris (FR) Sunday Sponsored by INTUITIVE SURGICAL EAU Milan

174 Sunday, 17 March - EAU Programme Abstract Session Challenging robotic surgery euro Auditorium - Level S2 Video Session 4 Chairs: S.D. Kim, Busan (KR) R.F. Van Velthoven, Brussels (BE) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V26 V27 V28 V29 V30 V31 Robotic cystoprostatectomy with nerve-sparing approach and intracorporeal construction of Hautmann neobladder: Saint Augustin technique D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France) Robotic intracorporeal ileal conduit in the female utilizing transvaginal assistance R. Eyraud, E. Rizkala, R. Autorino, H. Laydner, A. Khalifeh, J. Kaouk, G-P. Haber (Cleveland, United States of America) Robot assisted laparoscopic placement of an artificial urinary sphincter for a female patient V. Flamand, T. Ghoneim, F. Marcelli, P. Vandaele, A. Villers (Lille, France) Robotic-assisted anterior pelvectomy with intracorporeal ileal conduit: Saint Augustin technique D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France) Robot-assisted laparoscopic renal artery aneurysm repair: Demonstration of the surgical technique R. Autorino, D. Samarasekera, A. Khalifeh, J. Kaouk (Cleveland, United States of America) Robot-assisted adrenalectomy - a single center series from Homburg M.W. Janssen, A. Treiyer, J. Kamradt, S. Siemer, M. Stöckle, T. Gebhardt, C.H. Ohlmann (Homburg, Germany) Sunday V32 Robotic realization of double Yang-Monti ileal conduit and bladder augmentation: Saint Augustin technique D. Rey, E. Helou, M. Oderda, L. Lopez, P-T. Piechaud (Bordeaux, France) 174 Programme Book

175 Sunday, 17 March - EAU Programme Abstract Session New methods in imaging and targeting prostate cancer Brown Hall Level S2 Poster Session 30 Chairs: B.M. Carey, Leeds (GB) J. Walz, Marseille (FR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 350 Validation of histoscanning system to detect and characterize prostate cancer A. Govorov, D. Pushkar, M. Kovylina, A. Vasilyev, T. Moiseenko (Moscow, Russia) 351 Prostate HistoScanning for assessment of tumour volume and pathological stage prior to radical prostatectomy: What is its role in routine clinical practice? S. Javed, E. Chadwick, S. Beveridge, S. Bott, C. Eden, S. Langley (Guildford, Frimley, United Kingdom) 352 Prostate histoscanning as a tool for decision making P. Macek, E. Barret, R.E. Sanchez Salas, M. Galiano, F. Rozet, Y. Ahallal, J.M Gaya, M. Durand, L. Mascle, C. Giedelman, L. Lunelli, X. Cathelineau (Paris, France) * 353 Prostate histoscanning for the detection, localization and volume estimation of prostate cancer- PHS02 blind phase results L.A.M. Simmons, HU Ahmed, F. Zát ura, M. Winkler, J. Braeckman, I. Meiers, D. Nir, P. Autier, S. Charman, M. Emberton (London, United Kingdom; Olomouc, Czech Republic; Brussels, Waterloo, Belgium; Lyon, France) 354 CP OCT imaging of prostate neurovascular bundle D. Ledyaev, V. Atduev, L. Shkalova, E. Zagaynova (Nizhny Novgorod, Russia) 355 Parametric diffusion weighted imaging at 3 tesla accurately predicts histological outcomes in men presenting for a TRUS-guided biopsy of the prostate D.C. Moran, L. Marignol, A. Perry, A. Fagan, E. Gaffney, J.F. Meaney, D. Hollywood, T.H. Lynch (Dublin, Ireland) Sunday 356 Does 3 Tesla endorectal PET/MRI change the operative tactics in prostate cancer? J. Klein, J. Hauser, J-P. Vallee, C. Iselin (Geneva, Switzerland) 357 Choline positron emission tomography (PET) or PET/computed tomography (CT) and biochemical relapse of prostate cancer (PCa): A meta-analysis of literature A. Guttilla, F. Zattoni, L. Evangelista, G. Saladini, F. Zattoni (Padua, Italy) * 358 PET-CT in recurrent prostate cancer D.K. Osmonov, A.V. Aksenov, D. Heimann, C.M. Naumann, K-P. Jünemann (Kiel, Germany) 359 Identification of apparent-diffusion-coefficient (ADC) cut-offs during DWI-MRI in prostate cancer lymph node metastasis: Implication for daily clinical practice L. Budäus, S-R. Leyh-Bannurah, C. Seiwerts, B. Beyer, G. Salomon, H. Heinzer, M. Graefen, G. Adam, M. Regier (Hamburg, Germany) EAU Milan

176 360 Choline PET-CT and diffusion-weighted MRI for nodal staging in prostate cancer at high risk for nodal metastases S. Joniau, L. Van Den Bergh, E. Lerut, R. Oyen, C.M. Deroose, T. Budiharto, F. Ameye, K. Haustermans, S. Isebaert, H. Van Poppel (Leuven, Belgium) 361 Intra-operative prostatic swelling and intra-prostatic shift of targeted points within the prostate during high-intensity focused ultrasound: Implication for targeted focal therapy S. Shoji, T. Uchida, M. Nakamoto, A.L. De Castro Abreu, S. Leslie, Y. Sato, I. Gill, O. Ukimura (Los Angeles, United States of America; Hachioji, Osaka, Japan) Sunday 176 Programme Book

177 Sunday, 17 March - EAU Programme Abstract Session Making the diagnosis of bladder cancer Brown Hall 3 - Level S2 Poster Session 31 Chairs: J. Irani, Poitiers (FR) T.S. O Brien, London (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 362 Incidental diagnosis of bladder cancer in an obervational study: Clinical stage migration J.M. Gaya Sopena, J. Palou, B. Miñana, J.M. Cózar, R. Medina, I. De Zaragoza, F. De La Rosa, I. Ip De Coruña, I. Ip De Vall D Hebron, M.J. Ribal (Barcelona, Murcia, Granada, Sevilla, Zaragoza, Madrid, La Coruña, Spain) 363 The role of antiplatelet and anticoagulant therapy in the diagnosis of bladder cancer M. Moschini, A. Bettiga, G. Burgio, C. Maccagnano, L. Rocchini, F. Pellucchi, G. La Croce, R. Colombo (Milan, Italy) 364 Expedient combination of urine markers enhances their diagnostic performance in the detection of urothelial carcinoma T. Todenhöfer, J. Hennenlotter, U. Kühs, S. Mohrhardt, M. Esser, S. Aufderklamm, J. Mundhenk, G. Gakis, A. Stenzl, C. Schwentner (Tübingen, Germany) 365 Point-of-care testing for bladder cancer the UBC rapid test on the concile Ω100 reader platform provides quantitative results T. Todenhöfer, J. Hennenlotter, R. Ritter, U. Hoffmann, P. Blutbacher, A. Deja, A. Hohneder, A. Stenzl, C. Schwentner (Tübingen, Germany) 366 Bladder cancer detection by autofluorescence (ultraviolet) at 308nm (preliminary results) C. Egrot, M. Sibony, S.M. Al-Qahtani, O. Cussenot (Paris, France) 367 Removing routine urine cytology assessment in the one stop haematuria clinic J.S. Phull, A.C. Carter, J.D. Osborne, T. Lloyd, S. Sloan, V. Shah (Newport, United Kingdom) Sunday 368 Hematuria one stop clinic: First experience in Italy with 303 cases L. Carmignani, S. Casellato, S. Picozzi, G. Bozzini, C. Marenghi, V. Nicosia, M. Cosentino (San Donato Milanese, Italy) 369 Acute imaging for hematuria in the United States: Costs and predictors from the Nationwide Emergency Department Sample K.R. Ghani, S. Sukumar, J.D. Sammon, W. Jeong, A. Sood, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of America) 370 Visible haematuria in patients under 40 years of age: Where do we stand O. Aboumarzouk, S. Mishriki, B. Somani, R. Vint, T. Lam (Aberdeen, United Kingdom) 371 Preventive medical care in bladder cancer is possible: Risk-adapted screening in urology performed by IQUO-Germany G.C. Lüdecke, G. Geiges, F. König (Giessen, Berlin, Germany) EAU Milan

178 372 Ultrasonography and cytology in the follow up of grade 1 non-muscle invasive bladder cancer (NMIBC) J. Palou Redorta, S. Skrobot, G. Luccarelli, O. Rodriguez Faba, J.M. Gaya, L. Gausa, R. Parada, A. Breda, H. Villavicencio (Barcelona, Spain) 373 Biopsy in flexible ureterorenoscopy: Comparison of biopsy specimen quality using different biopsy forceps P. Liske, A. Fayyazi, V. Zimmermanns, S. Lahme (Pforzheim, Germany) Summary J. Irani, Poitiers (FR) Sunday 178 Programme Book

179 Sunday, 17 March - EAU Programme Abstract Session Kidney transplantation: Technique and outcome Amber Hall Level S2 Poster Session 32 Chairs: G. Karam, Nantes (FR) M. Musquera Felip, Barcelona (ES) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 374 Does it really matter which definition of delayed graft function we use after renal transplantation? N.J. Dempster, C. Ceresa, E. Aitken, D. Kingsmore (Glasgow, United Kingdom) 375 Simultaneous native nephrectomy and transplantation in autosomal dominant polycystic kidney disease: Efficacy and safety L. Marconi, P. Nunes, A. Figueiredo, F. Furriel, A. Roseiro, A. Mota (Coimbra, Portugal) 376 The treatment of ureteral strictures complicating kidney transplantation. An outcome analysis A. Bosio, F. Lasaponara, E. Dalmasso, A. Buffardi, E. Alessandria, S. Santià, G. Pasquale, O. Sedigh, D. Righi, L. Biancone, G.P. Segoloni, D. Fontana, B. Frea (Turin, Italy) 377 Renal transplantation outcomes in elderly patients N.J. Dempster, C. Ceresa, E. Aitken, D. Kingsmore (Glasgow, United Kingdom) 378 Kidney autotransplantation and revascularization surgery - still a good option D. Gosalbez Garcia, A. Ciudin, M. Musquera, L. Peri, J. Huguet, M.J. Ribal, A. Alcaraz, C. Mestre, M. Vera (Barcelona, Spain) * 379 Economic impact of pulsatile hypothermic perfusion in an expanded criteria donor transplant program. Analysis of the first year since its introduction V. Gomez, F. Arias, V. Diez, E. Fernandez, M. Jimenez, R. Rodriguez, C. Galeano, A. Gomis, F.J. Burgos (Madrid, Spain) * 380 Influence of pre-transplant diuresis in the development of lower urinary tract dysfunction in renal transplant patients F.A. Escórcio De Almeida, J. Cabral, F. Branco, M. Ramos, S. Ribeiro, A. Fraga (Porto, Portugal) Sunday 381 Evaluation of sexual functions in males receiving renal replacement therapies R. Demir, Y. Bostanci, F. Atac, E. Ozden, A. Karatas, S. Sarikaya, Y.K. Yakupoglu (Samsun, Turkey) 382 An urgent revision of the kidney transplant allocation system is required in order to improve long term graft survival results G. Pini, N. Mohammed, F. Greco, A. Schumann, F. Kawan, L. Ascalone, K. Weigand, P. Fornara (Halle, Germany) 383 Urological and surgical complications following kidney transplantation from non-heart beating donors R. Castañeda-Argáiz, L. Peri Cusi, M. Musquera Felip, E. Sanchez Escudero, D. Paredes, E. García Cruz, A. Carrión Puig, A. Alcaraz (Barcelona, Spain) EAU Milan

180 384 Comparative urological complications of ureteroneocystostomy in kidney transplantation: Transvesical Leadbetter-Politano versus extravesical Lich-Gregoir technique C. Baston, M. Harza, B. Stefan, A. Preda, I. Manea, B.C. Haineala, S.S. Margaritis Guler, B.G. Badescu, A. Omer, I. Sinescu (Bucharest, Romania) 385 Lich-Gregoir technique and routine use of double J catheter as the best combination to avoid urinary complications in kidney transplantation E.H. Olarte Barragán, C. Moreno Alarcón, P.A. López González, P. López Cubillana, C.P. Pinzón Navarrete, P.F. Gutiérrez Gutiérrez, H.L. Martínez Peralta, G. Gómez Gómez (Murcia, Spain) 386 Real time-contrast enhanced ultrasound voiding cystography as a screening examination for vesicoureteral reflux of renal transplant recipients F. Kurtz, M. Straub, J.E. Gschwend, K. Stock (Munich, Germany) Sunday 180 Programme Book

181 Sunday, 17 March - EAU Programme Abstract Session Advances in the treatment of penile cancer Amber Hall Level S2 Poster Session 33 Chairs: S. Egawa, Tokyo (JP) R. Salvioni, Milan (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 387 Surgical complications after inguinal lymphadenectomy in penile cancer an explorative historical cohort study for risk factors M.M. Stuiver, R.S. Djajadiningrat, N.M. Graafland, A.D. Vincent, C. Lucas, S. Horenblas (Amsterdam, The Netherlands) 388 The characteristics of inguinal lymph nodes may predict pelvic lymph nodes involvement in penile cancer: A single-institutional experience M. Catanzaro, G. Lughezzani, N. Nicolai, L. Piva, T. Torelli, D. Biasoni, S. Stagni, A. Necchi, P. Giannatempo, D. Raggi, E. Farè, M. Colecchia, R. Salvioni (Milan, Italy) 389 Factors associated with non-sentinel node metastasis in patients with squamous cell carcinoma of the penis: A two-institution prospective analysis of 174 inguinal basins with positive sentinel node biopsy W. Lam, R. Djajadiningrat, V. Sakalis, H.M. Alnajjar, C. Corbishley, M. Perry, D. Sharma, S. Horenblas, N. Watkin (London, United Kingdom; Amsterdam, The Netherlands) 390 Disease specific mortality after pelvic lymph node dissection containing tumour-positive nodes in penile cancer R.S. Djajadiningrat, S. Horenblas (Amsterdam, The Netherlands) 391 Zonal mapping of inguinal lymph nodes using SPECT - implications for lymphadenectomy for penile carcinoma S. Omorphos, Z. Saad, S. Minhas, A. Kirkham, J. Bomanji, A. Muneer (Nottingham, United Kingdom) 392 Contemporary survival of penile squamous cell carcinoma: Experience with 1000 patients R.S. Djajadiningrat, N.M. Graafland, E. Van Werkhoven, W. Meinhardt, A. Bex, H.G. Van Der Poel, S. Horenblas (Amsterdam, The Netherlands) Sunday 393 How reliable is tumor grading in penile cancer results of a European grading study C. Kakies, C. Protzel, L.C. Horn, A.K. Hoehn, G. Kristiansen, J. Koellermann, E. Comperat, A. Lopez Belltram, A. Erbersdobler, O.W. Hakenberg (Rostock, Leipzig, Bonn, Hamburg, Germany; Paris, France; Cordoba, Spain) 394 Value of dynamic sentinel node biopsy, ultrasound and fine needle aspiration in the detection of metastatic lymph nodes in penile cancer R.S. Djajadiningrat, H.J. Teertstra, B.W.G. Van Rhijn, W. Meinhardt, A. Bex, H.G. Van Der Poel, S. Horenblas (Amsterdam, The Netherlands) 395 A comparison of techniques in sentinel lymph node biopsy for penile cancer S.H. Shillito, V.K.S Sangar, B. Murby, D. Ashworth, N.R. Parr, B. Taylor, M.W. Lau (Manchester, United Kingdom) 396 Paclitaxel in pretreated metastatic penile cancer: Final results of a phase 2 study P. Verze, G. Di Lorenzo, C. Imbimbo, N. Longo, A. Palmieri, F. Fusco, S. De Placido, V. Mirone (Naples, Italy) EAU Milan

182 397 Early results of the pilot study with the anti-epidermal Growth-Factor Receptor (EGFR) monoclonal antibody panitumumab in patients (pts) with multi-relapsed or refractory squamous cell carcinoma (SCC) of the penis P. Giannatempo, N. Nicolai, D. Raggi, E. Farè, M. Colecchia, M. Catanzaro, T. Torelli, D. Biasoni, S. Stagni, L. Piva, R. Salvioni, A. Necchi (Milan, Italy) 398 Long-term oncological outcomes of partial penectomy in the treatment of penile cancer: A 30-year singleinstitutional experience M. Catanzaro, G. Lughezzani, N. Nicolai, T. Torelli, D. Biasoni, S. Stagni, A. Necchi, P. Giannatempo, D. Raggi, E. Farè, M. Colecchia, L. Piva, R. Salvioni (Milan, Italy) 399 Expression patterns of vimentin and e-cadherin in ephitelial-mesenchymal transition: A potential prognostic factor in penile cancer G. Guimaraes, M.J.L. Souza, W.H. Costa, R.A.R. Oliveira, S.C. Zequi, R.S.M. Campos, T.B.M. Santana, I.W. Cunha, F.A. Soares, A. Lopes (Sao Paulo, Brazil) 400 The treatment of penile carcinoma-in-situ within a UK supraregional network M. Lucky, M. Kusuma, B. Rogers, S. Jones, M. Lau, V. Sangar, N. Parr (Wirral, Manchester, United Kingdom) Sunday 182 Programme Book

183 Sunday, 17 March - EAU Programme Abstract Session Nocturia, OAB, metabolic syndrome - towards a new management Silver Hall - Level N2 Poster Session 34 Chairs: P. Abrams, Bristol (GB) B.A. Dybowski, Warsaw (PL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 401 The incidence of antimuscarinic-associated side effects in overactive bladder (OAB) patients treated with mirabegron: Results of a pooled analysis of 3 randomised phase 3 trials V. Nitti, C.R. Chapple, G. Amarenco, P. Radziszewski, J. Angulo, M.B. Blauwet, E. Siddiqui, N. Martin (New York, Northbrook, United States of America; Sheffield, Chertsey, United Kingdom; Paris, France; Warsaw, Poland; Madrid, Spain) 402 Tolenix (THVD-201), a novel combination of muscarinic agonist (tolterodine) and muscarinic agonist (pilocarpine), is efficacious in OAB with less dry mouth compared to tolterodine alone R. Dmochowski, K. Duchin, T. Tremblay, M. Paborji, R. Flugel (Nashville, Mountain View, United States of America) 403 The assessment of a novel Transdermal Amplitude Modulated Signal (TAMS) for the treatment of overactive bladder syndrome M. Slovak, A.T. Barker, C.R. Chapple (Sheffield, United Kingdom) 404 Clinical efficacy and safety evaluation of imidafenacin as add-on treatment for residual overactive bladder symptoms in BPH patients with nocturia; addition study sub-analysis M. Gotoh, M. Takeda, O. Nishizawa, M. Yoshida, S. Takahashi, N. Masumori (Nagoya, Yamanashi, Matsumoto, Ohbu, Tokyo, Sapporo, Japan) * 405 My sleep pattern is a series of naps. Subjective patient-reported data on what is most bothersome about nocturia T. Holm-Larsen, C. Albei, F. Andersson, J.P. Nørgaard (Farum, Copenhagen, Denmark; Parsippany, United States of America) Sunday 406 Nocturia has a strong impact on productivity - a comparison with different chronic diseases F. Andersson, A. Blemings, T. Holm-Larsen, J.P. Nörgaard (Copenhagen, Farum, Denmark) 407 Predictors of improvement amongst men with a predominant complaint of nocturia O.O. Cäkir, B.T. Helfand, K.T. McVary (Chicago, Evanston, United States of America) 408 An assessment of actual medical management of BPH in a cross-sectional study performed with administrative health services databases L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, F. Berardinelli, C. De Nunzio, P. Sountoulides, L. Schips (Vasto- Chieti, Rome, Italy; Veria, Greece) 409 Impact of concurrent statins and 5α-reductase inhibitors use on serum PSA and prostate volume in BPH patients K.J. Joo, Y.S. Cho, C.H. Kwon, H.J. Park (Seoul, South Korea) EAU Milan

184 410 Efficacy and safety of tadalafil 5mg administered once daily in men with erectile dysfunction and lower urinary tract symptoms; comparative study between metabolic syndrome patients and non metabolic syndrome patients A. Kim, B.J. Lim, S. Hong, G. Song, S. Park, J.Y. Joung, T.Y. Ahn (Seoul, Cheonan, Ulsan, South Korea; New Brunswick, United States of America) 411 Metabolic syndrome is correlated with prostatic inflammation in men with severe LUTS related to benign prostatic hyperplasia: Results of a preclinical and clinical experimental study L. Vignozzi, M. Gacci, I. Cellai, A. Sebastianelli, M. Salvi, R. Santi, A. Morelli, G. Rastrelli, P. Comeglio, E. Maneschi, G. Corona, G. Nesi, C. De Nunzio, A. Tubaro, M. Carini, M. Maggi (Florence, Bologna, Rome, Italy) 412 Metabolic syndrome and lower urinary tract symptoms: A possible link to storage symptoms C. De Nunzio, M. Gacci, L.C. Costantino, A. Brassetti, F. Cancrini, F. Esperto, R. Lombardo, F. Presicce, L. Cindolo, F. Pellegrini, L. Schips, D. Amore, A. Tubaro (Rome, Florence, Vasto, Italy) Sunday 184 Programme Book

185 Sunday, 17 March - EAU Programme Abstract Session Paediatric hypospadias repair Red Hall 1 - Level N1 Poster Session 35 Chairs: S.W. Han, Seoul (KR) G. Lackgren, Uppsala (SE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 413 Changes in erectile, connective tissue, and neural components of the human fetal penis at various gestational ages C.B.M. Gallo, L.E.M. Cardoso, A. Furriel, B.M.G. Gregório, W.S. Costa, F.J.B. Sampaio (Rio de Janeiro, Brazil) 414 Urinary tract reconstruction using regenerated oral mucosa sheets made with amniotic membrane as matrix Y. Naitoh, A. Kawauchi, K. Kamoi, J. Soh, T. Miki (Kyoto, Japan) * 415 Long-term functional, cosmetic and sexual outcomes of hypospadias correction performed in childhood S. Thiry, S. Dormeus, B. Tombal, F. Wese, A. Feyaerts (Brussels, Belgium) 416 One stage lingual augmented urethroplasty in repair of distal penile hypospadias E.R. Elsayed, A.M. Eliwa, A.A. Teelab, T. Dawood, M. Omran, L. Elbendary, S. Khalil (Zagazig, Egypt) 417 Distribution of androgen, and estrogen receptors in foreskins of children with or without hypospadias H. Kocaturk, S. Adanur, T. Ziypak, C. Gündogdu, Y. Aksoy, G. Okyar (Erzurum, Turkey) 418 A prospective study to evaluate the role of different variables in results of TIPU A.L. Bhat, M. Bhat, R.K. Saran, M. Singla, K.V. Sabbarwal, R. Upadhaya, V. Kumar (Bikaner, India) 419 Long term results of anastomotic urethroplasty performed in children M.I. Kogan, V.V. Mitusov, A.V. Shangichev, V.V. Sizonov, A.V. Hasigov (Rostov on Don, Russia) 420 Evaluation of nonstented distally folded onlay flap in distal penile hypospadias M. Soliman, M.H. Radwan, A.M. Tawfik, A.R. Ramadan, O.Z. Gamal, H. Al Wadaani (Tanta, Egypt; Al Ahsa, Saudi Arabia) Sunday 421 Comparison of results of TIPU repair for hypospadias with spongioplasty alone and spongioplasty with dorsal Dartos flap A.L. Bhat, M. Singla, M. Bhat, R.K. Saran, K.V. Sabharwal, V. Kumar, R. Upadhaya (Bikaner, India) 422 Combination of techniques for severe hypospadias trying to reduce the morbidity of the repairing surgery C. Moreno Alarcón, G. Zambudio Carmona, M.J. Guirao Piñera, K. Cabrejos Perotti, P.Y. Reyes Ríos, M. Fernández Ibieta, I. Martínez Castaño, J.I. Ruiz Jiménez (Murcia, Spain) 423 The use of a perimeatal-based penile skin flaps for cover the repair of a TIP urethroplasty. From experimental surgery to clinical practice S. Gardikis, K. Kampouri, A. Giatromanolaki, M. Agelidou, C. Kalaitzis, S. Giannakopoulos, S. Touloupidis, G. Vaos (Alexandroupolis, Greece) EAU Milan

186 424 Correlation of severity of congenital penile torsion with type of hypospadias and management by urethral plate with spongiosum/urethral mobilization A.L. Bhat, R.K. Saran, M. Bhat, K.V. Sabharwal, M. Singla, R. Upadhaya, V. Kumar (Bikaner, India) 425 Management of hypospadias cripples: Complication rates of the two-staged buccal mucosa repair in Bracka technique S. Riechardt, R. Dahlem, M. Fisch (Hamburg, Germany) Sunday 186 Programme Book

187 Sunday, 17 March - EAU Programme Abstract Session Stones: URS and imaging Red Hall 2 - Level N1 Poster Session 36 Chairs: E.A. Rodrigues de Lima, Porto (PT) O. Traxer, Paris (FR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 426 The efficiency and the safety of flexible ureterorenoscopy is not impacted by stone location B. Jacquemet, E. Chabannes, G. Guichard, S. Bernardini, N. Bardonnaud, P. Pillot, H. Bittard, F. Kleinclauss (Besancon, France) 427 Preoperative ureteral stenting is associated with higher stone-free rate after flexible ureterorenoscopy for urinary lithiasis J.F. Dessyn, P. Pillot, N. Bardonnaud, G. Guichard, S. Bernardini, E. Chabannes, H. Bittard, F. Kleinclauss (Besancon, France) 428 Effects of percutaneous nephrostomy tube during flexible ureteroscopy for renal stone management S.Y. Kwon, B.S. Kim, J.N. Lee, H.T. Kim, E.S. Yoo, S.K. Chung, B.W. Kim, T.H. Kim, T.G. Kwon, J.B. Kwon, Y.K. Park (Daegu, South Korea) 429 Impact of surgical experience on safety and efficiency of flexible uretero-renoscopy for urinary stone management F. Kleinclauss, P. Pillot, N. Bardonnaud, E. Chabannes, S. Bernardini, G. Guichard, H. Bittard (Besancon, France) 430 Comparative study of treatment of renal stones with flexible ureterorenoscopy in obese, morbidly obese and normal weight patients S. Doizi, C. Bonneau, S. Gil Diez De Medina, O. Traxer (Paris, France) 431 Retrograde intrarenal surgery (RIRS) in spinal anesthesia: A feasible and effective stone treatment in oneday surgery A. Bosio, P. Destefanis, E. Alessandria, M. Carchedi, A. Buffardi, E. Dalmasso, S. Santià, F. Fop, A. Bisconti, C. Ceruti, D. Fontana, B. Frea (Turin, Italy) Sunday 432 Complications of flexible ureterorenoscopy classified by the modified Clavien grading system (a single center s experience over 10 years) S.M. Al Qahtani, G. Raynal, T. Saussez, S.G.D. De Midina, M. Tligui, O. Traxer (Paris, France) 433 Withdrawn 434 Decreasing the cost of flexible ureterorenoscopic (FURS) procedures using disposable laser fiber: A cost comparison analysis A. Chapman, B.K. Somani, S. Healy, A. Robertson, S.G. Kata (Dundee, Southampton, United Kingdom) 435 Predictive value of preoperative unenhenced computed tomography during ureteroscopic lithotripsy: Single institute experience S. Kim, D.K. Lee, G.E. Min, H.L. Lee, J.H. Lee, G.H. Yoo (Seoul, South Korea) EAU Milan

188 436 Predicting urinary stone composition a radiological study made by urologists A. Ciudin, P. Luque, M.G. Diaconu, R. Salvador, A. Franco, R. Alvarez-Vijande, C. Nicolau, A. Alcaraz (Barcelona, Spain) 437 Terpene compound drug as medical expulsive therapy for ureterolithiasis: A meta-analysis M. Chua, J. Park, J. Castillo, M. Morales (Quezon City, Manila City, Taguig City, Philippines) 438 CalcuLithiasis: Computer assisted metabolic workup of stone disease A. Hoznek, J-P. Haymann, C. Borgogno, O. Traxer (Creteil, Paris, Pontoise, France) 439 Chemical and mineralogical analysis of ureteral stent encrustation and associated risk factors M.C. Sighinolfi, E Galli, G.P. Sighinolfi, S. Micali, A. Mofferdin, N. Nyek Ntep, N. Ferrari, G. Bianchi (Modena, Italy) Sunday 188 Programme Book

189 Sunday, 17 March - EAU Programme Abstract Session Exploring pharmacological targets in OAB Blue Hall Level N1 Poster Session 37 Chairs: C.D. Cruz, Porto (PT) G. Van Koeveringe, Maastricht (NL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 440 Effects of the combination of β3-adrenoceptor agonists and antimuscarinics on EFS-induced contractions of rat isolated urinary bladder M. Rekik, C. Rouget, S. Palea, P. Lluel, E.H. Ohlstein, T.D. Westfall (Toulouse, France; Malvern, United States of America) * 441 Why anticholinergics fail: Oxybutynin and fesoterodine induce a shift from muscarinergic to purinergic transmission in the rat bladder P. Uvin, M. Boudes, J. Franken, A. Menigoz, S.J. Pinto, T. Gevaert, R. Verplaetse, J. Tytgat, R. Vennekens, T. Voets, D. De Ridder (Leuven, Belgium) 442 A novel neurite outgrowth enhancer, TAC-302 improved voiding dysfunction in rats with STZ-induced diabetes T. Noma, S. Yoshida, A. Hakozaki, N. Orimoto, E. Sasaki, Y. Hayashi (Tsukuba-Shi, Ibaraki, Japan) 443 Inhibition of spinal cord fatty acid amide hydrolase reduces bladder overactivity in rats C. Fuellhase, A. Russo, F. Castiglione, L. Campeau, A. Bettiga, K-E. Andersson, C. Gratzke, P. Hedlund (Munich, Germany; Milan, Italy; Wake Forest, United States of America) 444 Upregulation of angitensin II type I receptor and connexin 43 in the bladder and urethra of aged rats with bladder dysfunction M. Ken-Ichi, S. Tobu, M. Noguchi, Y. Sumino, F. Sato, H. Mimata, N. Yoshimura (Pittsburgh, United States of America; Saga, Oita, Japan) 445 Protective effect of cyanidin-3-o-beta-d-glucopyranoside fraction from mulberry fruit pigment against oidative damage in streptozotocin-induced diabetic rat bladder W.J. Bae, U.S. Ha, J.H. Bae, Y.S. Choi, S.J. Kim, H.J. Cho, S.H. Hong, J.Y. Lee, T-K. Hwang, S.W. Kim (Seoul, South Korea) Sunday 446 Alpha1A-adrenoceptor antagonist improves bladder function by increasing bladder blood flow in rat model of lower urinary tract dysfunction with or without bladder outlet obstruction Y. Goi, M. Nomiya, K. Sagawa, K. Aikawa, Y. Tomiyama, S. Tatemichi, K. Maruyama, M. Kobayashi, H. Kusama, O. Yamaguchi (Azumino, Fukushima, Koriyama, Japan) 447 Micturition is controlled by neuronal cannabinoid receptor type 1 a urodynamic evaluation of a CB1 knockout mouse model C. Fullhase, L. Campeau, A. Sibaev, M. Storr, C. Gratzke, C. Stief, P. Hedlund, K.E. Andersson (Munich, Germany; Winston-Salem, United States of America; Milan, Italy) EAU Milan

190 448 Quotient of non-micturition-associated and micturition-associated detrusor events determined by radiotelemetered cystometry (RTC) as a possible parameter in a Göttingen minipig (GM) model of infravesical obstruction (BOO) N. Huppertz, C. Fera, D. Leonhäuser, K. Strick, I. Zraik, S. Hirshman, U. Schwantes, R. Kirschner-Hermanns, R. Tolba, J. Grosse (Aachen, Bamberg, Bonn, Germany) 449 Bladder and erectile dysfunctions in the type 2 diabetic goto-kakizaki rat D. Behr-Roussel, S. Oger, S. Caisey, M. Kergoat, A. Audet, J. Bernabé, L. Alexandre, F. Giuliano (Montigny- Le-Bretonneux, Chilly-Mazarin, France) 450 Ca2+ sensitization without activation of G protein is independent of calmodulin in contraction of human detrusor smooth muscle S. Kajioka, N. Shahab, M. Hayashi, R. Takahashi, S. Naito (Fukuoka, Japan; Jakarta, Indonesia) 451 Chronic treatment with a rho-kinase inhibitor restores ureter peristaltic amplitudes, halts bladder enlargement, but does not affect urodynamics in rats with partial outflow obstruction R. Buono, F. Benigni, L. Villa (Milan, Italy) Sunday 190 Programme Book

191 Sunday, 17 March - EAU Programme Abstract Session Surgery for RCC and the adrenal gland Yellow Hall Level N1 Poster Session 38 Chairs: E. Barret, Paris (FR) A. Vuksanovic, Belgrade (RS) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 452 Oncological outcome and complications in patients with renal cell cancer and inferior vena cava thrombus C. Piper, D. Porres, D. Pfister, A. Heidenreich (Aachen, Germany) 453 Resection of renal cell carcinoma with atrio-caval extension: A single centre experience J.D. Evans, A.M. Ranasinghe, T.R. Graham, S.J. Rooney, R.I. Bhatt (Birmingham, United Kingdom) 454 The impact of fat infiltration and renal vein thrombosis on cancer-specific survival in T3a kidney tumors R. Schiavina, G.C. Rocca, M. Borghesi, C. Pultrone, F. Chessa, L. Della Mora, G. Saraceni, E. Brunocilla, M. Garofalo, F. Manferrari, G. Martorana (Bologna, Italy) 455 Liver mobilisation reduces the need for cardiopulmonary bypass in renal tumours with inferior vena cava extension A.A. Mohammed, R.C. Kockelbergh (Kettering, Leicester, United Kingdom) 456 Comparison of overall survival between the life expectancy and the estimated outcome in patients who underwent radical nephrectomy or partial nephrectomy for renal cell carcinoma N. Tanaka, Y. Hirao, K. Fujimoto (Kashihara, Japan) 457 Withdrawn 458 Predictive factors of severe renal insufficiency after nephrectomy J. Berger, Y. Brakbi, Z. Daher Abdi, X. Plainard, M. Lanoe, J. Centi, J.P. Dumas, A. Rousseau, M. Essig, A. Descazeaud (Limoges, France) Sunday 459 Complication and conversion rate in a large multicenter series of 222 patients undergoing laparoscopic radical nephrectomy for large renal cell carcinoma (> 7 cm) L.G. Luciani, V. Vattovani, C. D Elia, G. Giusti, D. Tiscione, R. Peschechera, A. Celia, C. Fiori, F. Porpiglia, P. Parma, T. Cai, G. Malossini (Trento, Milan, Bassano Del Grappa, Orbassano, Mantova, Italy) 460 Prognostic significance of preoperative neutrophil-to-lymphocyte ratio to predict recurrence in patients with non-metastatic clear cell renal cell carcinoma S.I. Kim, K.B. Lee, H.S. Ahn, S.J. Kim (Suwon, South Korea) * 461 Laparoscopic adrenalectomy in urologic centres the experience of the German Laparoscopic Working Group C. Springer, J. Rassweiler, D. Fahlenkamp, N. Kutta, D. Nesius, J. Thüroff, A. Krause, W. Strohmaier, A. Bachmann, L. Hertle, G. Popken, S. Deger, D. Jocham, C. Doehn, T. Loch, S. Lahme, V. Janitzky, C. Gilfrich, T. Klotz, B. Kopper, U. Rebmann, T. Kälbe, U. Wetterauer, A. Leitenberger, J. Raßler, P. Fornara, F. Greco (Halle Saale, Austria; Heilbronn, Chemnitz, Trier, Mainz, Freiberg, Coburg, Münster, Berlin, Lübeck, Flensburg, Pforzheim, Pirna, Straubing, Weiden, Kaiserslautern, Dessau, Fulda, Freiburg, Wolfsburg, Leipzig, Germany; Basel, Switzerland) EAU Milan

192 462 Patient-reported satisfaction and cosmesis outcomes following laparoscopic adrenalectomy: LESS vs conventional laparoscopic surgery S. Inoue, K. Ikeda, K. Hieda, K. Shoji, K. Miyamoto, S. Ohara, K. Kobayashi, M. Kajiwara, J. Teishima, A. Matsubara (Hiroshima, Japan) 463 Anti-hypertensive effect of laparoscopic adrenalectomy (LA) for the patients with primary aldosteronism (PA) is limited despite of the accurate determination of responsible lesion by adrenal venous sampling (AVS) H. Yamamoto, S. Hatakeyama, N. Sugiyama, Y. Suzuki, A. Okamoto, A. Imai, T. Yoneyama, Y. Hashimoto, T. Koie, T. Nigawara, K. Terui, S. Sakihara, C. Ohyama (Hirosaki, Japan) 464 Clinical characteristics of adrenal injury in trauma patients K.J. Oh, W.S. Jang, I. Hwang, E.C. Hwang, H.S. Yu, S.O. Kim, S.I. Jung, T.W. Kang, D.D. Kwon, K. Park (Gwangju, South Korea) Sunday 192 Programme Book

193 Sunday, 17 March - EAU Programme Abstract Session st century stone management euro Auditorium - Level S2 Video Session 5 Chairs: N.N-P. Buchholz, London (GB) P.A. Geavlete, Bucharest (RO) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V33 V34 V35 V36 V37 Laparoendoscopic single-site (LESS) pyelolitecthomy in a horseshore kidney using conventional rigid laparoscopic instruments A. Perez-Lanzac De Lorca, J. Soto Villalva, J. Rosety Rodriguez, Z. Okhunov, A. Lusch, A. Conde Giles, M.J. Ledo Cepero, R. Garcia-Baquero Garcia De Paredes, B. Madurga Patuel, J.L. Alvarez-Ossorio Fernandez (Cadiz, Spain) Robot-assisted combined intrarenal surgery for the treatment of a complex kidney stone formation S. Poth, C. Wagner, A. Schütte, A.P. Labanaris, J. Zinke, J.H. Witt (Gronau (Westfalen), Germany) Combined endoscopic surgery: Flexible retrograde ureteroscopy with percutaneous access in the supine position: Endovision O. Angerri, J.M. Santillana, F. Sanchez-Martín, F. Millan, H. Villavicencion (Barcelona, Spain) Totally ultrasonography guided percutaneous nephrolithotomy: Key steps overview J.A. Agudelo, M.G. Finol, E. Arias, N. Ktech, L. Sanchez, R. Montiel, E. Peña, M. Riveros (Maracaibo, Venezuela) Retrograde flexible ureteroscopic approach combined with Ho:YAG laser lithotripsy for renal stones: How large is too large? D.R. Multescu, G. Nita, B.F. Geavlete, V. Mirciulescu, P.A. Geavlete (Bucharest, Romania) V38 V39 Robotic assisted laparoscopic anatrophic nephrolithotomy: First case report R. Sotelo Noguera, O. Carmona, R. De Andrade, C. Rodriguez, G. Fernández, R. Clavijo, R. Garza (Caracas, Venezuela) Single session bilateral percutaneous nephrolithotomy applicability of the simplified technique J.A. Agudelo, E. Arias, N. Ktech, L. Sanchez, E. Pena, R. Montiel, M. Rivero (Maracaibo, Venezuela) Sunday V40 Ultra-mini PCNL (UMP) J. Desai, R. Solanki (Ahmedabad, India) EAU Milan

194 Sunday, 17 March - EAU Programme Abstract Session How to optimise staging in prostate cancer? Brown Hall Level S2 Poster Session 39 Chairs: C.B. Congregado Ruiz, Sevilla (ES) H-P. Schmid, St. Gallen (CH) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 465 High-Grade Prostatic Intraepithelial Neoplasia (HGPIN) topographical distribution in 1374 prostate specimens: Existence of topographical relationship between prostate cancer and HGPIN O. Eminaga, R. Hinkelammert, E. Eltze, O. Bettendorf, U. Titze, A. Semjonow (Cologne, Muenster, Saarbruecken, Schüttorf, Germany) 466 Clinical significance of benign prostatic tissue at the soft tissue margin in robotic and open radical prostatectomy S. Park, M. Shim, D. Yoo, C. Song, C-S. Kim, H. Ahn (Seoul, South Korea) 467 Are the efforts towards prostate cancer early detection associated with a significant reduction in tumor volume? An analysis stratified according to risk categories N. Suardi, A. Gallina, U. Capitanio, M. Tutolo, N. Fossati, R. Matloob, A. Russo, A. Salonia, R. Bertini, V. Di Girolamo, M. Freschi, C. Doglioni, G. Guazzoni, A. Briganti (Milan, Italy) * 468 Cancer volume is an independent predictor for biochemical progression and clinical failure in high-risk prostate cancer patients following radical prostatectomy: A single centre experience L. Hakim, M. Spahn, P. Gontero, S. Van Bruwaene, A. Briganti, C.Y. Hsu, K. Jeffrey, S. Joniau (Leuven, Belgium; Berne, Switzerland; Milan, Italy; Puli, Taiwan; Rochester, United States of America) Sunday 469 Impact of statin use on biochemical recurrence after radical prostatectomy for prostate cancer S. Park, M. Shim, D. Yoo, J. Kim, C. Song, J.H. Hong, C-S. Kim, H. Ahn (Seoul, South Korea) 470 Simple prediction model of side-specific extracapsular extension based on percent positive biopsy cores and tumor contact length with the capsule on MRI Y. Matsuoka, J. Ishioka, N. Numao, H. Tanaka, S. Yoshida, M. Yokoyama, F. Koga, K. Saito, H. Masuda, Y. Fujii, K. Kihara (Tokyo, Japan) * 471 Risk stratification among men undergoing radical prostatectomy for high-risk prostate cancer in a US cohort: An EMPaCT validation study J. Karnes, A. Briganti, P. Gontero, M. Spahn, S. Joniau (Rochester, United States of America; Milan, Turin, Italy; Berne, Switzerland; Leuven, Belgium) 472 Laparoscopic sentinel lymph node (SLN) dissection correlated to extended pelvic lymph node dissection for clinically localized prostate cancer (PC): 200 patients T.G.M. Rousseau, J. Lacoste, E. Potiron, G. Le Coguic, G. Aillet, M. Lacombe, L. Campion, C. Rousseau (Saint Herblain, Nantes, France) * 473 Pathological nodal staging score for prostate cancer: A tool to address adequate nodal dissection in men treated with radical prostatectomy A. Briganti, A. Nonis, C. Brombin, L.A. Kluth, F.K.H. Chun, S.F. Shariat, U. Capitanio, A. Gallina, A. Nini, M. Bianchi, M. Tutolo, M. Freschi, C. Doglioni, G. Guazzoni, A. Salonia, P. Rigatti, C. Di Serio (Milan, Italy; Hamburg, Germany; New York, United States of America) 194 Programme Book

195 474 Pathologic nodal staging scores (pnss) for prostate cancer: A decision tool for adjuvant therapy after radical prostatectomy L.A. Kluth, E. Xylinas, F. Abdollah, N. Passoni, H. Fajkovic, T. Faison, M. Sun, P.I. Karakiewicz, C. Seitz, P. Schramek, M. Herman, M. Schmid, Y. Lotan, D.S. Scherr, F.K.H. Chun, M. Graefen, A. Tewari, A. Briganti, S.F. Shariat (New York, Dallas, United States of America; Milan, Italy; St.Poelten, Viena, Austria; Montreal, Canada; Hamburg, Germany) 475 Does private health insurance status affect the pathological outcomes in patients undergoing radical prostatectomy in the United Kingdom? S. Robinson, A. Omar, D. Summers, H. Motiwala, A. Rao, O. Karim, M. Laniado (Slough, Berkshire, United Kingdom) 476 Examining the health status of informal caregivers of European patients with prostate cancer A. Goren, M. Lees, I. Gilloteau (New York, Princeton, United States of America; Rueil-Malmaison, France) Sunday EAU Milan

196 Sunday, 17 March - EAU Programme Abstract Session Bladder cancer: Imaging and resection Brown Hall 3 - Level S2 Poster Session 40 Chairs: P. Black, Vancouver (CA) F. Greco, Leipzig (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 477 Assessing the value of PET scans in the preoperative staging of bladder cancer A.I. Goodfellow, Z. Viney, P. Hughes, S. Hughes, S. Rankin, T. Kay, P. Dasgupta, T.S. O Brien, M.S. Khan (London, United Kingdom) * 478 Accuracy of FDG PET-CT compared with conventional CT for the lymph node staging in muscle invasive bladder cancer: Prospective study of 58 patients with extended lymphadenectomy I.G. Jeong, J.H. Lim, S. Hong, D. You, J.Y. Joung, B. Hong, J.H. Hong, H. Ahn, C-S. Kim (Seoul, South Korea; New Brunswick, United States of America) 479 The accuracy of fluorine-18 fluorodeoxyglucose ([18f]fdg) positron emission tomography in the diagnosis of lymph node metastasis for patients undergoing radical cystectomy and extended lymph node dissection for invasive bladder cancer F. Gevher, C. Demirdag, M. Gezer, M. Halac, K. Sonmezoglu, S. Ataus, C. Obek (Istanbul, Turkey) 480 The staging role of 18FDG PET-CT in patients with muscle-invasive bladder cancer selected for radical cystectomy M.C. Ferriero, G. Simone, R. Papalia, S. Guaglianone, R. Sciuto, C.L. Maini, M. Gallucci (Rome, Italy) Sunday 481 PETCT for preoperative evaluation of bladder cancer before cystectomy - localisation of positive lymphnodes F. Aljabery, G. Lindblom, S. Jahnson (Linköping, Sweden) 482 Extended results of the use of diffusion-weighted magnetic resonance imaging in the diagnosis of lymph node invasion in bladder cancer E. De La Peña, B. López, V. Hernández, I. Sola, C. Blázquez, F.J. Díaz, J. Borrego, J. Martel, C. Llorente (Madrid, Spain) * 483 Prognostic interest to discriminate muscularis mucosae invasion (T1a vs. T1b) in non-muscle-invasive bladder carcinomas: Results from a national multicentre study with a central pathology review M. Rouprêt, T. Seisen, S. Larre, E. Comperat, C. Mazerolles, G. Fromont, O. Celhay, B. Faivre D Arcier, F. Rozet, J. Irani, M. Soulie, C. Pfister (Paris, Reims, Toulouse, Poitiers, Tours, Rouen, France) 484 Applications of a flexible ultrasound bronchoscope in the staging of bladder transitional cell tumors: Initial experiences C. Xu, Z. Zhang, Y. Sun (Shanghai, China) 485 The prognostic effect of a repeat transurethral resection prior to neoadjuvant chemotherapy for urothelial carcinoma of the bladder J.M. Gaya, D.D. Holder, M.C. Benson, G.W. Hruby, J. De Castro, J.M. McKiernan (Barcelona, Spain; New York, United States of America) 196 Programme Book

197 486 Narrow band imaging (NBI) cystoscopy and NBI assisted bipolar TURBT: Does it improve detection rates in low and high risk non muscle invasive bladder cancer? The RUA s experience R. Giulianelli, B.C. Gentile, G. Vincenti, S. Nardoni, T. Shestani, L. Mavilla, L. Albanesi, F. Attisani, G. Mirabile, F. Pisanti, D. Granata, M. Schettini (Rome, Italy) 487 Significance of random bladder biopsies in patients undergoing transurethral resection of non-muscle invasive bladder cancer M. Kumano, Y. Nakano, H. Miyake, M. Fujisawa (Kobe, Japan) 488 Is transurethral surgery for bladder tumor or BPH safe to operator? J.P. Park, C. Zhao, Y.S. Shin, M.K. Kim, H.J. Kim (Jeonju, South Korea; Shanghai, China) Sunday EAU Milan

198 Sunday, 17 March - EAU Programme Abstract Session Living donor nephrectomy and tumours on kidney transplanted patients Amber Hall Level S2 Poster Session 41 Chairs: A. Breda, Barcelona (ES) M. Giessing, Düsseldorf (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 489 Transvaginally notes-assisted living donor nephrectomy: Experience after 50 cases L. Peri Cusi, M. Musquera Felip, A. Vilaseca Cabo, E. Garcia-Cruz, M.J. Ribal Caparrós, J. Huguet Pérez, R. Alvarez-Vijande, A. Alcaraz Asensio (Barcelona, Spain) 490 Clinical situations requiring right-sided living donor nephrectomy and the safety of hand-assisted living donor nephrectomy; single-center experience B.J. Lim, A. Kim, D. Choi, G. Song, W. Kim, I.G. Jeong, D.J. Han, B. Hong (Seoul, Busan, South Korea) 491 Results of ABO-incompatible kidney transplant after five years of experience M. Musquera Felip, A. Sanchez-Escudero, L. Peri, F. Diekmann, I. Revuelta, J. Cid, M. Lozano, M. Blasco, D. Paredes, J.M. Campistol, A. Alcaraz, F. Oppenheimer (Barcelona, Spain) 492 Results of the elderly unrelated ABO incompatible kidney transplantation T. Kimura, T. Yagisawa, N. Ishikawa, Y. Sakuma, T. Fujiwara, A. Nukui (Shimotsuke, Japan) Sunday 493 Decreasing operating times and complication rates after laparoscopic donor nephrectomy by different techniques in highly experienced surgical teams E.M.P. Broers, J.F. Langenhuijsen, H.W. Kloke, M.C. Warlé, M.F.P. Van Der Jagt, F.C.H. D Ancona (Nijmegen, The Netherlands) 494 LESS living donor nephrectomy L. Peri Cusi, A. Vilaseca Cabo, M. Musquera Felip, M.J. Ribal Caparrós, J. Huguet Pérez, R. Álvarez-Vijande, A. Alcaraz Asensio (Barcelona, Spain) 495 The impact of socioeconomic status, ethnicity, age and location of transplant centre on live donor kidney transplant access and outcomes in the West of Scotland N.J. Dempster, C. Ceresa, E. Aitken, D. Kingsmore (Glasgow, United Kingdom) 496 Effectiveness of our living donor kidney transplant program. evaluation of discarded living donor in kidney transplantation M. Musquera Felip, I. Revuelta, L. Peri, F. Diekmann, A. Sanchez-Escudero, M.C. Sebastia, R. Salvador, D. Paredes, C. Monsalve, A. Alcaraz, J. Campistol, F. Oppenheimer (Barcelona, Spain) 497 Live donor nephrectomy vs kidney transplants in minority populations: A population based analysis of trends J.D. Sammon, K.R. Ghani, S. Sukumar, S. Staley, J.O. Peabody, C.G. Rogers, M. Menon, Q-D. Trinh (Detroit, United States of America) 198 Programme Book

199 * 498 De novo parenchymal renal graft tumors. Multicenter descriptive national study with renal transplants F. Gómez Veiga, J. Ponce Diaz-Reixa, E. Lledó, J Blazquez, A. Breda, P. Pardo, M. Musquera, A. Alcaraz, J. García-Olaverri Rodríguez, C. Pertusa Peña, F. Burgos, C. García, L. Riera Canals, J. Cózar, A. Rodríguez, A. Aguilera, C. Hernández, P. Gutierrez (A Coruña, Madrid, Barcelona, Bilbao, Sevilla, Granada, Tenerife, Spain) 499 Pathologic characteristics and prognosis of renal cell carcinoma in kidney transplant recipients native kidney: Case-control study M. Sodano, N. Arrighi, L. Cristinelli, S. Sandrini, S. Cosciani Cunico, C. Simeone, A. Antonelli (Brescia, Italy) 500 Prostate carcinoma in solid organ transplant recipients X. Tillou, K. Guleryuz, J. Fumey, C. Orczyk, B. Hurault De Ligny, L. Chiche, H. Bensadoun, A. Doerfler (Caen, Bordeaux, France) 501 Urological de novo malignancies after renal transplantation: Incidence and management V. Hevia Palacios, V. Gómez Dos Santos, S. Álvarez Rodríguez, V. Díez Nicolás, C. Gómez Del Cañizo, C. Galeano Álvarez, A. Gomis Couto, A. Fernández Fernández, R. Marcén Letosa, F.J. Burgos Revilla (Madrid, Spain) Sunday EAU Milan

200 Sunday, 17 March - EAU Programme Abstract Session News in prostate and bladder infections Amber Hall Level S2 Poster Session 42 Chairs: N. Mondaini, Florence (IT) F.M.E. Wagenlehner, Giessen (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 502 Bacteraemia during TURP: Is it more prevalent than previously thought? A. Mohee, D. Gascoyne-Binzi, J. Sandoe, I. Eardley (Leeds, United Kingdom) 503 Additional amikacin is effective as a targeted antibiotic prophylaxis for transrectal prostate biopsy in patients with fluoroquinolone-resistant E. coli in rectal flora Y. Nasu, A. Takamoto, M. Sugimoto, N. Ono (Okayama, Kochi, Japan) 504 Prostatic penetration of meropenem in humans, and dosage considerations for prostatitis based on sitespecific pharmacokinetic-pharmacodynamic evaluation G. Nishikawa, K. Ikawa, K. Nakamura, Y. Yamada, K. Zennami, K. Ikeda, N. Morikawa, M. Sumitomo (Nagakute, Hiroshima, Kani, Japan) 505 The Influence of urinary ph on antibiotic efficacy against bacterial uropathogens L. Yang, K. Wang, H. Li, J Denstedt, P Cadieux (Chengdu, China; London, Canada) 506 Identification of bacteria in human urine from the profile of emitted volatile organic compounds J.P. Williams, K. Vaughan, B. De Lacy Costello, N.M. Ratcliffe, M.J. Drake (Bristol, United Kingdom) Sunday 507 Psychosomatic disorders in patients with chronic bacterial prostatitis O. Banyra, O. Ivanenko, O.D. Nikitin, O.O. Stroy (Lviv, Kiev, Ukraine) 508 Human papillomavirus infection is not related with prostatitis-realted symptoms in young heterosexual men: Results from a population-based case-control study R. Bartoletti, E. Meliani, F. Meacci, S. Mazzoli, T. Cai (Florence, Trento, Italy) 509 Effects of pollen extract in association with vitamins (deprox 500 ) for pain relief in patients affected by chronic prostatitis/chronic pelvic pain syndrome: Results from a randomized, controlled study T. Cai, G.L. Luciani, C. D Elia, N. Mondaini, G. Malossini, S. Mazzoli, R. Bartoletti (Trento, Florence, Italy) * 510 Prospective study assessing the presence of endotoxaemia in patients undergoing transrectal prostate biopsy S. Sheehan, J. Philpott-Howard, W. Wang, H. Nemade, P.M. Thompson (London, United Kingdom; Beijing, China) 511 Prevalence of prostatitis in men treated with prostatectomy (open prostatectomy, transurethral resection of prostate) for benign prostatic hyperplasia induced bladder outlet obstruction H. Khairy Salem, H. El Fayoumy, H. Shaker, A. Lotfi, E. Anis (Cairo, Egypt) 512 Early experience of safety and efficacy of sodium hyaluronate-chondroitin sulfate solution in chronic painful conditions in the bladder H. Yoon, Y.J. Byun, B.S. Shim, W.S. Chung, D.H. Lee, Y.Y. Park (Seoul, South Korea) 200 Programme Book

201 * 513 Characterisation of the inflammatory infiltrate in bladders from patients with bladder pain syndrome, multiple sclerosis and mitomycin instillations T. Gevaert, T. Roskams, D. De Ridder (Leuven, Belgium) Sunday EAU Milan

202 Sunday, 17 March - EAU Programme Abstract Session TURP and beyond Silver Hall - Level N2 Poster Session 43 Chairs: T. Esen, Istanbul (TR) M. Oelke, Hanover (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 514 Can we forecast the postoperative results in patients with bladder outlet obstruction (BOO)? S.H. Alloussi, G. Peters, Y. Al-Bulushi, W. Arafat, C. Lang, S. Alloussi (Neunkirchen, Germany) * 515 Is the resected prostate weight a predictive factor of the need for continual medication or reoperation for lower urinary tract symptom after transurethral resection of the prostate? A study by applying nationwide population based database C.C. Lin, A.T.L. Lin, H.J. Chung, Y.H. Huang, K.K. Chen, T.Z. Chen (Taipei, Taiwan) 516 The management of acute chronic urinary retention: Factors influencing treatment decisions W. Green, N. Campain, R. Parkinson (Derby, Nottingham, United Kingdom) 517 Transurethral resection of prostate and the role of pharmacological treatment with dutasteride in decreasing surgical blood loss A.L. Pastore, G. Palleschi, V. Petrozza, S. Mariani, M.A. Valentini, F. Barrese, M. Cappa, A. Carbone (Latina, Rome, Italy) 518 Impact of medical therapy on transurethral resection of the prostate (TURP): Two decades of change A. Argirovic, D. Argirovic (Belgrade, Serbia) Sunday 519 Clinical characters of patients continuing medical therapy after transurethral prostate surgery for benign prostatic hyperplasia with lower urinary tract symptoms W.J. Ko, H.H. Han, T.Y. Jung, T.K. Yoo, D.Y. Kim, T.H. Oh, S.S. Byun, S.I. Kim, D.D. Kwon (Gyeonggi-Do, Seoul, Daegu, Changwon, Gyeonggido, Chonnam, South Korea) 520 Bipolar resection versus standard transurethral resection of the prostate: A prospective randomized study with 2-year follow-up M. Oussama, J. Ghorbel, R. Hedi, M. Zouari, T. Kilani, J. Maaroufi, M. Ben Ali, H. Khouni, M. Dridi, R. Khiari, S. Ghozzi, N. Ben Rais (Tunis, La Marsa Tunis, Tunisia) * 521 Bipolar vs monopolar TURP: Impact on the overall sexual function and midterm safety-efficacy results of an international multicentre randomized controlled trial C. Mamoulakis, A. Skolarikos, M. Schulze, C. Scoffone, J. Rassweiler, G. Alivizatos, R. Scarpa, J. De La Rosette (Amsterdam, The Netherlands; Athens, Greece; Heilbronn, Germany; Turin, Italy) 522 Two-year prospective, randomized comparison between the bipolar plasma enucleation of the prostate and open prostatectomy in BPH cases over 80 ml B.F. Geavlete, F.A. Stanescu, C. Iacoboaie, P.A. Geavlete (Bucharest, Romania) 523 Systematic review and meta-analysis of the clinical effectiveness of bipolar compared to monopolar transurethral resection of the prostate M.I. Omar, T. Lam, C.E. Alexander, J. Graham, C. Mamoulakis, M. Imamura, S. MacLennan, F. Stewart, J. N Dow (Aberdeen, United Kingdom; Crete, Greece) 202 Programme Book

203 524 Prospective study to compare safety and outcomes of open retropubic adenomectomy and extraperitoneal laparoscopic adenomectomy A. Garcia-Segui, F. Ramon De Fata, F. Lista, G. Andres, M. Sánchez-Chapado, J.C. Angulo (Mahon, Madrid, Spain) 525 Single port transvesical adenomectomy for BPH M. Hisano, F.C. Vicentini, T.S. Agresta, P.K. Mota, M.A. Di Napoli, C.B. Murta, J.F.A. Claro (Sao Paulo, Brazil) Sunday EAU Milan

204 Sunday, 17 March - EAU Programme Abstract Session Paediatric urology: What s new? Red Hall 1 - Level N1 Poster Session 44 Chairs: M. De Gennaro, Rome (IT) Z. Tchanturaia, Tbilisi (GE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 526 Prevalence and temporal trends in admissions for urolithiasis in children F.J. Penna, J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, J.S. Elder (Detroit, United States of America) * 527 What is the best option for mm renal pelvic stones undergoing ESWL in pediatric population: Stenting, alpha blockers or conservative follow-up? E. Süer, M. Mermerkaya, F. Afandiyev, E. Öztürk, C. Özcan, B. Burgu, T. Soygür (Ankara, Turkey) 528 Pediatric ureteroscopy with two guide wires technique W. Gamal, A. Mmdouh, M. Husein, A. Hammdy, M. Aldahshoury, E. Moursy, M. Diaa (Sohag, Egypt) 529 Does previous open nephrolithotomy affect the outcomes of the percutaneous nephrolithotomy in children? B. Onal, F. Gevher, B. Argun, C. Dogan, S Citgez, A.U. Onder, A. Erozenci (Istanbul, Turkey) 530 Assessment of pediatric and adult percutaneous nephrolithtomy complications by modified Clavien grading system. A comparative study Z. Alam, M.B. Baig, T.W. Saad, S.Z. Zaidi (Karachi, Pakistan) Sunday 531 Percutaneous cystolithotomy in pediatric bladder enlargement and continent reservoirs E. Llorens De Knecht, A. Bujons, J. Caffarati, J.M. Garat, H. Villavicencio (Barcelona, Spain) 532 Lithiasis development in bladder continent reservoirs J.M. Lopez, J. Pelegrí, A. Bujons, J. Caffaratti, L.J. Saldaña, M. Cosentino, J.M. Garat, H. Villavicencio (Barcelona, Spain) 533 Predictors of renal functional improvement after pyeloplasty in ureteropelvic junction obstruction: Clinical value of visually assessed renal parenchymal tracer transit time in 99mTc-mercaptoacetyltriglycine (99mTc- MAG3) renography? S. Pak, S.H. Song, A. Kim, B. Lim, D. Kim, S. Park, K.S. Kim (Seoul, Ulsan, South Korea) * 534 Correction of ureteropelvic junction obstruction in children: National trends and comparative effectiveness in operative outcomes S. Sukumar, A. Abdo, F.J. Penna, A.A. Friedman, J.D. Sammon, K.R. Ghani, J.O. Peabody, M. Menon, Q-D. Trinh, J.S. Elder (Detroit, United States of America; Montreal, Canada) 535 Inguinal approach for the management of non-palpable testis: Is diagnostic laparoscopy necessary? J-S. Park, H.J. Jung, K-H. Bae, C-I. Kim (Daegu, South Korea) 536 Evaluation of laparoscopy in the diagnosis and management of non-palpable testis K. Mursi, A. Salem, M.N. El-Ghoneimy, A.M. Abdel-Hakim, I.R. Saad (Cairo, Egypt) 204 Programme Book

205 537 Laparoendoscopic single-site surgery (LESS) for treatment of different urologic pathologies in pediatrics: Initial experience A. Abdel-Karim, A. Moussa, M. Elmissery, A. Abolfotoh, W. Mahfouz, S. Elsalmy (Alexandria, Egypt) Sunday EAU Milan

206 Sunday, 17 March - EAU Programme Abstract Session Stones: ESWL and PCNL Red Hall 2 - Level N1 Poster Session 45 Chairs: S. McClinton, Aberdeen (GB) H.G. Tiselius, Stockholm (SE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 538 Withdrawn 539 Superior ureteric stone clearance with shockwave lithotripsy under anaesthesia: A review of 106 cases D.R. Lenaghan, C. Kaiser, J.R. Goad, A.H. Clarke (Melbourne, Australia) 540 Urgent shock wave lithotripsy as first-line treatment for ureteral stones: A meta-analysis of 570 patients S. Picozzi, C. Ricci, S. Casellato, R. Stubinski, G. Bozzini, S. Maruccia, L. Carmignani (San Donato Milanese, Italy) 541 A prospective randomized study comparing the effect of escalating and fixed voltage treatment on stone comminution and renal injury during ESWL N. Ghosh, S. Mandal, D. Karmakar, S. Bakshi (Kolkata, India) 542 Shock wave lithotripsy vs flexible ureteroscopy for the treatment of renal stones a single center experience C. Persu, V. Mirciulescu, G. Nita, A. Mihalache, P. Geavlete (Bucharest, Romania) 543 Is it possible to improve the efficacy of ESWL in the treatment of urinary lithiasis? E.J. Moran Pascual, M.A. Conca, A. Budia, P. Bahilo, G. García, F. Boronat (Valencia, Spain) Sunday 544 Withdrawn 545 The Locator: Clinical experience with a novel PCNL navigation device J.M. Lazarus, L. Kaestner (Cape Town, South Africa) PANG system -version 2: A multiutility system for percutaneous renal access A.V. Rawandale, L.G. Patni, P.A. Patil (Dhule, India) 547 Renal access under computer tomography guidance in percutaneous nephrolithotomy P. Sarkis, G. Nawfal, G. Kamel, A. Chemaly (Beirut, Lebanon) 548 Complications after percutaneous nephrolithotomy using the De La Rosette categorization of the Clavien- Dindo system. Single centre experience in 145 cases N. Ferakis, K. Bouropoulos, P. Nasopoulou, P. Sinos, P. Anastasopoulos, M. Stavropoulos, F. Venetsanos, A. Farmakis, I. Poulias (Athens, Greece) 549 A new method of objectively assessing the necessity of draining the ureter after mini-pcnl J. Rode, U. Nagele, M. Kufner, U. Walcher, M.N. Kimuli, A. Hoznek (Creteil, France; Hall in Tirol, Austria; Leeds, United Kingdom) 550 A novel paraboloid pneumatic intracorporeal lithotriptor: Computer assisted (CAD) analysis and invitro comparison with holmium laser A.V. Rawandale, L.G. Patni, P.A. Patil (Dhule, India) 206 Programme Book

207 551 Effect of epinephrine mix saline irrigation in percutaneous nephrolithotripsy surgery J.H. Yoon, T.S. Kim, J.S. Jeung, C.K. Oh, H.K. Ha, S. Kim (Busan, South Korea) Sunday EAU Milan

208 Sunday, 17 March - EAU Programme Abstract Session Uro-genital reconstruction and trauma Blue Hall Level N1 Poster Session 46 Chairs: J.J. Lopez-Tello Garcia, Madrid (ES) D.N. Wood, London (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 552 Laparoendoscopic single site pyeloplasty: A multi-institutional cumulative analysis R. Autorino, E. Rizkala, J. Cadeddu, S. Rais-Bahrami, V. Tugcu, A. Kawauchi, A. Abdel-Karim, I. Darweesh, A. George, A. Bagrodia, R. Kopp, L. Richstone, R. Stein, J. Kaouk (Cleveland, Dallas, New Hyde Park, La Jolla, United States of America; Istanbul, Turkey; Kyoto, Japan; Alexandria, Egypt) 553 Laparoendoscopic single-site (LESS) versus conventional transperitoneal laparoscopic pyeloplasty: A prospective randomized study V. Tugcu, Y.O. Ilbey, E. Sonmezay, A.I. Tasci (Istanbul, Turkey) 554 How long is it necessary to stent after laparoscopic or robot assisted dismembered pyeloplasty? Results of a prospective randomized study C. Germann, A. Mattei, P. Stucki, M. Behrendt, H. Danuser (Luzern, Switzerland) 555 Long-term renal function after urinary diversion: A retrospective study F.C. Burkhard, J. Xiao-Dong, S. Röthlisberger, F.J. Frey, U.E. Studer (Berne, Switzerland) 556 Iatrogenic ureteral stricture: Laparoscopic ureteral reimplantation J. Gómez Rivas, S. Alonso Y Gregorio, D. López Sánchez, J. Pons Viver, A. Tabernero Gómez, J. Cisneros Ledo, J.J De La Peña Barthel (Madrid, Spain) Sunday 557 Late functional results of double-barreled wet colostomy after 169 procedures: Single-institution experience G.C. Guimaraes, R.A.R. Oliveira, L.Y. Kumagai, G. Baiocchi, S. Aguiar, T.B.M. Santana, S.C. Zequi, R.L. Favaretto, W.H. Costa, A. Lopes (Sao Paulo, Brazil) 558 Urologic complications of cytoreductive surgery and intraperitoneal hyperthermic chemotherapy for peritoneal surface malignancy; incidence, risk factors, and management in 934 consecutive procedures L. Craven, M. Mirzazadeh, P. Shen, E. Levine, K. Votanopoulos, J. Stewart Iv (Winston Salem, United States of America) 559 Gender reassignment surgery - a 13 year review of surgical outcomes R. Rossi Neto, F. Hintz, S. Krege, H. Rübben, F. Vom Dorp, J. Hess (Essen, Krefeld, Germany) 560 Gender reassignment surgery: A 20 years review of surgical outcomes D. Arcaniolo, P. Verze, C. Imbimbo, N. Longo, A. Palmieri, F. Fusco, F. Mangiapia, F. Bottone, V. Mirone (Naples, Italy) 561 Multicentric study of reconstructive after partial amputation of the penis for squamous cell carcinoma R. Leonardi, S. Pecoraro, S. Sansalone, M. Silvani, A. Zucchi (Catania, Avellino, Rome, Biella, Perugia, Italy) 562 Long-term results of 50 ureteral replacements with ileum B.K. Komyakov, V.A. Ochelenko (Saint-Petersburg, Russia) 208 Programme Book

209 563 High grade renal injury: Non operative management of urinary extravasation and prediction of long-term outcomes J.A. Long, G. Fiard, V.A Arnoux, J.L. Descotes, O. Skowron, N. Terrier, J.J. Rambeaud (Grenoble, France) 564 Indications, successes and complications of arterial embolization in renal trauma G. Fiard, N. Terrier, C. Sengel, M. Chodez, J-L. Descotes, J-J. Rambeaud, J-A. Long (Grenoble, France) 565 Accuracy of magnetic resonance imaging for diagnosis of penile fracture comparison with intraoperative findings G. Hatzichristodoulou, J.E. Gschwend, K. Herkommer, N. Zantl (Munich, Germany) Sunday EAU Milan

210 Sunday, 17 March - EAU Programme Abstract Session Urothelial cancer: Transurethral surgery and intravesical recurrence Yellow Hall Level N1 Poster Session 47 Chairs: M. Babjuk, Prague (CZ) B. Van Rhijn, Amsterdam (NL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 566 Risks and complications of trans-urethral resection of bladder tumour in patients taking anti-platelet agents for cardiovascular disease S. Casellato, S. Picozzi, G. Bozzini, S. Maruccia, L. Carmignani (San Donato Milanese, Italy) 567 Is it oncologically safe performing simultaneous transurethral resection of the bladder and prostate? A meta-analysis on 1,234 patients S. Picozzi, C. Ricci, S. Casellato, G. Bozzini, S. Maruccia, D. Ratti, L. Carmignani (San Donato Milanese, Milan, Italy) 568 Snapshot of transurethral resection of new bladder tumours in the UK audit - STUKA A. Patel, J. Catto, D. Rosario, C. Gan, T.S. O Brien (London, Sheffield, United Kingdom) 569 TaG1 bladder tumours: One third of all primary tumours and 80% of all recurrent tumours can be treated in the office under local anaesthesia E.F. Sabir, S. Holmäng (Gothenburg, Sweden) Sunday 570 Comparative therapeutic impact and long-term NMIBC recurrence rates specific for HAL blue light cystoscopy, combined NBI bipolar plasma vaporization and the standard approach in randomized clinical settings B.F. Geavlete, R.D. Multescu, D.A. Georgescu, M. Jecu, F.A. Stanescu, C. Moldoveanu, P.A. Geavlete (Bucharest, Romania) 571 Long-term follow-up of patients with tumours of the renal pelvis and ureter: How often is a bladder tumour diagnosed after 5 tumour-free years? S. Holmäng, S.L. Johansson (Gothenburg, Sweden; Omaha, Nebraska, United States of America) 572 Risk stratification model for predicting bladder recurrence after radical nephroureterectomy for upper urinary tract urothelial carcinoma J. Ishioka, K. Saito, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, Y. Sakai, T. Okuno, C. Arisawa, S. Kamata, K. Nagahama, J. Yonese, A. Noro, T. Tsujii, S. Morimoto, Y. Higashi, I. Fukui, K. Kihara (Tokyo, Chiba, Ibaraki, Saitama, Japan) 573 Prediction of intravesical recurrence after radical nephroureterectomy: Development of a clinical decisionmaking tool E.N. Xylinas, L.A. Kluth, D.S. Scherr, G. Novara, E. Comploj, A. Pycha, H-M. Fritsche, Q-D. Trinh, P.I. Karakiewicz, A. Weizer, J.D. Raman, W. Kassouf, M. Zerbib, S.F. Shariat (New York, Ann Arbor, Hershey, United States of America; Padua, Bolzano, Italy; Regensburg, Germany; Montreal, Canada; Paris, France) 574 Detection of factors affecting early bladder recurrence after nephroureterectomy in patients with N0M0 upper urinary tract urothelial carcinoma K. Kuroda, J. Asakuma, A. Horiguchi, S. Tasaki, A. Sato, K. Seguchi, K. Ito, T. Asano (Tokorozawa, Saitama, Japan) 210 Programme Book

211 575 Segmental ureterectomy versus radical nephroureterectomy for urothelial cancer of the ureter: A matchedpair analysis T. Klatte, R.E. Zigeuner, M. Rouprêt, M. Babjuk, U. Capitanio, E. Cha, P. Colin, E. Comploj, O. Dalpiaz, H.-M. Fritsche, T.R. Herrmann, M. Hora, W. Hübner, A.S. Merseburger, F. Montorsi, L. Nison, G. Novara, M. Roscigno, S.F. Shariat, M. Remzi (Vienna, Graz, Korneuburg, Austria; Paris, Lille, France; Prague, Plze n, Czech Republic; Milan, Bolzano, Padua, Bergamo, Italy; New York, United States of America; Regensburg, Hanover, Germany) 576 Prediction of cancer-specific survival after radical nephroureterectomy for upper tract urothelial carcinoma: Development of an optimized post-operative nomogram using decision curve analysis M. Rouprêt, V. Hupertan, T. Seisen, P. Colin, E. Xylinas, D. Yates, H. Fajkovic, Y. Lotan, J. Raman, R. Zigeuner, M. Remzi, C. Bolenz, G. Novara, W. Kassouf, A. Ouzzane, F. Rozet, O. Cussenot, J. Martinez-Salamanca, H-M. Fritsche, T. Walton, C. Wood, K. Bensalah, P. Karakiewicz, F. Montorsi, V. Margulis, S. Shariat (Paris, Lille, Rennes, France; New-York, Dallas, Hershey, Texas, United States of America; Graz, Korneuburg, Austria; Manheim, Regensburg, Germany; Bergamo, Milan, Italy; Montreal, Canada; Madrid, Spain; Nottingham, United Kingdom) * 577 Photodynamic diagnosis of non-muscle invasive bladder cancer with hexaminolevulinate cystoscopy: A meta-analysis M. Burger, H.B. Grossman, M. Droller, J. Schmidbauer, G. Hermann, O. Drăgoescu, E. Ray, F.J. Witjes, A. Karl, A. Stenzl, Y. Fradet, J. Burgués, D. Jocham (Würzburg, Munich, Tübingen, Lübeck, Germany; Houston, New York, United States of America; Vienna, Austria; Copenhagen, Denmark; Craivoa, Romania; London, United Kingdom; Nijmegen, The Netherlands; Quebec, Canada; Palma de Mallorca, Spain) Discussion on poster 577 M. Babjuk, Prague (CZ) Sunday EAU Milan

212 Sunday, 17 March - EAU Programme Abstract Session Laparoscopic renal surgery euro Auditorium - Level S2 Video Session 6 Chairs: A. Celia, Bassano del Grappa (IT) M.J. Ribal, Barcelona (ES) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V41 V42 V43 V44 V45 Laparoscopic nephrectomy with cavotomy for right renal cell carcinoma with venous thrombus F. Vigués, J.I. Pérez-Reggeti, M. Serrallach, E. Llorens, R. Rodriguez-Malatesta, M.A. López-Costea, E. Franco (Barcelona, Spain) Alternative laparoscopic approaches for kidney neoplasms with tumor thrombus L. Rodriguez Villamil, M. Rivas Del Fresno, S. Fernandez-Pello Montes, I. Gonzalez Rodriguez, P. Benito Garcia, J. Cuervo Calvo (Gijon, Spain) Laparoscopic partial nephrectomy with radiofrequency ablation B.Y. Alekseev, A.N. Andrianov, K.M. Nyushko, A.S. Kalpinskiy, N.V. Vorobyev, V.A. Polyakov (Moscow, Russia) Left laparoscopic radical nephrectomy: Step-by-step R. Sotelo Noguera, O. Carmona, R. De Andrade, F. Santinelli, D. Subira, C. Ignacio, G. Fernández, R. Garza, J. Castro, F. Birkhauser, R. Cisneros, D. Canes, R. Clayman (Caracas, Venezuela; Buenos Aires, Argentina; Madrid, Spain; Boston, Irvine, United States of America) Renovascular and tumor 3-D reconstruction to facilitate robot-assisted anatomical partial nephrectomy O. Ukimura, A.L. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Dharmaraja, M. Patil, M. Aron, M. Desai, I. Gill (Los Angeles, United States of America) Sunday V46 V47 Laparoscopic partial nephrectomy with superselective microdissection G. Simone, R. Papalia, M. Ferriero, S. Guaglianone, M. Costantini, E. Forastiere, M. Gallucci (Rome, Italy) Off-clamp, non-renorrhaphy laparoscopic partial nephrectomy with perirenal fat and Gerota s fascia reapproximation: Initial experience of a novel technique T.S. Kim, H.Y. Rhew, J.H. Oh, S.H. Kang, S. Kim, H.K. Ha, J. Yoon (Busan, South Korea) V48 Selective arterial clamping with aid of near-infrared fluorescence during laparoscopic partial nephrectomy P. Macek, F. Rozet, E. Barret, R.E. Sanchez-Salas, M. Galiano, Y. Ahallal, X. Cathelineau (Paris, France) 212 Programme Book

213 Sunday, 17 March - EAU Programme Abstract Session Focal therapy in prostate cancer treatment Brown Hall Level S2 Poster Session 48 Chairs: H.U. Ahmed, London (GB) B. Malavaud, Toulouse (FR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 578 Focal therapy for prostate cancer using I125seed implantation: Hemiablative brachytherapy for patients selected using extended biopsy and MRI K. Saito, T. Kijima, S. Yoshida, M. Yokoyama, J. Ishioka, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, K. Hayashi, H. Shibuya, K. Kihara (Tokyo, Japan) 579 Treatment of prostate cancer by 125iodine interstitial brachytherapy: A single center experience F. Palmieri, C. Di Stefano, M. Del Duca, G. Mazzotti, M. Morelli, G. Bruno, E. Lamanna, R. Pernetti, S. Voce (Ravenna, Italy) 580 Robotic HIFU: Focus on early complications and imaging evaluation with D-CE-MR after 3 years experience F. Pisanti, R. Del Vescovo, F. Attisani, B.B. Zobel, R. Giulianelli (Rome, Italy) 581 HIFU therapy for castration-resistant prostate cancer V.A. Solovov, L.V. Shaplygin, M.O. Vozdvozhenskiy (Samara, Russia) 582 MR-guided focal cryoablation of prostate cancer recurrence following radiotherapy: A feasibility study J. Futterer, J. Bomers, D. Yakar, N.J.T. Van Lin, H. Vergunst, F. De Lange, J.O. Barentsz, J.P. Sedelaar (Nijmegen, The Netherlands) 583 Definition of mid-term MRI follow-up after focal therapy for clinically localized low risk prostate cancer F. Mistretta, A. Losa, G. Cardone, M. Lazzeri, G.M. Gadda, G. Lista, A. Larcher, A. Abrate, G. Balconi, G. Guazzoni (Milan, Italy) 584 Early clinical experience of focal therapy for localised prostate cancer using irreversible electroporation C.L. Dickinson, M. Valerio, H.U. Ahmed, A. Freeman, C. Allen, M. Emberton (London, United Kingdom) Sunday 585 Focal therapy targeted to the index lesion in multifocal prostate cancer: A prospective development study C.L. Dickinson, H.U Ahmed, R.G Hindley, M. Sahu, S. Charman, S. Weir, N. McCartan, A. Freeman, A.P Kirkham, C. Allen, J. Van Der Meulen, M. Emberton (London, Basingstoke, United Kingdom) 586 Candidate selection for quadrant-ablation focal therapy of prostate cancer through a combination of extended 14-core biopsy and MRI Y. Matsuoka, N. Numao, K. Saito, H. Tanaka, S. Yoshida, M. Yokoyama, J. Ishioka, F. Koga, H. Masuda, Y. Fujii, K. Kihara (Tokyo, Japan) 587 Focal HIFU treatment for prostate cancer. Initial results M. Borghi, E. Becher, L. Montes De Oca, V. Chernobilsky (Buenos Aires, Argentina) 588 Initial results of MR guided laser focal therapy for prostate cancer U. Lindner, S.R.H. Davidson, N.E. Fleshner, A. Finelli, A.R. Zlotta, M.A.S. Jewett, T.H. Van Der Kwast, M.R. Gertner, E. Hlasny, S.A. McCluskey, W. Kucharczyk, M.A. Haider, J. Trachtenberg (Toronto, Canada) EAU Milan

214 589 Limitation of the current criteria for biochemical recurrence (BCR) after high intensity ultrasound (HIFU) in localized prostate cancer R.E. Sanchez Salas, D. Prapotnich, F. Secin, E. Barret, F. Rozet, M. Galiano, A. Mombet, N. Cathala, X. Cathelineau (Paris, France; Buenos Aires, Argentina) Is focal therapy a real competitor of watchful waiting? B. Malavaud, Toulouse (FR) Sunday 214 Programme Book

215 Sunday, 17 March - EAU Programme Abstract Session Diagnostic imaging for bladder cancer Brown Hall 3 - Level S2 Poster Session 49 Chairs: M. Burger, Würzburg (DE) V. Matveev, Moscow (RU) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 590 Precision of CT urography in diagnosis of transitional cell carcinoma B. Horsburgh, J. Belfield, C. Lynch (Liverpool, United Kingdom) 591 CT cystography (CTC) with virtual cystoscopy (VC): A new technique in the detection of bladder lesion G.M. Busetto, V. Panebianco, R. Giovannone, R. Passariello, V. Gentile, E. De Berardinis (Rome, Italy) * 592 A comparison of hexaminolaevulinate (hexvix ) fluorescence cystoscopy and white light cystoscopy for the detection of bladder cancer: Results of the HeRo observational study A. Lapini, A. Minervini, A. Masala, L. Schips, A. Pycha, L. Cindolo, R. Giannella, T. Martini, G. Vittori, D. Zani, F. Bellomo, S. Cosciani Cunico (Florence, Naples, Vasto, Bolzano, Brescia, Milan, Italy) 593 Narrow band imaging improves the detection of new and recurrent bladder cancers and carcinoma in-situ W. Lam, B. Ayres, A. Fernando, M. Perry (London, United Kingdom) 594 In vivo optical coherence tomography for the evaluation of upper urinary tract urothelial carcinoma: Initial results from a pilot study M.T.J. Bus, B.G. Muller, D.M. De Bruin, D.J. Faber, M.P. Laguna-Pes, T.G. Van Leeuwen, T.M. De Reijke, J.J.M.C.H. De La Rosette (Amsterdam, The Netherlands) 595 Air versus water as an optical transmission medium in cystoscopy back to the origins? A. Ciudin, M.G. Diaconu, D. Gosalvez, L. Mateu, I. Aisain, A. Garcia-Larrosa, L. Peri, E. Garcia-Cruz, A. Franco, A. Alcaraz (Barcelona, Viladecans, Spain) 596 Feasibility of transurethral resection of the bladder (TURB) done by narrow-band imaging (NBI) F. Longo, M. Delor, B. Mangiarotti, A. Del Nero, E. Montanari (Milan, Italy) Sunday 597 Molecular characteristics of tumour tissue, fluorescent tissue during PDD, blood and urine in non-muscle invasive bladder cancer patients B. Dobrowolska-Glazar, M. Kozakowska, W. Lipczynski, A. Jozkowicz, J. Dulak, Z. Dobrowolski (Cracow, Poland) 598 Comparison of optics and performance of a distal sensor high definition cystoscope, a distal sensor standard definition cystoscope and a fiberoptic cystoscope A. Lusch, P. Greene, R. Alipanah, A. Perez-Lanzac De Lorca, E.M. McDougall, J. Landman (Orange, United States of America) 599 Photodynamic diagnosis of upper urinary tract urothelial cell cancer O. Aboumarzouk, S. Ahmad, B. Somani, H. Moseley, G. Nabi, S. Kata (Dundee, United Kingdom) 600 Photo-dynamic therapy (PDD) and flexible uretero-renoscopy (FURS) for upper tract TCC S. Agrawal, E. Havrenak, D. Hrouda, A. Shamsuddin (London, United Kingdom) EAU Milan

216 601 Role of conventional cytology in the treatment of upper tract urothelial carcinoma (OSS-UTUC): Results from the multi-institutional organ-sparing-utuc collaboration E. Comploj, M. Babjuk, U. Capitanio, E. Cha, P. Colin, H-M. Fritsche, T. Herrmann, W. Hübner, T. Klatte, A. Merseburger, F. Montorsi, A. Pycha, M. Roscigno, M. Rouprêt, S. Shariat, R. Zigeuner, M. Remzi (Bozen, Milan, Bergamo, Italy; Prague, Czech Republic; New York, United States of America; Lille, France; Regensburg, Hanover, Germany; Korneuburg, Vienna, Graz, Austria) Sunday 216 Programme Book

217 Sunday, 17 March - EAU Programme Abstract Session Research in kidney transplant Amber Hall Level S2 Poster Session 50 Chairs: A.B. Chkhotua, Tbilisi (GE) E. Lledo García, Madrid (ES) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 602 Blood group antigen-targeting peptide suppresses anti-blood group antibody binding to antigen in renal glomerular capillaries after ABO-incompatible blood reperfusion T. Yoneyama, S. Hatakeyama, Y. Tobisawa, H. Yamamoto, K. Imanishi, T. Okamoto, N. Tokui, N. Sugiyama, Y. Suzuki, S. Kudo, T. Yoneyama, Y. Hashimoto, T. Koie, N. Kamimura, M. N Fukuda, C. Ohyama (Hirosaki, Japan; La Jolla, United States of America) 603 Heat shock protein 90 is involved in antibody-mediated rejection and is a potential target of anti-rejection therapy in kidney transplantation T. Tanaka, H. Ishida, M. Furusawa, Y. Tamura, H. Kitamura, S. Takahashi, N. Masumori, K. Tanabe, N. Sato, T. Tsukamoto (Sapporo, Tokyo, Japan) * 604 Ischemic post-conditioning attenuates renal ischemic reperfusion injury via down-regulation of toll-like receptor 4 B.O. Jiang, Q. Chen, D. Kong, X. Liu, Z. Chen (Xianning, Wuhan, China) 605 Mechanisms of toll-like receptor 4 (TLR4)-mediated inflammation after cold ischemia/reperfusion in the kidney B.O. Jiang, Q. Chen, L. Hu, W. Zou, X. Liu (Xianning, Wuhan, China) 606 Beneficial effect of a short-period of hypothermic pulsatile machine perfusion of warm ischemic kidneys just before the transplant. Experimental study B. Humanes-Sanchez, A. Lazaro-Fernandez, J.C. Jado, M. Mojena-Sanchez, D. Ramirez-Martin, C. Agra, E. Alvarez, J.F. Del Cañizo-Lopez, C. Hernandez-Fernandez, A. Tejedor-Jorge, E. Lledo-Garcia (Madrid, Spain) Sunday 607 Experimental evaluation of renal oxygen consumption and antioxidant activity in the post-transplant period of kidneys with initial warm ischemia A. Lazaro-Fernandez, B. Humanes-Sanchez, M. Mojena, J.C. Jado, D. Ramirez-Martin, C. Agra, C. Hernandez-Fernandez, A. Tejedor-Jorge, E. Lledo-Garcia (Madrid, Spain) 608 The fibrinopeptide Bβ attenuates early ischemia reperfusion injury in the mouse kidney A. Urbschat, K. Zacharowski, N. Obermueller, K. Rupprecht, P. Paulus (Frankfurt am Main, Germany) 609 Renoprotective effects of aliskiren following ischemia reperfusion injury F. Hammad, S. Al-Salam, L. Lubbad (Al Ain, United Arab Emirates) 610 Comparison of the clinical outcome and systemic inflammatory marker levels between retroperitoneal and transperitoneal laparoscopic donor nephrectomy M. Saito, N. Tsuchiya, S. Narita, K. Numakura, S. Akihama, T. Inoue, S. Satoh, T. Habuchi (Akita, Japan) EAU Milan

218 611 Change in renal function after donor nephrectomy: An assessment using TC 99m-DTPA glomerular filtration rate H.J. Cho, Y.S. Choi, W.J. Bae, J.H. Bae, S.J. Kim, S-H. Hong, J.Y. Lee, S.W. Kim, T-K. Hwang (Seoul, South Korea) * 612 Comparison of postoperative estimated glomerular filtration rate between donor and radical nephrectomy patients D.S. Kim, S. Jung, S.J. Lee, Y.Y. Park, S.H. Jeon (Seoul, South Korea) 613 Post-transplant renal function is closely correlated with aortic calcification index (ACI) progression rate in renal transplant recipients S. Hatakeyama, T. Yoneyama, T. Koie, Y. Hashimoto, T. Fujita, R. Murakami, H. Saitoh, T. Funyu, S. Narumi, C. Ohyama (Hirosaki, Japan) Sunday 218 Programme Book

219 Sunday, 17 March - EAU Programme Abstract Session Urological infections Amber Hall Level S2 Poster Session 51 Chairs: H.M. Çek, Istanbul (TR) R.S. Pickard, Newcastle upon Tyne (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 614 Fournier s gangrene: Prognostic aspects and predisposing risk factors G. Liguori, N. Pavan, A. Rinaldi, S. Bucci, M. Rizzo, S. Siracusano, C. Trombetta (Trieste, Italy) 615 Comparison of different scoring systems for outcome prediction in patients with Fournier s gangrene: Our experience with 50 patients A. Tuncel, T. Keten, Y. Aslan, M. Kayali, A. Erkan, M. Yildiz, A. Atan (Ankara, Turkey) 616 Our experiences of Fournier s gangrene: 71 cases T. Ziypak, S. Adanur, F. Ozkaya, T. Yapanoglu, G. Okyar (Erzurum, Turkey) 617 Bacteremia during catheter manipulation: A prospective study A. Mohee, D. Gascoyne-Binzi, J. Sandoe, I. Eardley (Leeds, United Kingdom) 618 Growth quantification and rapid drug susceptibility testing of uropathogenic Candida albicans by isothermal microcalorimetry G. Bonkat, L. Wernli, O. Braissant, M. Rieken, G. Müller, S. Wyler, T. Gasser, A. Bachmann (Basel, Switzerland) * 619 Effect of human papillomavirus and chlamydia trachomatis coinfection on sperm parameters in young heterosexual men with chronic prostatitis-related symptoms T. Cai, F. Wagenlehner, N. Mondaini, C. D Elia, G. Malossini, S. Mazzoli, R. Bartoletti (Trento, Florence, Italy; Giessen, Germany) 620 Diagnosis of bladder tuberculosis E. Kulchavenya (Novosibirsk, Russia) Sunday 621 Phytotherapy in the prevention of recurrent uncomplicated urinary tract infection in women V.I. Vashchula, D.M. Nitkin, A.I. Viliukha (Minsk, Belarus) 622 A prospective observational cohort study on patients with PSA levels ranging from 4 to 10 ng/ml at opportunistic screening: Management and responses to ciprofloxacin 1000 mg P. Verze, C. Imbimbo, D. Arcaniolo, M. Franco, R. Bianco, A. Palmieri, F. Mangiapia, V. Mirone (Naples, Italy) * 623 Bacterial motility and NF-κB activation by clinical isolates from urinary tract infections M. Lanz, C. Birchall, A.S.M. Ali, K. Walton, C.L. Townes, L.Y. Lim, S. Roushias, P. Aldridge, R.S. Pickard, J. Hall (Newcastle upon Tyne, United Kingdom) 624 HPV-contamination of laser smoke during laser treatment of condylomata acuminata I. Akbarov, A. Tok, U. Wieland, U. Engelmann, S. Wille (Cologne, Germany) EAU Milan

220 625 Predictors of admission in patients presenting to the emergency department with urinary tract infection J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of America) Sunday 220 Programme Book

221 Sunday, 17 March - EAU Programme Abstract Session New and old minimally invasive BPH therapies Silver Hall - Level N2 Poster Session 52 Chairs: S. Madersbacher, Vienna (AT) K.M.L. Van Renterghem, Hasselt (BE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 626 NX-1207 for the treatment of lower urinary tract symptoms due to benign prostatic hyperplasia (BPH) N.D. Shore, R.F. Tutrone Jr. (Myrtle Beach, South Carolina, Baltimore, Maryland, United States of America) 627 Effect of onabotulinum toxin type A intraprostatic injection on the outcome of BPH patients refractory to medical therapy: A 2-year study T. Gorgal Rodrigues De Carvalho, J. Silva, R. Pinto, P. Dinis, F. Cruz (Porto, Portugal) 628 Clinical outcome of prostatic arterial embolization for patients with benign prostatic hyperplasia and moderate to severe lower urinary tract symptoms 365 cases L. Campos Pinheiro, J. Pisco, H. Rio Tinto, T. Bilhim, L. Fernandes, M. Duarte, J. Preira, A. Gouveia Oliveira (Lisbon, Portugal) 629 The Prostatic Urethral Lift (PUL), a minimal-invasive transurethrally-placed implant, proves its efficacy in the treatment of LUTS in patients with BPH in daily clinic practice outside of studies F. Miller, M. Schönthaler, R. Berges, C. Gratzke, B. Amend, J. Bedke, S. Kruck, J. Zumbé, U. Wetterauer, C. Stief, A. Stenzl, K-D. Sievert (Tübingen, Freiburg, Cologne, Munich, Leverkusen, Germany) 630 The MediTate temporary implantable nitinol device (TIND) proves safe and effective in relieving bladder outlet obstruction related to benign prostatic hyperplasia F. Porpiglia, D. Amparore, C. Fiori (Orbassano (Turin), Italy) 631 Transurethral water vapor therapy for BPH; initial clinical results of the first in man trial and Rezūm I pilot study C. Dixon, E. Rijo Cedano, D. Pacik, V. Vit, G. Varga, L. Mynderse, D. Hanson, T. Larson (New York, Rochester, United States of America; La Romana, Dominican Republic; Brno, Czech Republic) Sunday 632 The factors associated with occurrence and recovery of transient urinary incontinence after holmium laser enucleation of the prostate J-Y. Han, S-W. Park, L. Sang Don, M.K. Chung (Yangsan, South Korea) 633 Evaluating the efficacy and impact on quality of life of 120 Watts KTP LASER for treating bladder outlet obstruction D. Kaushal (Taree, Australia) 634 Photoselective vaporisation of the prostate using the 180W lithium triborate laser in the treatment of benign prostatic obstruction: An international multicenter experience A.S. Chung, A. Bachmann, E. Collins, F. Gomez Sancha, S. Tabatabaei, H.H. Woo (Sydney, Australia; Basel, Switzerland; San Francisco, Boston, United States of America; Madrid, Spain) 635 Significant absorption of irrigation fluid is frequently detectable during high-power Greenlight laser vaporization of the prostate: Results from a prospective investigation using the expired breath ethanol test M.S. Wettstein, N. Grossmann, C.D. Fankhauser, L.J. Hefermehl, J.C. Capol, M. Zimmermann, T. Sulser, A. Müller, T. Hermanns (Zürich, Switzerland) EAU Milan

222 636 Thulium VapoEnucleation of the prostate in patients on oral anticoagulation C. Netsch, M. Stöhrer, S. Knipper, T. Bach, T.R.W. Herrmann, A.J. Gross (Hamburg, Hanover, Germany) 637 Extent of tissue ablation following pure transurethral bipolar plasma vaporization compared to monopolar resection of the prostate: 12 months-results of a transrectal three-dimensional ultrasound volumetry study B. Kranzbühler, O. Gross, C.D. Fankhauser, M.S. Wettstein, N. Grossmann, L.J. Hefermehl, C. Poyet, R. Largo, M. Zimmermann, T. Sulser, A. Müller, T. Hermanns (Zürich, Switzerland) 638 Greenlight HPS-120W vs Greenlight XPS-180W laser vaporization of the prostate for benign prostatic hyperplasia: A global, multi-center, and prospective comparative analysis according to prostate size P.A. Hueber, D. Liberman, T. Ben-Zvi, H. Woo, M.A. Hai, A.E. Te, B. Chughtai, R. Lee, M. Rutman, R.R. Gonzalez, N. Barber, K.C. Zorn (Montreal, Canada; Sydney, Australia; Wayne, New York, Houston, United States of America; Frimley, Surrey, United Kingdom) Summary and outlook S. Madersbacher, Vienna (AT) Sunday 222 Programme Book

223 Sunday, 17 March - EAU Programme Abstract Session Paediatric urology developments Red Hall 1 - Level N1 Poster Session 53 Chairs: G.A. Bogaert, Leuven (BE) S. Tekgül, Ankara (TR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 639 Pediatric extreme weight kidney transplantation M. Musquera Felip, A. Vila, L. Peri, M. Piqueras, R. Alvarez-Vijande, L. Garcia, J.A. Camacho, A. Alcaraz (Barcelona, Spain) * 640 Long-term follow up of adult female patients (16-28 years old) with history of bladder exstrophy (BE) repair in childhood: Urological and fertility function outcome H.K. Salem, M. Eisa (Giza Cairo, Egypt) 641 Withdrawn * 642 Continent ileal tube technique: A simple catheterizable channel construction using ileum when appendix is not available S. Tekgul, H.S. Dogan, A. Koni, M. Hascicek (Ankara, Turkey) 643 Histologic responses of different bulking agents which are used for endoscopic reflux treatment, on rats bladder and subcutanous tissue A.C. Bozaci, F.T. Aki, D. Zeybek, S. Muftuoglu, H.S. Dogan, S. Tekgul (Ankara, Turkey) 644 Endoscopic treatment of occult vesicoureteric reflux significantly reduces risk of febrile urinary tract infection R. Pichler, C. Berger, D. Oswald, T. Becker, M. Koen, I. Heidegger, A. Strasak, B. Schlenck, W. Horninger, J. Oswald (Innsbruck, Linz, Salzburg, Austria) 645 Previous endoscopic injection significantly reduces reimplantation success: Critical retrospective analysis of 398 patients A.C.B. Bozaci, B. Ozdemir, S. Tonyali, H.S. Dogan, S. Tekgul (Ankara, Turkey) Sunday 646 Can factors affecting complication rates for urethral reimplantation be predicted? Use of Clavien classification system in pediatric population E. Süer, C. Özcan, M. Mermerkaya, E. Öztürk, Ö. Gülpınar, B. Burgu, T. Soygür (Ankara, Turkey) 647 Effects of transforming growth factor on the developing embryonic ureter: An in-vitro megaureter model in mice E. Öztürk, B. Burgu, Ö. Gülpınar, T. Soygür (Ankara, Turkey) 648 Long term follow-up after transurethral treatment of infravesical obstruction in boys P.M.L. Hennus, J.H. Kieft, E. Hoenjet, S.P. Rynja, T.P.V.M. Jong, J.L.H.R. Bosch, L.M.O. De Kort (Utrecht, The Netherlands) 649 The impact of internal spermatic artery preservation during laparoscopic varicocelectomy on recurrence and catch-up growth rate in adolescent S. Park, L. Chunwoo, S. Sang Hoon, L. Hunju, M. Kyung Hyun, K. Kun Suk (Ulsan, Seoul, South Korea) EAU Milan

224 650 Comparative analysis of the long-term oncological results of radical nephrectomy after chemotherapy by the videolaparoscopic technique with those of the open technique, for the treatment of Wilms tumor R. Duarte, F.T. Denes, L.M. Cristofani, A.M. Giron, V. Odone-Filho, U. Tannuri, M. Srougi (Sao Paulo, Brazil) Sunday 224 Programme Book

225 Sunday, 17 March - EAU Programme Abstract Session Stones: ESWL, epidemiology and training Red Hall 2 - Level N1 Poster Session 54 Chairs: M.R. Desai, Naidad (IN) J. Rassweiler, Heilbronn (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 651 Transient potential cation channel V4 (TRPV4) is involved in regulation of intraluminal pressure of the normal and obstructed ureter N. Fossati, L. Villa, R. Buono, F. Benigni, P. Zygmunt, P. Hedlund (Milan, Italy; Lund, Sweden) * 652 Effect of tadalafil and diltiazem on ESWL induced kidney injury in rats H. Vuruskan, B. Aytac, G. Ozmerdiven, M. Danısoglu, H. Kilicarslan (Bursa, Turkey) 653 In vivo stone comminution produced by a modified acoustic lens for electromagnetic lithotripters A. Neisius, N. Smith, N. Kuntz, T. Schykowski, G. Astroza, M. Lipkin, W. Simmons, G. Preminger, P. Zhong (Durham, United States of America) * 654 Procedural performance and assessment of technical skills in percutaneous renal access: Using an assessment tool in Virtual Reality Perc-Mentor trainer F. Zaman, I. Junaid, S. Kachrilas, A. Goyal, A. Bourdoumis, C. Bach, N. Buchholz, J. Masood (London, United Kingdom) 655 Construction and validation of a novel indigenous PCNL simulator: An innovative approach to training A.V. Rawandale, L.G. Patani, P.A. Patil (Dhule, India) 656 Improved porcine ex-vivo organ model for percutaneous renal surgery (sandwich-model) using a laparoscopy-training-box (SITUS Box) S. Jutzi, F. Imkamp, M.A. Kuczyk, M. Wolters, M. Stoehrer, S. Kruck, U. Walcher, U. Nagele, T.R.W. Herrmann (Hanover, Tübingen, Germany; Hall, Austria) Sunday 657 It s getting hot in here! Monthly variation in emergency department visits for upper urinary tract calculi in the United States K.R. Ghani, J.D. Sammon, S. Sukumar, W. Jeong, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of America) * 658 Percutaneous nephrolithotomy in England: Practice and outcomes described in the Hospital Episode Statistics database J.N. Armitage, J. Withington, J.H.P. Van Der Meulen, D. Cromwell, J. Glass, W.G. Finch, S.O. Irving, N.A. Burgess (Cambridge, London, Norwich, United Kingdom) * 659 Trends in utilization and outcomes for percutaneous nephrolithotomy in the United States K.R. Ghani, J.D. Sammon, S. Sukumar, D. Pucheril, R. Littleton, J.O. Peabody, N. Bhojani, M. Menon, Q-D. Trinh (Detroit, United States of America; Montreal, Canada) 660 Use of flexible ureteroscopy in the clinical practice for the treatment of renal stones: Results from a large European survey F. Sanguedolce, E. Liatsikos, P. Verze, S. Hruby, A. Breda, M. Binbay, T. Knoll (London, United Kingdom; Patras, Greece; Naples, Italy; Salzburg, Austria; Barcelona, Spain; Istanbul, Turkey; Sindelfingen, Germany) EAU Milan

226 661 Treatment response in stone patients with gouthy diathesis stratified by BMI G. Astroza, A. Neisius, M. Tsivian, N. Kuntz, M. Iqbal, G. Preminger, M. Lipkin (Santiago, Chile; Durham, United States of America) 662 Relief more than 2 weeks after ureteral obstruction is a risk factor for long-term renal function deterioration G. Lucarelli, P. Ditonno, R. De Nola, A. Vavallo, M. Rutigliano, M. Spilotros, S. Impedovo, C. Bettocchi, F.P. Selvaggi, M. Battaglia (Bari, Italy) Sunday 226 Programme Book

227 Sunday, 17 March - EAU Programme Abstract Session From bench to bedside in pain and OAB Blue Hall Level N1 Poster Session 55 Chairs: A. Giannantoni, Perugia (IT) K. Monastyrskaya, Berne (CH) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 663 Significant biomarker for lower urinary tract symptoms or pain from chronic prostatitis K. Shigemura, F. Yamamichi, M. Matsumoto, T. Shirakawa, H. Miyake, S. Arakawa, K. Tanaka, M. Fujisawa (Kobe, Japan) 664 Cytokine responses in BPS/IC type 3C Y. Logadottir, C. Lindholm, I. Gjertsson, M. Fall, D. Delbro, R. Peeker (Gothenburg, Örebro, Sweden) 665 Chronic pelvic pain syndrome in men is associated with reduction of relative gray matter volume in the anterior cingulate cortex compared to healthy controls L. Mordasini, C. Weisstanner, C. Rummel, G.N. Thalmann, R.K. Verma, R. Wiest, T.M. Kessler (Berne, Switzerland) 666 Therapeutic efficacy of narrow band imaging-assisted transurethral electrocoagulation for ulcer-type interstitial cystitis/painful bladder syndrome M. Kajiwara, S. Inoue, K. Kobayashi, S. Ohara, J. Teishima, A. Matsubara (Hiroshima, Japan) 667 Laser ablation of leukoplakia of the bladder S.K. Al-Shukri, M.N. Slesarevskaya, A.V. Zharkikh, A. Sokolov (St. Petersburg, Russia) 668 Posterior tibial nerve stimulation (PTNS) for treatment of non-neurogenic detrusor overactivity and chronic pelvic pain M. Aggamy, M.A. Gomha, A. Aldayel, R. Almousa, A. Abdelbary, A. Masoud (Dammam, Saudi Arabia; Benisuef, Egypt) Sunday 669 Ulcerative and non-ulcerative forms of BPS/IC have a similar response to trigonal onabotulinum toxin A injection R.M. Correia De Almeida Pinto, T. Antunes Lopes, J. Alturas Silva, C. Martins Silva, P. Dinis, F. Cruz (Porto, Portugal) 670 The efficacy and safety of a multimodal therapy for chronic prostatitis/chronic pelvic pain: A prospective randomized study A. Giannantoni, S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, M. Porena (Perugia, Rozzano, Italy) 671 Efficacy of Canephron N against bacterial adhesion, inflammation and bladder hyperactivity G. Künstle, C. Brenneis, J. Haunschild (Neumarkt, Germany) * 672 Urinary brain-derived neurotrophic factor (BDNF) level does not correlate with detrusor overactivity A. Bhide, V. Gopalan, R. Cartwright, A. Digesu, F. Puccini, C. De Nunzio, A. Tubaro, V. Khullar (London, United Kingdom; Rome, Italy) EAU Milan

228 * 673 Urinary levels of neurotrophins differ between women with stress urinary incontinence and women with urgency urinary incontinence T. Antunes Lopes, R. Pinto, S. Carvalho-Barros, C.M. Silva, C.D. Cruz, F. Cruz (Porto, Portugal) Discussion on posters 672 & 673 A. Giannantoni, Perugia (IT) Sunday 228 Programme Book

229 Sunday, 17 March - EAU Programme Abstract Session Androgen deprivation therapy, still to improve.. Yellow Hall Level N1 Poster Session 56 Chairs: F. Calais Da Silva Junior, Lisbon (PT) L.N. Türkeri, Istanbul (TR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 674 Enzalutamide monotherapy: Results from a phase 2 study in hormone naive prostate cancer patients B. Tombal, M. Borre, P. Rathenborg, P. Werbrouck, A. Heidenreich, P. Iversen, E. Baskin-Bey, F. Perabo, D. Phung, M.R. Smith (Brussel, Kortrijk, Belgium; Skejby, Herlev, Copenhagen, Denmark; North-Rhine Westphalia, Germany; Staines, United Kingdom; Northbrook, Boston, United States of America; Leiderdorp, The Netherlands) * 675 Survival and metastases among non-metastatic prostate cancer patients treated with androgen deprivation therapy (ADT) in Denmark, M. Nguyen-Nielsen, M.L. Maegbaek, R.K. Hernandez, H.T. Sørensen, V. Ehrenstein, A. Liede (Århus, Denmark; Thousand Oaks, South San Francisco, United States of America) 676 Polymorphisms of androgen transporting gene SLCO2B1 may participate in hormone-resistance and ethnic difference in response to androgen deprivation therapy N. Fujimoto, T. Kubo, H. Bui, T. Yoshida, T. Matsumoto (Kitakyushu, Japan) 677 Lower risk of cardiovascular (CV) events and death in men receiving ADT by gonadotropin releasing hormone (GnRH) antagonist, degarelix, compared with luteinising hormone-releasing (LHRH) agonists B. Tombal, P. Albertsen, A. De La Taille, E. Van Der Meulen, B-E. Persson, T.K. Olesen, J. Nilsson (Brussels, Belgium; Farmington, United States of America; Paris, France; Copenhagen, Denmark; St Prex, Switzerland; Lund, Sweden) 678 Disease control-related outcomes from an analysis of six comparative randomised clinical trials of degarelix versus luteinising hormone-releasing hormone (LHRH) agonists K. Miller, E.D. Crawford, N. Shore, C. Karup, E. Van Der Meulen, B-E. Persson (Berlin, Germany; Aurora, Myrtle Beach, United States of America; Copenhagen, Denmark; St Prex, Switzerland) Sunday 679 PSA patterns during off-time treatment period in patients undergoing intermittent androgen deprivation. Is PSA doubling time reliable in every case? R.E. Sanchez Salas, D. Prapotnich, F. Olivier, M. Fhima, P. Descamps, S. David, F. Secin, E. Barret, M. Galiano, F. Rozet, X. Cathelineau (Paris, France; Buenos Aires, Argentina) 680 Intermittent versus continuous cyproterone acetate in bone metastatic prostate cancer: Results of a randomized trial P.C.M.S. Verhagen, M.F. Wildhagen, A.M. Verkerk, W.A.B.M. Bolle, E. Vjaters, H. Pagi, L. Kukk, D. Bratus, R. Fiala, C.H. Bangma, F.H. Schröder, G.H. Mickisch (Rotterdam, The Netherlands; Riga, Latvia; Tallinn, Estonia; Maribor, Slovenia; Olomouc, Czech Republic; Bremen, Germany) 681 Correlation between information provided by urologists and messages understood by patients when starting androgen blockade for advanced prostate cancer T. Lebret, B. Duclos-Morlaes, D. Comet, S. Droupy (Suresnes, Levallois-Perret, Nanterre, Nîmes, France) EAU Milan

230 682 When to start antiresorptive treatment in prostate cancer patients on androgen suppression D. Lorente Garcia, J. Planas, A. Celma, F. Agreda, C. Konstantinidis, I. Iztueta, J. Placer, J. Morote, G. Encabo (Barcelona, Spain) 683 Androgen deprivation therapy improve disease free survival in patients treated with salvage radiotherapy - a national Danish study M. Ervandian, M. Høyer, S. Elleberg Petersen, L. Sengeløv, S. Hansen, M. Holmberg, J. Svejstrup, P. Meidahl Petersen, M. Borre (Århus, Herlev, Odense, Aalborg, Copenhagen, Denmark) 684 Digoxin lowers the incidence of prostate cancer - a nationwide population-based study W.J. Huang, W.Y.H. Chang, W.C.P. Lin, A.T.L. Lin, K.K. Chen (Taipei, Taiwan) Summary on androgen deprivation therapy and its side effects L.N. Türkeri, Istanbul (TR) Sunday 230 Programme Book

231 Sunday, 17 March - Sponsored Sessions Workshop Overview Urinary incontinence - Optimising the patient experience and improving outcomes page 409 Amber Hall 6 - Level S2 Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division Symposia Overview Management of OAB: Electing the right candidate for the right patient page 410 euro Auditorium - Level S2 Sponsored by ASTELLAS Nocturia: Definitive diagnosis for better patient outcomes page 411 Yellow Hall Level N1 Sponsored by FERRING PHARMACEUTICALS Towards individualisation of prostate cancer treatments: From bench to bedside page 412 Brown Hall 3 - Level S2 Sponsored by IPSEN Clinical conundrums in the treatment of metastatic castration-resistant prostate cancer page 413 Silver Hall - Level N2 Sponsored by JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON Burden of illness and optimal management of recurrent cystitis page 414 Amber Hall Level S2 Sponsored by OM PHARMA SA BPH and inflammation, from lab to clinic page 415 Red Hall 1 - Level N1 Sponsored by PIERRE FABRE MEDICAMENT Silodosin: A first choice for the pharmacological treatment of BPH page 416 Brown Hall Level S2 Sponsored by RECORDATI Focal therapy in localised prostate cancer page 417 Amber Hall Level S2 Sponsored by STEBA BIOTECH Sunday EAU Milan

232

233 Monday, 18 March - EAU Programme Plenary Session Lower urinary tract management: How to balance benefits with side-effects euro Auditorium - Level S2 Chairs: P. Radziszewski, Warsaw (PL) M. Wirth, Dresden (DE) Highlight Session 2 Oncology A.S. Merseburger, Hanover (DE) Stone disease P. Chlosta, Wroclaw (PL) Andrology M. Fode, Herlev (DK) Introduction to the plenary session M. Wirth, Dresden (DE) Update Pelvic floor anatomy for urologists H. Fritsch, Innsbruck (AT) Aims and objectives It is common knowledge that the pelvis displays the most marked skeletal differences between males and females; hence, the anatomy of the male and female pelvic floor differs widely as to the striated muscles, the urinary organs, the striated sphincters and the subperitoneal connective tissue as well as topographical relationships. These differences will be pointed out thoroughly with regard to urinary continence Debate The role of urodynamic assessment in contemporary practice Moderator: M. Lucas, Swansea (GB) What do we mean by urodynamics? M. Lucas, Swansea (GB) Pro - Invasive urodynamics are essential in all patients undergoing surgical intervention P. Abrams, Bristol (GB) Con - Invasive urodynamics are essential in all patients undergoing surgical intervention S. Herschorn, Toronto (CA) Aims and objectives Urodynamic testing has become, over a period of 30 years, an accepted part of the workup of patients before surgery for either urinary incontinence or prostatic obstruction. The framework of thinking that they provide about bladder and urethral function underpins our understanding of the pathophysiology, and the way we plan treatment. However, recent statements and new trials have raised questions about the clinical utility of urodynamics. Are they essential? Are they worthless? - or can their use be rationalised according to the clinical problem? Monday EAU Milan

234 American Urological Association (AUA) Lecture Cellular-based therapy of urinary incontinence L. Rodriguez, Los Angeles (US) Aims and objectives The aim of the lecture is to provide an update on the scientific advances made to date in cellular and stem cell based therapies for the treatment of urinary incontinence. Available laboratory, pre-clinical and human data will be reviewed. The objectives of the lecture are: 1) To help understand the clinical problem of SUI, 2) To help familiarise the audience with the potential benefits and pitfalls of stem cell based therapies, 3) To provide an update on the current state of the art of cell based therapies for the treatment of urinary incontinence Case discussion Sling, sphincter or balloon for male urinary incontinence Moderator: Sphincter Balloon Sling J.W. Thüroff, Mainz (DE) K-D. Sievert, Tübingen (DE) E. Chartier-Kastler, Paris (FR) P. Rehder, Innsbruck (AT) Aims and objectives The case discussion panel on surgical treatment options for male sphincteric incontinence aims at providing detailed insight into mechanism of action of the different surgical strategies and their respective advantages and disadvantages. This will eventually translate into defining criteria and/or tests for securing the indications for each surgical technique and their respective limitations (contra-indications). Clinical examples are presented and the best possible solutions for the individual cases are discussed Debate What the practising urologist needs to know about new therapies for LUTS. When, where and how do they work? Moderator: C.R. Chapple, Sheffield (GB) Introduction to new therapies for lower urinary tract symptoms - setting the scene C.R. Chapple, Sheffield (GB) PDE5 inhibitors in the management of LUTS M. Oelke, Hanover (DE) Beta-3 agonist therapy C.R. Chapple, Sheffield (GB) Botulinum toxin therapy - which agent? T.M. Kessler, Zürich (CH) New avenues (neurotoxins and combination therapy) in treating the BPH patient M.J. Speakman, Taunton (GB) Monday Discussion on how these new approaches relate to contemporary therapy Aims and objectives To provide the practising clinician with a comprehensive update on what they need to know about the latest new therapies for LUTS. The participants will provide a detailed overview on how these therapies are thought to work and the evidence base relating to their use. These treatments will be discussed against the backdrop of existing therapy and a detailed discussion will be held as to:- the role of these therapies in the context of existing pharmacotherapy, will they replace it and if so in which patients how they are thought to exert their effect 234 Programme Book

235 what the potential is for combination therapy using existing agents and do these therapies add further possibilities Take home message A clear understanding on contemporary pharmacotherapy for both the male and female patient with LUTS and how to most effective treat them in State-of-the-art lecture Is TURP the gold standard for benign prostatic obstruction? M. Marberger, Vienna (AT) Monday EAU Milan

236 Monday, 18 March - EAU Programme Abstract Session Miscellaneous Brown Hall 3 - Level S2 Video Session 7 Chairs: P. Albers, Düsseldorf (DE) I. Eardley, Leeds (GB) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V49 V50 V51 V52 V53 V54 V55 V56 Laparoscopic living donor nephrectomy with the use of 3 mm instruments and laparoscope: Early experience at a tertiary center A. Breda, G. Lucarelli, O. Rodriguez-Faba, L. Gausa, J. Ponce De Leon, H. Villavicencio (Barcelona, Spain) Right-sided terminal hand assisted laparoscopic donor nephrectomy. The Halle experience G. Pini, N. Mohammed, F. Greco, A. Schumann, F. Kawan, L. Ascalone, K. Weigand, P. Fornara (Halle, Germany) Robotic microsurgical targeted denervation of the spermatic cord for chronic groin pain A. Gudeloglu, J. Brahmbhatt, K. Priola, S. Parekattil (Winter Haven, United States of America) Robotic assisted microsurgical vasectomy reversal J. Brahmbhatt, A. Gudeloglu, K. Priola, S. Parekattil (Winter Haven, United States of America) Laparoscopic resection of a large functional paraganglioma in the organ of Zuckerkandl (PZ) D. Veneziano, O. Sicuro, E. Sgrò, L. Carbone, P. Cozzupoli (Reggio Calabria, Italy) Modified surgical reconstructive technique in male-to-female gender reassignment minimizes postoperative risks and improves final outcome B. Amend, J. Seibold, A. Stenzl, K-D. Sievert (Tübingen, Germany) Use of bowel for savage vaginoplasty in male to female transsexual C. Trombetta, C. Imbimbo, G. Liguori, P. Verze, N. Pavan, V. Mirone (Trieste, Naples, Italy) Corpora cavernosa reconstruction with porcine dermal matrix graft and inflatable penile prosthesis implant in a case of massive, post-infective penile fibrosis F. Colombo, G. Gentile, R. Djinovic, A. Franceschelli (Bologna, Italy; Belgrade, Serbia) Monday 236 Programme Book

237 Monday, 18 March - EAU Programme Abstract Session Management of high risk prostate cancer Brown Hall Level S2 Poster Session 57 Chairs: M. Ramirez Backhaus, Valencia (ES) T. Wiegel, Ulm (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 685 Risk-factors for biochemical recurrence- and clinical metastasis-free survival in D Amico high-risk patients after radical prostatectomy A. Becker, P. Tennstedt, T. Steuber, M. Graefen, H. Heinzer (Hamburg, Germany) * 686 Association between time to biochemical recurrence and cancer specific and other cause mortality in men with high risk prostate cancer treated with radical prostatectomy without adjuvant treatments. A multiinstitutional analysis M. Bianchi, J.R. Karnes, S. Joniau, M. Spahn, P. Gontero, F.K. Chun, J. Hansen, G. Marchioro, F. Abdollah, B. Tombal, U. Capitanio, P. Bastian, H. Van Der Poel, R. Sanchez-Salas, A. Briganti (Milan, Turin, Novara, Italy; Rochester, United States of America; Leuven, Brussels, Belgium; Berne, Switzerland; Hamburg, Munich, Germany; Amsterdam, The Netherlands; Paris, France) 687 A competing-risks analysis of survival after alternative treatment modalities for locally advanced prostate cancer patients: A population-based study F. Abdollah, M. Bianchi, N.M. Passoni, A. Nini, P. Dell Oglio, S. Corti, R. Colombo, C. Cozzarini, R. Damiano, N. Di Muzio, M. Sun, A. Briganti (Milan, Catanzaro, Italy; Montreal, Canada) * 688 Predicting prostate cancer specific outcome after radical prostatectomy among men with (very) high-risk, locally advanced PCa with or without additional high risk factors: A multi-institutional retrospective cohort study of 1644 patients S. Joniau, A.R. Alberts, F. Moltzahn, A. Briganti, J. Karnes, P. Gontero, E. Weyne, C-Y. Hsu, G. Marchioro, B. Tombal, J. Chun, P. Bastian, H. Van Der Poel, R. Sanchez-Salas, M. Spahn (Leuven, Brussels, Belgium; Berne, Switzerland; Milan, Turin, Novara, Italy; Rochester, United States of America; Puli, Taiwan; Hamburg, Munich, Germany; Amsterdam, The Netherlands; Paris, France) 689 Impact of surgery delay in patients diagnosed with high grade prostate cancer S. Samavedi, H. Abdul-Muhsin, O. Schatloff, K. Palmer, G. Ebra, V. Patel (Celebration, United States of America) 690 Can immediate adjuvant therapy be avoided in patients with prostate specimen Gleason 8, organ confined disease, absence of positive lymph nodes and surgical margins, who undergo robot-assisted laparoscopic radical prostatectomy? A.P. Labanaris, V. Zugor, J.H. Witt (Gronau, Germany) Monday 691 Comparison of the survival rate between prostate cancer patients with Gleason score 8 and those with score 9 or higher for different therapeutic approaches H.K. Ha, J.Y. Ku, J.H. Ahn, S.M. Kang, C.H. Lee, S.D. Kim, T.S. Kim, J.H. Yoon, M.K. Chung, D.S. Kim, J.M. Chung, J.Z. Lee (Busan, South Korea) 692 Radio-guided surgery: Our experience in sentinel lymph node removal in prostate cancer M. Grasso, S. Blanco, A.A.C. Grasso, G. Bovo, A. Crespi, M. Arosio (Monza, Milan, Italy) EAU Milan

238 693 External validation of the updated nomogram predicting lymph node invasion in patients with prostate cancer undergoing extended pelvic lymph node dissection M. Gacci, M. Lanciotti, R. Schiavina, L. Masieri, S. Serni, V. Vagnoni, F. Abdollah, M. Carini, G. Martorana, F. Montorsi (Florence, Bologna, Milan, Italy) 694 Prediction of long-term cancer recurrence after radical prostatectomy in patients with lymph node invasion: Results of conditional survival analysis F. Abdollah, A. Briganti, F. Castiglione, N. Suardi, C. Cozzarini, N. Di Muzio, R. Lucianò, G. Gandaglia, A. Nini, G. Zanni, M. Freschi, J. Karnes (Milan, Italy; Rochester, United States of America) 695 Impact of stage migration on node positive prostate cancer rate and features: A 20-year, single institution analysis in men treated with extended pelvic lymph node dissection N. Fossati, F. Abdollah, A. Gallina, U. Capitanio, N. Suardi, A. Salonia, L. Villa, M. Tutolo, E. Di Trapani, V. Di Girolamo, V. Scattoni, G. Guazzoni, P. Rigatti, A. Briganti (Milan, Italy) year German experience of cryoablation for primary high risk localized prostate cancer using 17 gauge cryoneedles technology U. Witzsch, W. Dillenburg, E. Becht (Frankfurt am Main, Germany) Monday 238 Programme Book

239 Monday, 18 March - EAU Programme Abstract Session Urothelial cancer treatment: Intravesical approaches Brown Hall 3 - Level S2 Poster Session 58 Chairs: A. Noon, Sheffield (GB) M. Rouprêt, Paris (FR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 697 Prognostic factors and risk groups in T1G3 patients initially treated with BCG: Results of a multicenter retrospective series in 1743 patients P. Gontero, R. Sylvester, F. Pisano, S. Joniau, K. Van Der Eeckt, V. Serretta, S. Larré, S. Di Stasi, B. Van Rhijn, A. Witjes, A. Grotenhuis, R. Colombo, A. Briganti, M. Babjuk, V. Soukup, P.U. Malmstrom, J. Irani, N. Malats, J. Baniel, R. Mano, T. Cai, E. Cha, P. Ardelt, J. Varkarakis, R. Bartoletti, M. Spahn, G. Dalbagni, S. Shariat, J. Karnes, J. Palou (Turin, Palermo, Rome, Milan, Trento, Florence, Italy; Brussels, Leuven, Belgium; Oxford, United Kingdom; Amsterdam, Nijmegen, The Netherlands; Prague, Czech Republic; Uppsala, Sweden; Poitiers, France; Madrid, Barcelona, Spain; Tel Aviv, Israel; New York, Rochester, United States of America; Freiburg, Würzburg, Germany; Athens, Greece) 698 Intravesical sequential BCG and electromotive mitomycin versus BCG alone for stage pt1 urothelial bladder cancer S.M. Di Stasi, C. Verri, E. Liberati, F. Masedu, M. Valenti (Rome, L Aquila, Italy) 699 A prospective comparative study of intravesical Bacillus Calmette-Guérin therapy for non-muscle invasive bladder cancer: Tokyo strain vs Connaught strain A. Sengiku, M. Ito, Y. Miyazaki, H. Sawazaki, T. Takahashi, K. Ogura (Otsu, Japan) 700 Results of a phase-1 dose escalation study of intravesical TMX-101 in patients with non-muscle invasive bladder cancer J. Falke, J.M. Lammers, H.C. Arentsen, M. Ravic, R. Pozzi, E.B. Cornel, H. Vergunst, T.M. De Reijke, J.A. Witjes (Nijmegen, Hengelo, Amsterdam, The Netherlands; London, United Kingdom; Bioggio, Switzerland) 701 Statin use is not associated with prognosis or BCG-response in patients with non-muscle invasive bladder cancer E.N. Xylinas, J.J Crivelli, L.A Kluth, N. Passoni, S. Holmang, P.I. Karakiewicz, E. Comploj, A. Pycha, Y. Lotan, M. Zerbib, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of America; Milan, Bolzano, Italy; Gothenburg, Sweden; Montreal, Canada; Paris, France) 702 Is there any influence on the real number of BCG instillations applied on the outcome of high-grade nonmuscle-invasive bladder cancer (NMIBC)? J.A. Portillo Martin, R. Madero, E. Solsona, J.M. Fernández, L. Martínez-Piñeiro, M. Montesino, M. Unda, A. Ojea, J. Rodríguez, J. Palou, J.A. Martínez-Piñeiro (Santander, Madrid, Valencia, Oviedo, Pamplona, Bilbao, Vigo, Barcelona, Spain) Monday 703 Flow cytometry based immunoassay to monitor the BCG-therapy of the non muscle invasive bladder cancer J. Elsaesser, M. Janssen, F. Becker, H. Suttmann, C-H. Ohlmann, U. Sester, M. Stöckle, M. Sester (Homburg, Neunkirchen, Hamburg, Germany) EAU Milan

240 704 Tumour recurrence and intravesical BCG significantly impact upon health related quality of life in patients undergoing conservative management for superficial bladder cancer N. Sapre, A. Wooten, H. Siddons, A.J. Costello, C.M. Hovens, N.M. Corcoran, P. Anderson (Melbourne, Australia) 705 BCG induced bladder and systemic adverse events assessed by weekly self-administered questionnaire can predict SAEs and course interruption B. Tamarelle, A. Picard, N. Arfi, A. Pages, X. Martin, M. Colombel (Lyon, France) 706 Early vs delayed mitomycin C instillations after TUR in patients with non-muscle invasive bladder tumours: A prospective multicentre randomised trial T. Van Ginkel, J. Nieuwenhuijzen, R. Ter Haar, D. Newling, R.J.A. Van Moorselaar (Amsterdam, The Netherlands) 707 Organ preservation in high- and extreme high risk non-muscle-invasive bladder cancer (NMIBC): Outcome analysis of an interventional cohort study of the German Hyperthermia Chemotherapy Group in efficacy and side effects G.C. Lüdecke, L. Schäfer, W. Weidner, F. Hasner, H. Hanitzsch, M. Schmidt (Giessen, Munich, Bonn, Germany) * 708 Side effects of BCG in the treatment of intermediate and high risk Ta T1 papillary carcinoma of the bladder: Results from EORTC GU Cancers Group randomized study comparing 1/3 dose vs full dose during 1 or 3 years M. Brausi, J. Oddens, R. Sylvester, S. Colette, P. Gontero, A. Bono, L. Turkeri (Modena, Turin, Varese, Italy; Hertogenbosh, The Netherlands; Brussels, Belgium; Istanbul, Turkey) Discussion on poster 708 M. Rouprêt, Paris (FR) Monday 240 Programme Book

241 Monday, 18 March - EAU Programme Abstract Session Prostate cancer biopsies and pathology Amber Hall Level S2 Poster Session 59 Chairs: F. Gómez Veiga, A Coruna (ES) V. Scattoni, Milan (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 709 Bimanual examination of retrieved specimen during robot-assisted radical prostatectomy: A novel technique for reducing the positive surgical margin W. Jeong, A. Sood, S. Dusik, N.S. Gupta, C.G. Rogers, P. Dasgupta, J.O. Peabody, M. Menon (Detroit, United States of America; London, United Kingdom) 710 Repeated prostate biopsy: Evaluation of a new diagnostic pathway using mp-mri, PCA3 and pro-psa in the selection of patients F. Porpiglia, C. Fiori, M. Manfredi, F. Mele, R. Bertolo, S. Grande, F. Russo, D. Regge, E. Bollito, M. Papotti (Orbassano (Turin), Candiolo (Turin), Italy) 711 Detection of nodal micro-metastases with serial section, immunohistochemistry and real time polymerase chain reaction in intermediate and high risk prostate cancer patients submitted to radical prostatectomy with extended pelvic lymph node dissection: A perspective study R. Schiavina, E. Capizzi, G. Passaretti, D. Romagnoli, A. Bertaccini, E. Brunocilla, F. Manferrari, M. Garofalo, V. Vagnoni, G.C. Rocca, C.N. Bizzarri, F. Chessa, L. Bianchi, M. Borghesi, M. Fiorentino, G. Martorana (Bologna, Italy) 712 The novel complexity measures in the objective grading of prostate cancer P. Waliszewski, M. Tanase, F. Wagenlehner, S. Gattenloehner, W. Weidner (Giessen, Germany; Bucharest, Romania) 713 Presence of intraductal carcinoma of the prostate on needle biopsy can be a significant prognostic factor K. Masashi, K. Kyosuke, T. Toyonori, F. Yasuhito, F. Takashi, S. Naoto, M. Yoshihisa, Y. Yasushi, Y. Tokunori, G. Momokazu (Nagoya, Japan) 714 Spatial distribution of positive cores decreases misclassification rates of patients with low risk prostate cancer candidate for active surveillance E. Di Trapani, F. Castiglione, N.M. Passoni, U. Capitanio, A. Gallina, M. Tutolo, M. Bianchi, N. Finocchio, E. Farina, G. Gandaglia, L. Villa, N. Suardi, V. Mirone, F. Abdollah (Milan, Naples, Italy) * 715 Can transrectal needle biopsy be optimized to detect nearly all prostate cancer with volume 0.5 cc? A three-dimensional analysis K. Kanao, J.A. Eastham, P.T. Scardino, M. Sumitomo, V.E. Reuter, S.W. Fine (New York, United States of America; Nagakute, Japan) Monday 716 Biopsy Gleason score 6. How to predict final pathological specimen Gleason score? T. Seisen, F. Roudot Thoraval, P.O. Bosset, A. Campeggi, Y. Allory, D. Vordos, A. Hoznek, C-C. Abbou, A. De La Taille, L. Salomon (Creteil, France) EAU Milan

242 717 Transperineal MRI-targeted biopsy versus transperineal template prostate mapping biopsy in the detection of localised radio-recurrent prostate cancer A. Kanthabalan, M. Abl-Azzeez, M. Arya, A. Freeman, C. Allen, A. Kirkham, S. Punwani, M. Emberton, H. Ahmed (London, United Kingdom) 718 The impact of multiple biopsies on erectile and voiding function after radical prostatectomy: A populationbased assessment F. Roghmann, H. Lavigueur-Blouin, M. Meskawi, A. Becker, Z. Tian, J. Noldus, M. Sun (Montreal, Canada; Hamburg, Herne, Germany) 719 Evidence for a cell cycle proliferation field effect in prostate cancer F. Carvalho, W. Welbourn, J. Reid, E. Humphries, M. Han, J. Lanchbury, A. Gutin, S. Stone, D.M. Berman (Baltimore, Salt Lake City, United States of America; Kingston, Canada) 720 Low percentage ( 10%) of positive biopsy core (PBC) is not a predictor of lower risk for PSA recurrence in ct1c prostate cancer treated with radical prostatectomy in contemporary Japanese population S. Hatakeyama, T. Koie, T. Yoneyama, Y. Hashimoto, K. Mitsuzuka, S. Kawamura, S. Narita, N. Tsuchiya, T. Habuchi, Y. Arai, C. Ohyama (Hirosaki, Sendai, Akita, Japan) 721 The advantages of using 3D guidance for localizing prostate biopsies by endo-rectal route: Feasibility and preliminary results A. De Gorski, G.J. Wirth, C.E. Iselin (Geneva, Switzerland) Monday 242 Programme Book

243 Monday, 18 March - EAU Programme Abstract Session Update on SUI Amber Hall Level S2 Poster Session 60 Chairs: C. Gratzke, Munich (DE) D.A.O. Waltregny, Liège (BE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 722 The effect of aging on voiding function in women with stress-predominant urinary incontinence prior to surgical intervention P. Zimmern, H. Litman, G.E. Lemack, H. Richter, L. Sirls, S. Kraus (Dallas, Watertown, Birmingham, Royal Oak, San Antonio, United States of America) 723 Changes in urinary incontinence during postpartum and associated factors S.R. Chang, M.I. Lin, H.H. Lin, K.H. Chen, W.A. Lin (Taipei, Taichung, Taiwan) 724 A cost-effectiveness analysis of tension-free vaginal tape vs transobturator tape for female stress urinary incontinence M.A. Laudano, S. Seklehner, D. Xie, E.C. Osterberg, B. Chughtai, R.K. Lee (New York, United States of America) 725 Obesity is not associated with urodynamic stress incontinence F. Puccini, A. Tubaro, C. De Nunzio, A. Digesu, A. Bhide, C. Hendricken, R. Fernando, V. Khullar (Rome, Italy; London, United Kingdom) 726 TVT-O for the treatment of pure urodynamics stress incontinence in females: Efficacy and adverse events at 5 years follow-up M. Serati, R.M. Bauer, J.N.L. Cornu, E. Cattoni, A. Braga, G. Siesto, D. Lizée, F. Haab, M. Torella, S. Salvatore (Varese, Milan, Naples, Italy; Munich, Germany; Paris, France) 727 Affect outcomes of mid-urethral sling procedures for stress urinary Incontinence according to body mass index L.H. Sung, C.H. Noh, J.Y. Chung, J.H. Yu (Seoul, South Korea) 728 TOT approach in stress urinary incontinence (SUI) are there differences in obese females? F. Ludt, C. Frohme, P. Olbert, R. Hofmann, A. Hegele (Marburg, Germany) 729 Deterioration of continence after TOT when the follow-up is extended: Results from a randomised controlled study E. Costantini, M. Lazzeri, A. Zucchi, R. Bruno, E. Salvini, A. Pietropaolo, M. Del Zingaro, M. Porena (Perugia, Italy) 730 Urodynamic repercussions of the treatment of the female stress urinary incontinence by suburethral tapes S. Garcia Barreras, N. Garcia Garcia, M. Téllez Martínez Fornés, M. Cervero Jiménez, L. Fiter Gómez, C. Fernández Lucas (Leganés, Spain) Monday 731 Results of repeat midurethral sling for the treatment of recurrent female stress urinary incontinence T. Charles, Y. Sow, S. Christian (Strasbourg, France; Dakar, Senegal) EAU Milan

244 732 Can one global quality of life question simplify the overall outcome assessment after surgery for stress predominant urinary incontinence in women? C. Bacsu, A. Gomelsky, P. Zimmern (Dallas, Shreveport, United States of America) 733 Does the type of physiotherapy affect the quality of life and clinical outcomes in female urinary incontinence? A comparative study of two physiotherapy schemes E. Konstantinidou, M. Kalaitzi, K-V. Mytilekas, E-I. Ioannides, D. Hatzichristou, A. Apostolidis (Thessaloniki, Greece) 734 Long-term functional outcomes obtained after artificial urinary sphincter implantation in women with stress urinary incontinence: A single center experience S. Benadiba, V. Phé, M. Rouprêt, B. Granger, F. Richard, E. Chartier-Kastler (Paris, France) 735 Patients with urinary incontinence are more likely to develop upper urinary tract stone: A nation-wide population-based study with 8-year follow-up H.J. Chung, A.T.L. Lin, C.C. Lin, T.J. Chen, K.K. Chen (Taipei, Taiwan) Monday 244 Programme Book

245 Monday, 18 March - EAU Programme Abstract Session Current and new treatments of OAB and LUTS Silver Hall - Level N2 Poster Session 61 Chairs: M.J. Drake, Bristol (GB) H. Hashim, Bristol (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 736 The clustering of lower urinary tract syndrome. Is the overactive bladder a distinct clinical syndrome? P.O. Pal, B.H. Maraj, M. Ghei, J. Malone-Lee (London, United Kingdom) 737 Developing a psychometrically validated urinary diary E. Bright, N. Cotterill, M. Drake, P. Abrams (Bristol, United Kingdom) * 738 Urinary retention following anticholinergics in patients with BPH, do comorbidities matter? A nationwide population-based study E.Y-H Huang, C-C. Lin, H-J. Chung, J-P. Lin, A.T. Lin, K-K. Chen (Taipei, Taiwan) 739 Cardiovascular (CV) assessments in short- and long-term Phase 3 mirabegron trials in patients with overactive bladder (OAB) S. Herschorn, P. Kowey, V. Nitti, I. Milsom, S.M. Auerbach, M.B. Blauwet, C. Dorrepaal, M. Weber, J.S. Borer, W. Fitzsimmons, N. Martin (Toronto, Canada; Wynnewood, New York, Newport Beach, Northbrook, United States of America; Gothenburg, Sweden; Leiderdorp, The Netherlands) 740 A randomised controlled trial of fesoterodine in subjects with overactive bladder and suboptimal response to tolterodine extended release: Results from the AFTER study L. Cardozo, S. Kaplan, S. Herschorn, L. Grenabo, M. Carlsson, D. Arumi, T.J. Crook, L. Whelan, F. Ntanios (London, Walton Oaks, United Kingdom; New York, United States of America; Toronto, Canada; Gothenburg, Sweden; Madrid, Spain) 741 Pivotal phase 3 study in overactive bladder (OAB) patients with urinary incontinence confirms onabotulinumtoxina 100U significantly improves all OAB symptoms and patients quality of life C. Chapple, K-D. Sievert, S. MacDiarmid, V. Khullar, P. Radziszewski, C. Nardo, C. Thompson, J. Zhou, C. Haag-Molkenteller (Sheffield, London, Marlow, United Kingdom; Tübingen, Germany; Greensboro, Irvine, United States of America; Warsaw, Poland) 742 A prospective randomized comparative study of first-line tolterodine and doxazosin monotherapy for men with predominant storage symptoms C.H. Liao, H-C. Kuo (New Taipei City, Hualien, Taiwan) 743 Prevalence and management of overactive bladder patients in the French general population in 2012 P. Grise, G. Amarenco, A. Bellessort, F. Bruyère, E. Chartier-Kastler, B. Fatton, F. Haab, A. Serikoff (Rouen, Paris, Levallois-Perret, Tours, Nimes, France) Monday 744 OnabotulinumtoxinA 100U demonstrates similar treatment effect in overactive bladder patients with urinary incontinence regardless of number of prior anticholinergics taken or reason for their inadequate management of patients overactive bladder C. Chapple, K-D. Sievert, S. Herschorn, C. Thompson, C. Nardo, J. Zhou, C. Haag-Molkenteller, V. Nitti (Sheffield, Marlow, United Kingdom; Tübingen, Germany; Toronto, Canada; Irvine, New York, United States of America) EAU Milan

246 745 Withdrawn 746 Is there concordance between clinical overactive bladder and detrusor overactivity in male with storage symptoms? M. Esteban, D. Castro-Diaz, J. Salinas, S. Arlandis, A. Franco, M.A. Jiménez, L. Prieto, C. Gutierrez, (Toledo, Santa Cruz de Tenerife, Madrid, Valencia, Barcelona, Alicante, Spain) 747 Contribution of sleep disorders to nocturia-specific QOL (N-QOL) and the efficacy of treatment with anticholinergic drug in overactive bladder patients with nocturia M. Yoshida, M. Takeda, S. Takahashi, O. Nishizawa, M. Gotoh, N. Masumori (Obu, Aichi, Kofu, Tokyo, Matsumoto, Nagoya, Sapporo, Japan) Summary H. Hashim, Bristol (GB) Monday 246 Programme Book

247 Monday, 18 March - EAU Programme Abstract Session Urothelial cancer treatment: Predicting outcomes Red Hall 1 - Level N1 Poster Session 62 Chairs: S.F. Shariat, New York (US) R. Sosnowski, Warsaw (PL) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 748 Clinical impact of grade on both recurrence and progression in T1 bladder cancer: Comparison between WHO 1973 and WHO 2004 histological classification F. Pellucchi, L. Rocchini, C. Maccagnano, G. Zanni, G. La Croce, M. Moschini, M. Bianchi, P. Rigatti, R. Colombo (Milan, Italy) 749 Clinical outcome in patients with T1 micropapillary carcinoma of the bladder M. Spaliviero, G. Dalbagni, B.H. Bochner, B.Y. Poon, T.F. Donahue, H.A. Al-Ahmadie, J.M. Taylor, J.J. Meeks, D.D. Sjoberg, S.M. Donat, H.W. Herr (New York, United States of America) 750 Leucocyte infiltration is a prognostic factor in bladder cancer stage T1 O. Patschan, P.O. Bendahl, G. Chebil, H. Engilbertsson, S. Gudjonsson, P. Kollberg, F. Liedberg (Malmö, Lund, Helsingborg, Sweden) 751 T1 urinary bladder cancer - long time observation population-based material S. Jahnson, S. Holmang, F. Liedberg, B Ljungberg, A. Hosseini-Aliabad (Linköping, Gothenburg, Malmö, Umeå, Stockholm, Sweden) 752 Female gender is associated with higher risk of disease recurrence in patients with primary T1 high grade urothelial carcinoma of the bladder L.A. Kluth, E. Xylinas, J.J. Crivelli, H. Fajkovic, N. Passoni, M. Rouprêt, A. Becker, E. Comploj, A. Pycha, S. Holmang, A. Gupta, Y. Lotan, P.I. Karakiewicz, P. Gontero, F.K.H. Chun, M. Fisch, D.S. Scherr, S. Shariat (New York, Iowa City, Dallas, United States of America; St.Poelten, Austria; Milan, Bolzano, Turin, Italy; Paris, France; Montreal, Canada; Gothenburg, Sweden; Hamburg, Germany) 753 Oncological outcome of radical cystectomy for BCG failure compared to primary invasive disease A. Masson-Lecomte, D. Vordos, R. Yiou, Y. Allory, C.C. Abbou, A. De La Taille, L. Salomon (Creteil, France) 754 Accuracy of the EORTC risk tables and of the CUETO scoring model to predict outcomes in non muscleinvasive urothelial carcinoma of the bladder E.N. Xylinas, M. Kent, L.A. Kluth, D. Sjoberg, A. Pycha, E. Comploj, Y. Lotan, R.S. Svatek, Q.D. Trinh, P.I. Karakiewicz, S. Holmang, D.S. Scherr, M. Zerbib, S.F. Shariat (New York, Dallas, United States of America; Bolzano, Italy; Montreal, Canada; Gothenburg, Sweden; Paris, France) 755 Prediction of recurrence probabilities after intravesical treatment in patients with non-muscle-invasive bladder cancer R.J.M. Lammers, J.C.M. Hendriks, J. Palou, W.P.J. Witjes, J.A. Witjes (Nijmegen, Arnhem, The Netherlands; Barcelona, Spain) Monday 756 Prediction of progression in patients with non-muscle invasive bladder cancer based on histologic grade, T stage, recurrence rate and bladder neck involvement: The BN-GTR model Y. Fujii, S. Kobayashi, F. Koga, M. Yokoyama, S. Yoshida, J. Ishioka, Y. Matsuoka, N. Numao, K. Saito, H. Masuda, K. Kihara (Tokyo, Japan) EAU Milan

248 757 An active surveillance program in recurrent non muscle-invasive bladder tumor. Oncological safety and predictive factors to remain under surveillance V. Hernández, E. De La Peña, C. Blázquez, E. Pérez, F.J. Díaz, C. Llorente (Alcorcón (Madrid), Spain) 758 Association of cytotoxic T-lymphocyte antigen-4 gene polymorphisms with increased likelihood of recurrence in non-muscle invasive bladder cancer E. Chiong, A. Wong, N. Kesavan, Y.H. Chan, K. Esuvaranathan, R. Mahendran (Singapore, Singapore) 759 Prognostic value of sex-hormone receptors expression in bladder tumor J.K. Nam, S.W. Park, M.K. Chung (Yangsan, South Korea) 760 Retrospective study of the upper urinary tract urothelial carcinoma (UUT-UC) Spanish Collaborative Group alerts endocavitary BCG/MMC instillations, in unsuitable patients, could be deleterious in terms of survival F. Ramon De Fata, R. Cansino, J. Palou, J.H. Amón, V. Chantada, F.J. Burgos, C. Rioja, A. Serrano, L. Fariña, M. Cosentino, J.C. Angulo (Madrid, Barcelona, Valladolid, La Coruña, Zaragoza, Guadalajara, Vigo, Spain) Summary S.F. Shariat, New York (US) Monday 248 Programme Book

249 Monday, 18 March - EAU Programme Abstract Session Renal tumours: Basic research on pathogenesis Red Hall 2 - Level N1 Poster Session 63 Chairs: F. Jankevicius, Vilnius (LT) K. Junker, Jena (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 761 Establishing primary renal cancer cell cultures in vitro linked to a corresponding orthotopic in vivo model M. Saar, H. Zhao, A. Thong, A. Ingels, M. Valta, S.R. Young, R. Nolley, D.M. Peehl (Homburg/Saar, Germany) 762 Dietary selenium and lower risk of developing renal cancer a prospective cohort study using food diaries in EPIC Norfolk B.J.R. Barrass, M.A. Rochester, R. Pillai, R. Luben, K.T. Khaw, A.R. Hart (Norwich, Cambridge, United Kingdom) 763 Renal cell cancer in young adults: Prevalence, characteristics, and impact of Xp11.2/TFE3 translocation carcinoma diagnosis L. Donon, M. Yacoub, G. Robert, C. Deminière, G. Pasticier, J-M. Ferrière, P. Ballanger, J-C. Bernhard (Bordeaux, France) 764 Integrative analysis of clear cell renal cell carcinoma Y. Sato, S. Maekawa, Y. Okuno, Y. Shiraishi, A. Sato, G. Nagae, T. Shimamura, Y. Nagata, K. Yoshida, M. Sanada, H. Kume, H. Aburatani, S. Sugano, S. Ogawa, Y. Homma (Tokyo, Japan) 765 The important role of glycine N-methyltransferase (GNMT) in the proliferation of renal cell carcinoma Y. Song, M. Shiota, A. Yokomizo, K. Tatsugami, K. Kuroiwa, S. Naito (Fukuoka, Japan) 766 Proteomic intra-tumoural heterogeneity and differential expression between primary and metastatic renal cancer tissue A. Laird, F.C. O Mahony, L. Eory, J. Nanda, A.C.P. Riddick, M. O Donnell, R.R. Meehan, G.D. Stewart, D.J. Harrison (Edinburgh, St Andrews, United Kingdom) 767 Identification of antigenic peptides from novel renal cancer stem cell antigen, DNAJB8 N. Satoshi, Y. Hirohashi, T. Torigoe, H. Kusumoto, K. Kikkawa, Y. Kodama, M. Ko, N. Matsumura, Y. Kohjimoto, N. Sato, I. Hara (Wakayama, Sapporo, Japan) 768 Gene expression profile changes in response to overexpression or silencing of the hhavcr-1/kim-1 gene in the 769-p and 786-o ccrcc cell lines E. Trilla, D. Lorente, M.A. López-Pacios, T. Cuadros, M. Vilà, I. De Torres, J. Vilardell, N. Ben Messaoud, M. Salcedo, E. Sarró, J. López-Hellin, S. Ramón Y Cajal, E. Itarte, A. Meseguer, J. Morote (Barcelona, Spain) 769 Cancer stem cell characteristics may be correlated to the renal cell carcinoma intratumoral heterogeneity S. Bombelli, M.A. Zipeto, C. Bianchi, B. Torsello, V. Di Stefano, P. Viganò, G. Bovo, G. Cattoretti, G. Strada, R. Perego (Monza, Milan, Italy) Monday 770 CD39 is highly involved in mediating the suppression activity of tumor infiltrating CD8 + T regulatory lymphocytes in renal and bladder cancer P. Traverso, A. Parodi, F. Battaglia, F. Ferrera, S. Tardito, S. Stringara, G. Conteduca, S. Negrini, A. Simonato, D. Fenoglio, G. Carmignani, G. Filaci (Genoa, Italy) EAU Milan

250 771 Regulatory T cells in clinically localized renal cell carcinoma: Comparison with an age-matched healthy control I.G. Jeong, J.H. Yoon, K.H. Kim, D. You, S. Park, J.H. Hong, H. Ahn, C-S. Kim (Seoul, Ulsan, South Korea) 772 The functional significance and cancer pathways of EMT-related microrna-200-family in renal cell carcinoma H. Yoshino, N. Seki, H. Hidaka, T. Yamasaki, H. Enokida, M. Nakagawa (Kagoshima, Chiba, Japan) 773 Analysis of molecular profiling of renal cell carcinoma (RCC). Identification of a 4-microRNA signature as a prognostic value in patients with stage I-II L. Diez Sicilia, F. Villacampa Aubá, B. García Gómez, J. Medina Polo, M. Dominguez Esteban, A. Tejido Sánchez, G. De Velasco, F. De La Rosa Kehrmann, D. Castellano, R. Díaz González (Madrid, Spain) 774 Analysis of site specific mirna expression in distant metastases of clear cell renal cell carcinoma J. Heinzelmann, S. Baumgart, U. Wickmann, A. Szendroi, A. Unrein, M.R. Gajda, M-O. Grimm, M. Stöckle, K. Junker (Homburg/Saar, Jena, Germany; Budapest, Hungary) Monday 250 Programme Book

251 Monday, 18 March - EAU Programme Abstract Session OAB in women Blue Hall Level N1 Poster Session 64 Chairs: P. Dinis Oliveira, Porto (PT) T. Hanus, Prague (CZ) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 775 Sacral Nerve Stimulation (SNS) for the treatment of idiopathic refractory overactive bladder: Costeffectiveness compared to optimal medical therapy, botulinum toxin A (BoNT-A) and percutaneous tibial nerve stimulation (PTNS) J. Jenks, R. Hamid, P.J.R. Shah, T.J. Greenwell, C. Betts, S. Walleser, N. Hallas, J.L. Ockrim (London, Salford, United Kingdom; Tolochenaz, Switzerland) 776 Tined lead versus percutaneous nerve evaluation for sacral nerve stimulator assessment J. Jenks, R. Hamid, P.J.R. Shah, T.J. Greenwell, J.L. Ockrim (London, United Kingdom) 777 Affect on bowel symptoms in patients having sacral neuromodulation for detrusor overactivity A. Gulamhusein, J. Fielding, R. Simmons, S.V. Reid (Sheffield, United Kingdom) 778 Transcutaneous posterior tibial nerve stimulation: Evaluation of therapeutic option in overactive bladder syndrom M. Ammi, P. Bigot, D. Chautard, S. Larre, T. Culty, C. Pinon, A. Azzouzi (Angers, France) 779 Objective efficacy of mirabegron on storage and voiding function in patients with overactive bladder, based on a urodynamic study Y. Matsukawa, Y. Funahashi, S. Takai, Y. Yoshino, T. Yamamoto, M. Gotoh (Nagoya, Japan) * 780 Overactive bladder syndrome in elderly: Is there a place for detrusor Botox injections? V.M. Keppenne, D. Waltregny, S. Sanjurjo (Liege, Belgium) 781 Discontinuation rates and inter-injection interval for repeated intravesical botulinum toxin type A injections in detrusor overactivity R. Veeratterapillay, C. Harding, N. Vasdev, L. Teo, A. Abroaf, R. Pickard, T. Dorkin, T. Hasan, A. Thorpe (Newcastle upon Tyne, United Kingdom) 782 The effect of solifenacin on bladder wall thickness in women with overactive bladder and detrusor overactivity: Results from the SHRINK study D. Robinson, M. Oelke, R. Tretter, B. Stow, G. Compion, A. Tubaro (London, Chertsey, United Kingdom; Hanover, Germany; Leiderdorp, The Netherlands; Rome, Italy) 783 Single surgeon experience of clam ileocystoplasty for refractory idiopathic detrusor overactivity S. Pisipati, F. Khan, R.B. Kinder (Cheltenham, United Kingdom) Monday 784 The characteristics and prognosis for impaired detrusor contractility in non-geriatric patients C-W. Yang, Y-H. Fan, C-C. Lin, J.S. Huang, T.L. Ling, K-K. Chen (Taipei, Taiwan) EAU Milan

252 785 A multi-centre randomized controlled study comparing surgical and pharmacological therapy to treat mixed urinary incontinence R. Caremel, L.M. Tu, K. Baker, O. El Yazami Adli, O. Loutochin, J. Corcos (Montreal, Sherbrooke, Ottawa, Canada) 786 The surgical outcomes of transobturator tape in patients with stress urinary incontinence concomitant with overactive bladder C. Yoo, H.Y. Choi, J.S. Cho, S.H. Lee, J.W. Hwang, C.Y. Oh, J.H. Han, Y.G. Lee (Anyang-Si, Guri, South Korea) Monday 252 Programme Book

253 Monday, 18 March - EAU Programme Abstract Session Urethral stricture management Yellow Hall Level N1 Poster Session 65 Chairs: S.J. Hosseini, Tehran (IR) C. Llorente, Madrid (ES) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 787 Value of MRI in diagnostic study in patients with urethral stricture: Impact on subsequent surgery M.I. Kogan, E.L. Banchik, V.I. Dombrovsky, V. Mitusov (Rostov on Don, Russia) 788 Urethral ultrasound versus magnetic resonance urethrography versus retrograde urethrography in the evaluation of anterior urethral stricture: A prospective study M.A.A. Abdullah (Assiut, Egypt) 789 Withdrawn 790 Stricture recurrence after the urethroplasty with buccal mucosal graft: What next? A. Pandey, C. Raita, J. Beier, H. Keller (Hof, Germany) 791 Seeding a biodegradable collagen cell carrier and its use for urethroplasty in a urethral stricture minipig model L. Lisa, M. Vaegler, S. Maurer, K-D. Sievert (Tübingen, Germany) 792 Histological evidence of balanitis xerotica obliterans (BXO) complicating cases of failed hypospadias repair M. Selim, E. Elsherif, S. Yones, M. Sultan (Shibin Elkom, Egypt) 793 Management of pananterior urethral strictures due to LS/BXO by single stage dorsal buccal onlay urethroplasty A. El-Kassaby, E.A. Eltahawy (Cairo, Little Rock, Egypt) 794 Relationship between development of urethral stricture after transurethral resection of prostate and glycemic control S. Kumsar, H.S. Saglam, O. Köse, S. Budak, O. Adsan (Sakarya, Turkey) 795 The two-staged urethral and penile reconstruction using vasularised scrotal flap and buccal mucosal graft A. Pandey, C. Raita, J. Beier, H. Keller (Hof, Germany) 796 Time and stages survival of oral mucosa grafts on 3 different feeding beds - an experimental model in rats S.V. Kotov, S.V. Belomyttcev, E.I. Veliev, O.B. Loran (Moscow, Russia) 797 Comparison of urethroplasty results using oral mucosa graft and tunica vaginalis flap in anterior urethral stricture M.I. Kogan, V.V. Mitusov, A.V. Shangichev, R.E. Ametov, S.V. Naranov (Rostov on Don, Russia) Monday 798 Contemporary urethral stricture characteristics in the developed world E. Palminteri, E. Berdondini, C. De Nunzio, S. Maruccia, G. Bozzini, L. Carmignani, G. Barbanti (Arezzo, Rome, Milan, Siena, Italy) Summary C. Llorente, Madrid (ES) EAU Milan

254 Monday, 18 March - EAU Programme Special Session da Vinci Robotic Surgery Platinum Hall - Level S Live surgery: da Vinci prostatectomy - The Martini Klinik Technique Operator: Moderators: A. Haese, Hamburg (DE) M. Graefen, Hamburg (DE) P. Wiklund, Stockholm (SE) Live surgery: da Vinci prostatectomy - Early neurovascular bundles release Operator: Moderators: A. Cestari, Milan (IT) C.M. Annerstedt, Herlev (DK) W. Artibani, Verona (IT) Monday Sponsored by INTUITIVE SURGICAL 254 Programme Book

255 Monday, 18 March - EAU Programme Thematic Session Expert challenges the expert Yellow Hall Level N1 Chair: A. De La Taille, Creteil (FR) Case presentation How I do a nerve-sparing cystectomy G.N. Thalmann, Berne (CH) Challenger: R.E. Sanchez Salas, Paris (FR) Case presentation How I do a laparoscopic partial nephrectomy I.S. Gill, Los Angeles (US) Aims and objectives My lecture will present the technical nuances and details of laparoscopic and robotic partial nephrectomy. The techniques presented will include all 3 types of partial nephrectomy: Conventional-clamping, earlyunclamping and zero-ischemia techniques. Challenger: A. Mottrie, Aalst (BE) Aims and objectives Robot-assisted partial nephrectomy is today a standardised technique offering precise resection of the tumour and quick reconstruction of the defect. This is done under warm ischemia clamping the main renal artery and wherever possible clamping of a secundary or tertiary branch. Bleeding is so minor and vision superior. After inner renorrhaphy closure, early unclamping can be performed allowing warm ischemia times to be low without significant clinical consequences for the renal function Monday EAU Milan

256 Monday, 18 March - EAU Programme Andrology Thematic Session 10 euro Auditorium - Level S2 Chair: J.O.R. Sonksen, Herlev (DK) State-of-the-art lecture Modern management of ejaculatory disorders A. Salonia, Milan (IT) Aims and objectives Despite copious findings on the physiology of ejaculation, as well as on the pathophysiology of Premature Ejaculation (PE), treatment of early ejaculation is still not well-outlined, with only a minor proportion of patients complaining of primary PE being actively treated. These discrepancies may be considered as the unfortunate result of a combination of several factors: 1) PE per se is often underdiagnosed in clinical practice; 2) Urologists do not follow the guidelines for the treatment of PE in their everyday clinical practice; 3) The lack of a widely recognised gold standard treatment, as well as the presence of a number of potential side effects which characterise almost all the compounds available for PE. In this context, off-label daily dosing of paroxetine, sertraline, citalopram, fluoxetine, or clomipramine are regarded as first line treatments for PE worldwide. Recently, dapoxetine hydrochloride - a short-acting SSRI with a pharmacokinetic profile favourable for on-demand treatment of PE has been launched on the market as the first on-demand and on-label treatment for PE State-of-the-art lecture Current treatment possibilities for erectile dysfunction I. Eardley, Leeds (GB) Aims and objectives This lecture will discuss new treatment options for a man with erectile dysfunction and will critically evaluate the evidence for these therapies. The discussion will include both medical and physical therapies State-of-the-art lecture Developments in the diagnosis and therapy of priapism A. Muneer, London (GB) Monday Aims and objectives This session will aim to highlight the recent developments in diagnostic imaging and surgical interventions for the three sub-types of priapism; ischaemic, non-ischaemic and stuttering. Both clinical studies and in vitro studies have helped to formulate novel theories in order to explain the development of priapism and suggest effective management strategies. For a long time, the management of priapism has been based on anecdotal reports and therefore therapeutic guidelines vary globally. The use of both in vivo and in vitro models of priapism have now helped our understanding of the pathophysiology of this condition and helped develop alternative therapeutic interventions, particularly in the area of refractory ischaemic priapism and stuttering priapism. By understanding the fundamental changes at a molecular level, clinicians will be able to develop an evidence based treatment algorithm for difficult cases Abstract presentations: Special selection from the poster sessions 324 Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile function in a rat model of Peyronie s disease F. Castiglione, P. Hedlund, F. Van Der Aa, T.J. Bivalacqua, M. Albersen (Milan, Italy; Leuven, Belgium; Baltimore, United States of America) 256 Programme Book

257 325 Repair of erectile dysfunction using transplantation of human mesenchymal stem cells cultivated on the surface of nanofibrous meshes in rats with cavernous nerve injury Y.S. Song, H.J. Lee, J. An, J.H. Yun, J.H. Kim, S.W. Doo, W.J. Yang, S.U. Kim (Seoul, South Korea) Monday EAU Milan

258 Monday, 18 March - EAU Programme Thematic Session Systemic therapy in urological cancers Silver Hall - Level N2 Chair: M. De Santis, Vienna (AT) State-of-the-art lecture Risk stratification integrating clinical and genomic data A. Bjartell, Malmö (SE) Aims and objectives There is an urgent need for improved selection of patient for new therapies such as inhibition of androgen signaling and angiogenesis, and for immunotherapy. Prediction models for risk stratification of recurrence after treatment for different malignancies have become increasingly popular. Nomograms developed at Memorial Sloan-Kettering Cancer Center, MSKCC ( and other prediction models are frequently used today. Despite numerous publications on promising biomakers, multiplex signatures and gene panels, only PSA in blood is routinely incorporated in prediction models. This lecture will focus on the integration of biomarkers and genomic data with clinical characteristics today and what we can expect tomorrow State-of-the-art lecture When is chemotherapy indicated in prostate cancer? P. Albers, Düsseldorf (DE) State-of-the-art lecture Systemic therapy for renal cell cancer A.S. Merseburger, Hanover (DE) Aims and objectives Emerging from a largely cytokine-based era, the clinical development of the last decade has led to a dramatic change in the therapeutic landscape of renal cell carcinoma. Molecularly targeted and antiangiogenic agents now form the backbone of most therapeutic strategies for patients with advanced metastatic renal cell carcinoma. This lecture focuses on the clinical efficacy of systemic therapy in RCC patients and gives a brief overview on novel areas of development and emerging substances including vaccine and immunotherapies which hold promise to improve therapeutic outcomes for patients with mrcc State-of-the-art lecture Second-line chemotherapy for urothelial cancer M. De Santis, Vienna (AT) Monday Aims and objectives Bladder cancer is a chemotherapy sensitive disease and cisplatin based combination treatment has been the standard for many years. Only about 15% of patients experience long term remissions. For those who fail first-line chemotherapy the prognosis usually is dismal. Second-line chemotherapy data are highly variable. Only recently, three prognostic factors have been established, resulting in 4 prognostic groups. A reasonable strategy in the second-line setting is to rechallenge former cisplatin sensitive patients if progression occurs at least 6-12 months after first treatment. The only phase III trial in this context explored vinflunine plus best supportive care (BSC) randomised against BSC alone in patients failing first-line platinum based combination chemotherapy. The results showed a survival benefit in favour of vinflunine, which was statistically significant in the eligible patient population. Currently, vinflunine is the only approved second-line treatment in Europe. Recent advances and future strategies and studies will be summarised and critically discussed. 258 Programme Book

259 Monday, 18 March - EAU Programme Thematic Session A session by the European Society of Urogenital Radiology Red Hall 1 - Level N1 Chair: G. Heinz-Peer, Vienna (AT) State-of-the-art lecture Multiparametric MRI a step forward in the diagnosis of prostate cancer A. Turgut, Ankara (TR) Aims and objectives The main objective of this session is to outline the role of MRI in the clinical management of patients with prostate cancer. In this regard, multiparametric MRI involving conventional as well as functional techniques for the imaging of prostate cancer will be described. Importantly, the clinical indications for the use of prostate MRI will be discussed. Also, typical MRI findings of prostate cancer will be reviewed and the current advances in prostate MRI providing anatomical and functional data about prostate cancer will be summarised. Accordingly, a structured reporting system (PI-RADS) for the MRI findings of prostate cancer will be presented. Finally, future prospects for the impact of prostate MRI on the diagnosis and treatment of prostate cancer will be discussed State-of-the-art lecture The role of imaging in urothelial cancer N. Cowan, Oxford (GB) State-of-the-art lecture Characterisation and management of incidental adrenal masses G. Heinz-Peer, Vienna (AT) Monday EAU Milan

260 Monday, 18 March - EAU Programme Thematic Session Prevention and treatment of urological infections Red Hall 2 - Level N1 Chair: T.E. Bjerklund Johansen, Århus (DK) State-of-the-art lecture Antibiotics - the urological time bomb G. Kahlmeter, Växjö (SE) Aims and objectives Antimicrobial prophylaxis and therapy are an integral part of modern medicine. Without them much of what we perceive as modern medicine will be either impossible or very difficult to continue. Galloping antimicrobial resistance development together with an almost complete lack of development of truly new antibacterials threaten to undermine both prophylaxis and management of infections in modern medicine. The aim of this lecture is to update the audience on antimicrobial resistance development, development of new antibacterials, possible measures to counteract resistance development and their effectiveness and alternative strategies State-of-the-art lecture Antiobiotic prophylaxis in endoscopic urological interventions M. Grabe, Malmö (SE) Aims and objectives The risk of infectious complications associated with urological diagnostic and therapeutic procedures are related to the bacterial contamination level and several other factors. A model of classification of these procedures in different classes of contamination will be presented as will the subsequent strategy for antibiotic prophylaxis, with focus on urological endoscopic interventions State-of-the-art lecture Antibiotics in prostate biopsies F.M.E. Wagenlehner, Giessen (DE) Aims and objectives Prostate biopsy is currently an essential procedure for prostate cancer diagnosis and is a frequently performed procedure in urology with an estimated cases each year in Europe. The aim of this presentation is to highlight current developments with regard to increasing infectious complications after prostate biopsies and possible strategies for improvement Abstract presentations: Special selection from the poster sessions Monday 158 Socioeconomic trends and utilization in the emergency department treatment of urinary tract infections J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of America) 615 Comparison of different scoring systems for outcome prediction in patients with Fournier s gangrene: Our experience with 50 patients A. Tuncel, T. Keten, Y. Aslan, M. Kayali, A. Erkan, M. Yildiz, A. Atan (Ankara, Turkey) 260 Programme Book

261 Monday, 18 March - EAU Programme Thematic Session Neurourology Blue Hall Level N1 Chair: F.C. Burkhard, Berne (CH) State-of-the-art lecture Spinal cord injury: The initial management of the bladder G. Del Popolo, Florence (IT) Aims and objectives After spinal cord lesion we observe a period of spinal shock during which we must ensure the drainage of the bladder using an indwelling catheter, the bladder rehabilitation provide the removal of the indwelling catheter starting intermittent catheterisation. Further investigations are needed such as renal function tests, ultrasound, neurophysiological tests, urodynamic examination. Clinical and instrumental tests are mandatory to optimise rehabilitation management with the use of intermittent catheterism, conservative management, medical therapy and to prevent neurological bladder complications State-of-the-art lecture Pharmacotherapy for neurogenic bladder P. Radziszewski, Warsaw (PL) Aims and objectives The lecture will cover practical aspects of pharmacotherapy of different lower urinary tract conditions in patients with neurogenic bladder. The new compounds will be critically evaluated and guidelines on pharamacotherapy will be presented. The main focus will be on proper decision/treatment pathways and management of tolerability/efficay issues State-of-the-art lecture Renal transplantation into a reconstructed bladder P. Lopez Pereira, Madrid (ES) Aims and objectives Not many years ago, patients with congenital abnormalities of the lower urinary tract or bladder dysfunction were denied Renal Transplant (RT) because they were considered very high risk recipients. However, in the last few decades we have learnt that in patients with low-capacity-poorly compliant bladders an Augmentation Cystoplasty (AC) will create a compliant low-pressure reservoir that will protect the kidney graft. The incidence of symptomatic UTI may be increased in transplanted patients with AC but UTI is more related with CIC non-compliance or VUR to the native kidneys than with the AC itself and usually does not lead to impairment of graft function. Today, patients with a bladder reconstruction can be transplanted with the same outcome (graft survival and function) as those with normal bladders, although the risk of malignant transformation in the augmented segment may be increased in these patients Abstract presentations: Special selection from the poster sessions 300 Desmopressin in the treatment of nocturia in patients affected by Parkinson s disease S. Proietti, M. Gubbiotti, J.A. Rossi De Vermandois, A. Giannantoni (Rozzano, Perugia, Italy) Monday 441 Why anticholinergics fail: Oxybutynin and fesoterodine induce a shift from muscarinergic to purinergic transmission in the rat bladder P. Uvin, M. Boudes, J. Franken, A. Menigoz, S.J. Pinto, T. Gevaert, R. Verplaetse, J. Tytgat, R. Vennekens, T. Voets, D. De Ridder (Leuven, Belgium) EAU Milan

262 Monday, 18 March - EAU Programme Thematic Session Management of pain in urology Brown Hall Level S2 Chair: P. Bader, Karlsruhe (DE) State-of-the-art lecture Neuroanatomy, neurophysiology and molecular basis of pain K. Everaert, Ghent (BE) Aims and objectives We will supply an overview of neuroanatomy, neurophysiology and molecular basis of pain and will relate this to existing therapeutic options State-of-the-art lecture Management of pain after urological procedures E.J. Messelink, Groningen (NL) Aims and objectives This presentation will pay attention to pain mechanisms in abdominal and pelvic pain after surgery. Prevention of pain and adequate treatment will be discussed. The most important part will be the prevention of chronification of the pain. This requires pain management which is always multidisciplinary in nature. The role of the psychologist and physiotherapist will also be addressed State-of-the-art lecture Tumour-related pain A. Paez Borda, Madrid (ES) Monday 262 Programme Book

263 Monday, 18 March - EAU Programme Thematic Session Urological surgery in renal transplant patients Amber Hall Level S2 Chairs: F.J. Burgos Revilla, Madrid (ES) A.J. Figueiredo, Coimbra (PT) State-of-the-art lecture Therapeutic options facing graft lithiasis J.D. Olsburgh, London (GB) Aims and objectives To highlight rate of incidental kidney stones in potential living kidney donors and rates of stones in transplant patients. To discuss issues in kidney donors and recipients including patient selection, stone management options and outcomes. To discuss management strategies for stone treatment in transplanted kidneys and outcomes State-of-the-art lecture Management of allograft renal tumours M. Musquera Felip, Barcelona (ES) State-of-the-art lecture Treatment of ureteral stenosis M. Giessing, Düsseldorf (DE) Aims and objectives Transplant ureter strictures, occurring in about 5% of recipients after renal transplantation, can be treated with mulitple techniques. The presentation will name the different interventions as well as their success rates, from minimal invasive to open surgical approaches. Knowledge of these factors and interventional strategies will help to improve long term transplant outcome State-of-the-art lecture Open versus minimally invasive living donor nephrectomy L. Salomon, Creteil (FR) Aims and objectives Living donor graft procures the best results in renal transplantation. However, perioperative morbidity with major and minor complications can occur during this challenging procedure. Open surgery with transabdominal or retroperitoneal approach provide up to 22% of complications to the donor. Development of minimally invasive surgery in urology began in 1991 with the first laparoscopic radical nephrectomy. From then on, living donor nephrectomy has been performed with evolving surgical technics: transperitoneal, extraperitoneal, hand assisted robotic assisted, single site, natural orifice living donor laparoscopic nephrectomy. The aim of this lecture is to evaluate the results of these new procedures by comparaison with those of open surgery: not only have we compared these results for the donor but also for the receiver as well as the long term results of renal transplantation Monday EAU Milan

264 Monday, 18 March - EAU Programme Abstract Session Developments in cancer diagnosis and management euro Auditorium - Level S2 Video Session 8 Chairs: R. Medina López, Seville (ES) D. Burke, Manchester (GB) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V57 V58 V59 V60 V61 V62 V63 V64 Aggressive bladder neck sparing in laparoscopic radical prostatectomy M.J. Smolski, N. McLeod, J. Graham, A. Manjunath, R. Brough, N. Oakley (Stockport, United Kingdom) Intravesical and transperitoneal laparoscopy in the management of tumor in the residual ureter A.W. Branco, L. Stunitz, S. Nichele, P.H. Douat, M. Luiz, L.T. Nassif (Curitiba, Brazil) En-bloc resection of non-muscle invasive bladder tumours with the combination instrument HybridKnife J. Mundhenk, S.H. Alloussi, F. Miller, J. Hennenlotter, G. Gakis, D. Schilling, A. Stenzl, C. Schwentner (Tübingen, Neunkirchen, Germany) Initial series of video endoscopic inguinal lymphadenectomy and description of the technique S. Monagas Arteaga, M.A. Alonso Prieto, F. García Diez, M. De Arriba Alonso, F.J. Gallo Rolania (Leon, Spain) New 3-dimensional head-mounted display system (RoboSurgeon system) applied to gasless, single-port access adrenalectomy K. Kihara, Y. Fujii, H. Masuda, K. Saito, F. Koga, N. Numao, Y. Matsuoka (Tokyo, Japan) Multiparametric MRI US fusion targeted prostate biopsies with Varian brachytherapy software: Precision prostate cancer diagnostics P. Sturch, K. Duong, J. Kinsella, M. McGovern, A. Robinson, A. Polson, A. Chandra, G. Rottenberg, S. Morris, R. Popert (London, United Kingdom) Renal tumor with cava thrombus type III-IV M.A. López-Costea, J.I. Pérez-Reggeti, J. Fabregat Prous, R. Rodriguez-Malatesta, E. Llorens, F. Vigués, E. Franco (Barcelona, Spain) Prostate-sparing radical cystectomy with prostatic capsule and vasa deferentia sparing by means of Millin prostatectomy R.E. Sanchez Salas, P. Macek, F. Rozet, E. Barret, M. Galiano, L. Lunelli, X. Cathelineau (Paris, France) Monday 264 Programme Book

265 Monday, 18 March - EAU Programme Abstract Session Radical prostatectomy: New techniques Brown Hall Level S2 Poster Session 66 Chairs: A. Heidenreich, Aachen (DE) A. Mottrie, Aalst (BE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 799 Vessel sealing device with nano-coating significantly reduces heat spread for neurovascular bundle preparation R. Mackenzie, J. Skorucak, A. Mortezavi, J. Vörös, D. Eberli (Zürich, Switzerland) 800 The single-knot running vesico-urethral anastomosis ten years after its introduction: Evaluation of its application, feasibility and complication rate in an international survey S. Albisinni, K. Limani, E. Hawaux, A. Peltier, R. Van Velthoven (Brussels, Belgium) 801 Palliative radical (cysto)prostatectomy in locally advanced castration-resistant prostate cancer D. Porres, T. Van Erps, C. Piper, D. Pfister, A. Heidenreich (Aachen, Germany) 802 Presence of disseminated tumor cells at time of radical prostatectomy is not associated with more advanced or poorly differentiated disease in patients with localized prostate cancer; potential sources of relapse? H. Isbarn, K. Effenberger, T. Schlomm, M. Rink, F.K.H. Chun, M. Fisch, H. Huland, M. Graefen, K. Pantel (Hamburg, Germany) 803 Immunohistochemical ERG status is not predictive for biochemical recurrence after radical prostatectomy with positive surgical margin M. Ladurner Rennau, H. Klocker, I. Heidegger, V. Skradski, G. Schäfer, W. Horninger, J. Bektic (Innsbruck, Austria) 804 Functional and quality of life analysis in a prospective series of 51 brachytherapies and 42 robotic prostatectomies. Comparative analysis C. Garcia-Sanchez, J.M. Conde-Sanchez, C.B. Congregado-Ruiz, I. Osman-Garcia, J.M. Pena-Outeiriño, E. Arguelles-Salido, R.A. Medina-Lopez (Seville, Spain) 805 Biological significance of perineural invasion in radical prostatectomy specimens: Study of its prognostic significance in biochemical recurrence J.L. Ruiz Cerda, R. Rogel Berto, J.V. Salom Fuster, A. Gallego Matey, B. Plaza Viguer, A. Polo Rodrigo, F. Boronat Tormo (Valencia, Spain) 806 Predictors of early biochemical recurrence after radical prostatectomy and adjuvant radiotherapy in men with pt3 N0 prostate cancer. Implications for multi-modal therapies M. Bianchi, A. Briganti, T. Wiegel, S. Joniau, F. Abdollah, M. Tutolo, C. Cozzarini, B. Tombal, K. Haustermans, W. Hinkelbein, N. Di Muzio, H. Van Poppel (Milan, Italy; Ulm, Berlin, Germany; Leuven, Louvain, Belgium) Monday 807 Characteristics of anterior predominant prostate cancer and the usefulness of multiparametric MRI in diagnosis S. Pak, S.J. Park, S.H. Song, D. You, I.G. Jeong, C. Song, J.H. Hong, C.S. Kim, H. Ahn (Seoul, South Korea) EAU Milan

266 808 Effects of surgeon variability on oncological and functional outcomes in a population-based setting S. Carlsson, A. Berglund, D. Sjoberg, A. Khatami, J. Stranne, S. Bergdahl, G. Aus, J. Hugosson (New York, United States of America; Stockholm, Gothenburg, Sweden) 809 Ink marked intraoperative frozen section of the prostate during open radical prostatectomy prospective analysis of diagnostic and therapeutic efficacy G. Hatzichristodoulou, G. Weirich, S. Wagenpfeil, K. Herkommer, M. Autenrieth, T. Maurer, M. Thalgott, T. Horn, M. Heck, J.E. Gschwend, H. Kübler (Munich, Germany) 810 Withdrawn Summary - does the technique matter? A. Heidenreich, Aachen (DE) Monday 266 Programme Book

267 Monday, 18 March - EAU Programme Abstract Session Advanced urothelial cancer: Disease outcomes Brown Hall 3 - Level S2 Poster Session 67 Chairs: F. Liedberg, Malmö (SE) J. Huang, Guangzhou (CN) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 811 Serum β-hcg predicts recurrence post radical cystectomy J.W.R. Douglas, T. Drake, M. Sommerlad, M. Hayes, S. Crabb (Southampton, United Kingdom) 812 External validation of a multicenter prognostic model for risk stratification in pt2n0 bladder cancer T. Todenhöfer, M. Renninger, B. Al-Matar, M.F. Abdelhafez, A. Stenzl, G. Gakis (Tübingen, Germany) 813 Time to disease recurrence is a strong predictor of cancer-specific mortality in upper tract urothelial carcinoma M. Rink, D. Sjoberg, E. Xylinas, V. Margulis, L.A. Kluth, E.K. Cha, J.D. Raman, M. Remzi, K. Bensalah, G. Novara, F.K. Chun, E. Kikuchi, W. Kassouf, J. Martinez-Salamanca, Y. Lotan, C. Seitz, A. Pycha, R. Zigeuner, D.S. Scherr, A.J. Vickers, S.F. Shariat (Hamburg, Germany; New York, Dallas, Hershey, United States of America; Korneuburg, Vienna, Graz, Austria; Rennes, France; Padua, Bolzano, Italy; Tokyo, Japan; Monteal, Canada; Madrid, Spain) 814 Combining smoking information and molecular markers improves prognostication in patients with urothelial carcinoma of the bladder E.N. Xylinas, L. Wang, M. Kent, D. Sjoberg, L. Kluth, M. Rink, P.I. Karakiewicz, G. Novara, M. Zerbib, D. Scherr, Y. Lotan, S.F. Shariat (New York, Dallas, United States of America; Montreal, Canada; Padua, Italy; Paris, France) 815 Validation of prognostic value of Bajorin criteria for cancer-specific survival in patients who have disease recurrence after radical cystectomy for urothelial carcinoma of the bladder L.A. Kluth, E. Xylinas, M. Rink, M. Kent, D. Sjoberg, M. Babjuk, A. Brisuda, A. Aziz, H-M. Fritsche, E. Comploj, A. Pycha, D. Sundi, T. Bivalacqua, G. Novara, J. Baniel, R. Mano, P. Gontero, R.S. Svatek, L. Lusuardi, A. Mitra, S. Daneshmand, Y. Lotan, D.S. Scherr, S.F. Shariat (New York, Baltimore, San Antonio, Los Angeles, Dallas, United States of America; Hamburg, Regensburg, Germany; Prague, Czech Republic; Bolzano, Padua, Turin, Italy; Petah-Tikva, Israel; Salzburg, Austria) 816 Long-term outcomes of laparoscopic nephroureterectomy: 10-year follow-up J-A. Long, D. Snow-Lisy, R. Eyraud, R. Miocinovic, R. Stein, J. Kaouk, G-P. Haber (Cleveland, United States of America) 817 Elective segmental ureterectomy for transitional cell carcinoma of the ureter: Long term follow-up in a 73 patients series A. Simonato, A. Benelli, V. Varca, A. Gregori, M. Ennas, A. Lissiani, M. Gacci, S. De Stefani, M. Rosso, S. Benvenuto, G. Siena, E. Belgrano, F. Gaboardi, M. Carini, G. Bianchi, G. Carmignani (Genoa, Milan, Trieste, Florence, Modena, Italy) Monday EAU Milan

268 818 Site specific pattern of metastatic behavior in upper tract urothelial carcinoma treated with radical nephroureterectomy K. Ishioka, E. Kikuchi, N. Tanaka, K. Kanao, K. Matsumoto, H. Kobayashi, H. Ide, Y. Miyazaki, J. Obata, S. Shirotake, H. Akita, T. Kosaka, A. Miyajima, T. Momma, Y. Nakajima, S. Hasegawa, K. Nakagawa, M. Jinzaki, M. Oya (Tokyo, Saitama, Tochigi, Kanagawa, Japan) 819 Equivalent survival after distal ureterectomy compared to nephroureterectomy in patients with urothelial carcinoma of the distal ureter: A propensity score-matched multi-center study H. Fukushima, K. Saito, J. Ishika, Y. Matsuoka, N. Numao, F. Koga, H. Masuda, Y. Fujii, Y. Sakai, C. Arisawa, T. Okuno, J. Yonese, S. Kamata, K. Nagahama, A. Noro, S. Morimoto, T. Tsujii, S. Kitahara, S. Gotoh, Y. Higashi, K. Kihara (Tokyo, Chiba, Ibaraki, Saitama, Shizuoka, Japan) 820 A population-based competing-risks analysis of survival after nephroureterectomy for upper tract urothelial carcinoma A. Abdo, F. Roghmann, A. Becker, M. Meskawi, P.I. Karakiewicz, N. Hanna, M. Sun (Montreal, Canada; Herne, Hamburg, Germany) * 821 Therapeutic benefit from template-based lymphadenectomy in urothelial carcinoma of the renal pelvis - multi-institutional prospective study T. Kondo, I. Hara, T. Takagi, Y. Kodama, Y. Hashimoto, J. Iizuka, K. Omae, E. Ikezawa, K. Yoshida, K. Tanabe (Tokyo, Wakayama, Japan) 822 Prognostic factors and outcomes after definitive treatment for primary urethral cancer: Results from the International Collaboration on Primary Urethral Carcinoma (ICPUC) G. Gakis, S. Daneshmand, J.A. Efstathiou, B. Ali-El-Dein, J. Hrbacek, K.A. Keegan, S. Galland, R. Clayman, L. Weissbach, J. Brunner, T. Todenhöfer, M. Rink, H-M. Fritsche, M. Babjuk, G.N. Thalmann, A. Stenzl (Tübingen, Hamburg, Regensburg, Germany; Los Angeles, Boston, Nashville, United States of America; Mansoura, Egypt; Prague, Czech Republic; Berne, Switzerland) Summary R. Inman, Sheffield (GB) Monday 268 Programme Book

269 Monday, 18 March - EAU Programme Abstract Session Evidence-based prostate cancer therapies in cellular and animal models Amber Hall Level S2 Poster Session 68 Chairs: F.R. Santer, Innsbruck (AT) T. Visakorpi, Tampere (FI) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 823 Transcriptional down-regulation of the androgen receptor by promoter G-quadruplex stabilisation; a potential alternative treatment in castrate-resistant prostate cancer T.J. Mitchell, A. Ramos-Montoya, M. Di Antonio, P. Murat, S. Ohnmacht, M. Micco, L. Fryer, S. Balasubramanian, S. Neidle, D.E. Neal (Cambridge, London, United Kingdom) * 824 Abiraterone is able to block AR activation induced by accumulating levels of precursor hormones resulting from CYP17A1 inhibition J.M. Moll, R.J. Van Soest, J. Kumagai, R. Graeser, I. Hickson, G.W. Jenster, W.M. Van Weerden (Rotterdam, The Netherlands; Beerse, Belgium) 825 Modification of the integrins a2, a5 and b1 plays a particularly critical role in metastatic spread of RAD001- resistant prostate cancer cells I. Tsaur, J. Makarevic, M. Kurosch, M. Reiter, G. Bartsch, A. Haferkamp, R. Blaheta (Frankfurt, Germany) 826 Targeting STAT3 in castration-resistant prostate cancer - identification of STAT3 as a direct target of the fungal metabolite galiellalactone N. Don-Doncow, M. Johansson, Z. Escobar, O. Sterner, A. Bjartell, R. Hellsten (Malmö, Lund, Sweden) 827 Novel anticancer effect of proteasome inhibitor on prostate cancer cells targeting prostate-specific membrane antigen and androgen receptor K. Kuroda, A. Horiguchi, T. Asano, S. Tasaki, J. Asakuma, A. Sato, K. Seguchi, K. Ito, T. Asano (Tokorozawa, Saitama, Japan) 828 Antitumor activity of nanovectors encapsulating zoledronic acid (ZOL) in 3D prostate carcinoma spheroids J. Schmidt, J. Kamradt, M. Stöckle, G. Derosa, A. Lombardi, M. Caraglia, G. Unteregger (Homburg, Germany; Naples, Italy) 829 Improvement of efficacy of insulin-like growth-factor receptor (IGF)-targeting-therapies by co-targeting insulin receptor A in prostate cancer I. Heidegger, J. Kern, P. Massoner, H. Klocker (Innsbruck, Austria) 830 Resistance towards temsirolimus is counteracted by epigenetic intervention J. Makarevic, I. Tsaur, E. Jüngel, A. Haferkamp, R. Blaheta (Frankfurt, Germany) Monday 831 Mesenchymal stem cells carrying prodrug-activating enzymes inhibit tumor growth in immune-competent, prostate cancer-bearing mice A. Abrate, R. Buono, F Benigni, P. Hedlund, I.T.R. Cavarretta (Milan, Italy) EAU Milan

270 832 Mesenchymal stem cell mediated cancer therapy in the transgenic adenocarcinoma of the mouse prostate (TRAMP) model R. Buono, A. Abrate, A. Esposito, T. Canu, A. Del Maschio, F. Benigni, P. Hedlund, I.T.R. Cavarretta (Milan, Italy) 833 Monitoring the effects of therapeutic fatty acid synthase inhibition in prostate canecr using 11C acetate PET G.L. Shaw, D. Lewis, J. Boren, A. Ramos-Montoya, D. Soloviev, R. Bielik, K. Brindle, D. Neal (Cambridge, United Kingdom) aminolevulinic acid-mediated photodynamic therapy for prostate cancer H. Fukuhara, K. Inoue, T. Shuin (Nankoku, Japan) 835 IL-15 inhibits expression of killer inhibitory NK receptors and upregulates expression of NKG2D on NK and NKT cells in prostate cancer-pbmc cocultures O. Elhage, C-A. Sakellariou, O. Ukimura, I. Gill, R.A.G. Smith, C. Galustian, P. Dasgupta (London, United Kingdom; Los Angeles, United States of America) Monday 270 Programme Book

271 Monday, 18 March - EAU Programme Abstract Session Male infertility: Clinical issues Amber Hall Level S2 Poster Session 69 Chairs: W. Aulitzky, Vienna (AT) S. Micic, Belgrade (RS) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 836 The validity of testicular aspirate cytology and DNA image analysis of the aspirate in the assessment of infertile men S.E. Abou Hashem, E. Sabaa, S. Mostafa, A. Abdalla, H. Maramhy, M. Mostafa, D. Elsayed, E. Ibrahim, A. Maroof, M. Eladl (Zagazig, Egypt; Almadena Almonawarah, Saudi Arabia) 837 Withdrawn 838 Should older patients be offered varicocele repair to improve their fertility? G. Ollandini, G. Liguori, G. Mazzon, S. Benvenuto, B. De Concilio, S. Bucci, R. Napoli, M. Rizzo, P. Umari, N. Pavan, G. Chiriacò, C. Trombetta (Trieste, Italy) 839 Laparoendoscopic single-site surgery with a single channel versus conventional laparoscopic varicocele ligation: A prospective randomized study B.X. Xue, Y.X. Shan, J. Wang, J. Zhu, W. Tao, Y. Cui, Q. Yao (Suzhou, China) 840 Standardization of varicocele: Is it possible? X.K. Wang, W.L. Wang, H.Z. Wang, L. Che, D.J. Fu, M.K. Lai, Y.P. Liu (Xiamen, Beijing, China) 841 Robotic assisted re-do vasectomy reversal for previously failed pure microsurgical reversal A. Gudeloglu, J. Brahmbhatt, T. Patel, K. Priola, S. Parekattil (Winter Haven, United States of America) 842 Clinical assessment of microdissection testicular sperm extraction in 313 patients with non-obstructive azoospermia K. Yamaguchi, K. Chiba, K. Matsushita, K. Okada, N. Enatsu, H. Miyake, M. Fujisawa (Kobe, Japan) 843 Do cell phones affect semen quality? V. Boulos, H. Hassan (Cairo, Egypt) 844 Endoscopy of the vas deference a new diagnostic and therapeutic tool in andrology M. Trottmann, A. Becker, B. Liedl, C. Stief, M. Graw, C. Braun, S. Kölle (Munich, Germany) 845 Choice of antibiotic therapy for chronic bacterial prostatitis in patients with infertility M.I. Kogan, H.S. Ibishev, Y.L. Naboka, K.A. Shiranov, A.H. Ferzauli, I.A. Gudima (Rostov on Don, Russia) 846 EAU guideline reduces unnecessary post vasectomy semen analyses E.M. Gordon, S.A Gordon, A. Hatton, J. Kasraie, N.N.K Lynn (Shrewsbury, Colchester, United Kingdom) Monday 847 Probe based Confocal Laser Endomicroscopy (pcle) - a new imaging technique for in situ localization of vital spermatozoa M. Trottmann, B. Liedl, A. Becker, C. Gratzke, C. Füllhase, C. Stief, S. Kölle (Munich, Germany) Discussion on poster 847 S. Micic, Belgrade (RS) EAU Milan

272 Monday, 18 March - EAU Programme Abstract Session Prostate cancer: Biomarkers Silver Hall - Level N2 Poster Session 70 Chairs: S. Crouzet, Lyon (FR) A. Haese, Hamburg (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 848 Clinical performance of serum isoform [-2]proPSA (p2psa) and its derivatives, namely %p2psa and PHI (Prostate Health Index) in men with family history of prostate cancer. Results from a multicentric European study (PROMEtheuS project) M. Lazzeri, G. Lughezzani, G. Lista, A. Larcher, A. Cestari, N. Buffi, A. Haese, A. Renter, A. De La Taille, P.O. Bosset, P. Le Corvoisier, T. McNicholas, L. Fowler, J.W. Roux, J. Palou, A. Breda, P. De La Torre, V. Bini, M. Graefen, G. Guazzoni (Milan, Perugia, Italy; Hamburg, Germany; Creteil, France; Stevenage, United Kingdom; Barcelona, Spain) 849 Decreasing cancer specific PSA density (CaPSAD) is a hallmark of local prostate tumour progression with prognostic relevance independent of serum PSA, and reflects a systematic alteration in androgen signalling N.M. Corcoran, M.K.H. Hong, N. Sapre, C.J. Nowell, J. Pedersen, G. Macintyre, R.K. Gaire, A. Kowalczyk, L.M. Harewood, J.S. Peters, A.J. Costello, C.M. Hovens (Melbourne, Australia) 850 A prediction based on levels of four kallikrein markers in blood improves preoperative prediction of indolent versus S. Carlsson, A. Maschino, E. Steyerberg, T. Van Der Kwast, A. Van Leenders, A. Vickers, H. Lilja, M. Roobol (New York, United States of America; Rotterdam, The Netherlands) 851 Lower PCA3 scores in prostate cancer patients with metastatic disease than in patients with nonmetastatic disease: Baseline data from the Triptocare study L. Martínez-Piñeiro, J. Schalken, A. De La Taille (Madrid, Spain; Nijmegen, The Netherlands; Creteil, France) 852 Cost evaluation of introducing the Prostate Health Index (phi) in the management of prostate cancer diagnostic C. Castelli, R. Mathieu, T. Fardoun, K. Bensalah, S. Vincendeau (Nimes, Rennes, France) Monday 853 [-2]proPSA and prostate health index (phi) improve detection of prostate cancer at initial and repeated biopsies in young men ( 60 year old) preferentially detecting clinically significant cancer C. Stephan, S. Vincendeau, A. Houlgatte, K. Miller, A. Semjonow (Berlin, Münster, Germany; Rennes, Paris, France) 854 PSA determinations with microfluidics: A novel point-of-service bioassay M.S. Zappala, J. Libertino, A. Wein, E.D. Vaughan, P. Scardino (Andover, Burlington, Philadelphia, New York, United States of America) 855 Definition of the Limit of Detection (LoD) for serum isoform [-2]proPSA in patients with recurrent prostate cancer after radical prostatectomy: An analytic study F. Ceriotti, M. Pontillo, L. Fasoli, M. Lazzeri, G. Lughezzani, G. Lista, A. Larcher, A. Cestari, N. Buffi, G. Fuzzi, G. Guazzoni (Milan, Florence, Italy) 272 Programme Book

273 856 Reducing the number of prostate biopsies validation of a four kallikrein panel to predict prostate cancer in a population-based referral cohort K. Braun, H.G. Lilja, A.J. Vickers, D. Sjoberg, A. Bjartell (Herne, Germany; New York, United States of America; Malmö, Sweden) 857 Relationship between PSA level and impairment of proteinase-inhibitory balance of key proteolytic systems during androgen-deprivation therapy for prostate cancer M.I. Kogan, M.B. Chibichyan, E.A. Chernogubova (Rostov on Don, Russia) 858 Baseline PSA level in prediction of prostate cancer risk and aggressiveness: A Danish population-based cohort study S. Benzon Larsen, K. Brasso, S.O. Dalton, J. Christensen, M. Christiansen, S. Calsson, H. Lilja, S. Friis, A. Tjønneland, P. Iversen (Copenhagen, Denmark; New York, United States of America) 859 Parallel measurement of urinary PCA3 and TMPRSS2:ERG with serum [-2]proPSA based Phi for prostate cancer detection C. Stephan, A. Semjonow, K. Schulze-Forster, H. Cammann, X. Hu, K. Miller, K. Jung, F. Friedersdorff (Berlin, Münster, Luckenwalde, Germany) 860 Influence of metabolic syndrome on prostate volume and prostate specific antigen W.S. Choi, C.J. Lee, S.B. Ha, S.Y. Cho, N.J. Heo, H. Jeong, J.S. Paick, H. Son (Seoul, South Korea) 861 Chemopreventive properties of the flavonoids genistein and quercetin in men with rising PSA: First results of a double-blind, randomized, placebo-controlled trial (QUERGEN trial) A. Galasso, S. Aufderklamm, A. Damms-Machado, F. Miller, S.C. Bischoff, A. Stenzl, G. Gakis (Hohenheim, Tübingen, Germany) Monday EAU Milan

274 Monday, 18 March - EAU Programme Abstract Session Complex urological reconstructions and tissue engineering Red Hall 1 - Level N1 Poster Session 71 Chairs: T.A. Drewa, Bydgoszcz (PL) S.G. Joniau, Leuven (BE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 862 Health related quality of life after radical cystectomy: Comparative study between orthotopic sigmoid versus ileal neobladders H. Miyake, J. Furukawa, M. Muramaki, M. Fujisawa (Kobe, Japan) 863 Ileocecal cup patch plasty as secondary continence mechanism in selected cases of outlet failure in continent cutaneous urinary diversion: Surgical technique and clinical results D.C. Vergho, C. Bauer, A. Kocot, A. Loeser, H. Riedmiller (Würzburg, Germany) 864 Y-neobladder: An update of a multi-institutional retrospective study. Analysis of late complications through Clavien-Dindo classification P. Destefanis, A. Bosio, M.T. Carchedi, A. Battaglia, M. Allasia, A. Gonella, G. Fasolis, M. Bellina, M. Mari, S. Crivellaro, B. Frea, G. Marchioro, C. Terrone, M. Maffezzini, G. Carrieri, G. Morgia, D. Fontana (Turin, Alba, Rivoli, Udine, Novara, Genua, Foggia, Messina, Italy) 865 Long term follow up for ileal conduit urinary diversion: Patients perspective in the absence of guidelines A.M. Abdelbaky, J. O Donovan, R. Pickard (Newcastle upon Tyne, United Kingdom) 866 Modified Y/V-plasty for the treatment of recurrent bladder neck contracture: Outcome and patient satisfaction C.P. Reiss, P. Schriefer, W. Struss, B. Schwaiger, H. Isbarn, O. Engel, S. Riechardt, M. Fisch, S. Ahyai, R. Dahlem (Hamburg, Germany) 867 Outcome of Y-V plasty as a final option in patients with recurrent bladder neck sclerosis after failed endoscopic treatment K.A.M. Sayedahmed, M. Salman, M. Aragona, R. Seibel, J. Ekrutt, M. Reichert, R. Olianas (Lueneburg, Germany) 868 Longterm cell-demanded release of TG-VEGF for the development of mature vascular networks for sphincter muscle engineering in vivo J. Marshall, R. Largo, A. Mortezavi, A. Sala, A. Banfi, M. Ehrbar, D. Eberli (Zürich, Basel, Switzerland) Monday 869 The novel biocomposite enhanced urinary bladder regeneration by inducing smooth muscle regrowth and preventing scar tissue formation animal model study J.A. Adamowicz, J.T. Tworkiewicz, T.K. Kowalczyk, M.P. Pokrywczyńska, M.B. Bodnar, A.M. Marszałek, T.D. Drewa (Bydgoszcz, Warsaw, Poland) 870 Prenatal coverage of an experimental spina bifida defect by gluing a growth factor loaded collagen scaffold improves neurological outcome L.A.J. Roelofs, A.J. Eggink, W.F. Daamen, T.H. Kuppevelt, M.M.Y. Lammens, A.J. Crevels, L.H. Olde Damink, I. Heschel, P.J. Geutjes, W.F.J. Feitz (Nijmegen, Rotterdam, The Netherlands; Herzogenrath, Germany) 274 Programme Book

275 871 Bladder wall substitution with autologously seeded collagen scaffolds Optimaix in a Göttingen minipig model D. Leonhäuser, V. Seifarth, K. Strick, N. Gaisa, I. Heschel, R.H. Tolba, A. Artmann, J.O. Grosse (Aachen, Jülich, Herzogenrath, Germany) 872 Tubular constructs for urinary diversion: A feasibility study in pigs M. Sloff, P.J. Geutjes, H.R. Hoogenkamp, V. Simaioforidis, T.H. Van Kuppevelt, W.F. Daamen, E. Oosterwijk, W.F. Feitz (Nijmegen, The Netherlands) 873 Reducing the risk in the production of tissue engineered buccal mucosa for urethral reconstruction A.J. Bullock, C.R. Chapple, S. MacNeil (Sheffield, United Kingdom) 874 Bioengineered skeletal muscle for the treatment of sphincter insufficiency characterized by MRI relaxometry F. Azzabi, N. Chuck, A. Boss, D. Eberli (Zürich, Switzerland) Summary on tissue engineering T.A. Drewa, Bydgoszcz (PL) Monday EAU Milan

276 Monday, 18 March - EAU Programme Abstract Session How to reduce warm ischemia in partial nephrectomy Red Hall 2 - Level N1 Poster Session 72 Chairs: H-C. Klingler, Vienna (AT) F. Porpiglia, Turin (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 875 To clamp or not to clamp during laparoscopic partial nephrectomy: A scintigraphic study of impact on renal function F. Porpiglia, I. Morra, R. Bertolo, D. Amparore, C. Fiori (Turin, Italy) 876 Perioperative and functional outcomes of robotic assisted partial nephrectomy without hilar clamping: A multi-institutional propensity score analysis B. Kaczmarek, R. Kumar, Y. Tanagho, S. Hillyer, J. Mullins, M. Diaz, Q-D. Trinh, S. Bhayani, M. Stifelman, J. Kaouk, C. Rogers (Detroit, Saint Louis, Cleveland, Baltimore, New York, United States of America) 877 A clinical study of laparoscopic nephron-sparing partial nephrectomy with temporary blocking-up segmental branch of renal artery technique F. Chen (Guiyang, China) 878 Application of vasculature model and standardization of renal hilar approach in laparoscopic partial nephrectomy with precise segmental artery clamping C.J. Yin (Nanjing, China) 879 Towards zero ischaemia laparoscopic partial nephrectomy: Single centre experience J.K. Makanjuola, A. Qteishat, M. Lynch, A. Rao, C. Brown, C. Kouriefs, M. Arya, P. Grange (London, United Kingdom) 880 Functional outcome of nephron sparing surgery: Impact of warm ischemia less than 30 min vs no ischemia and role of endothelin-1 A. Morlacco, S. Crivellaro, G. Romano, L. Tosco, B. Frea (Udine, Italy) 881 Feasibility and safety of zero ischemia robotic assisted partial nephrectomy with controlled hypotension for tumors larger than 4 cm R. Papalia, G. Simone, M. Ferriero, S. Guaglianone, E. Forastiere, M. Gallucci (Rome, Italy) Monday 882 Early unclamping surgical technique for robot-assisted partial nephrectomy: A multicenter prospective experience A.A. Wagner, K. Zeeck, P. Chang, A. Percy, G. Rao, K. Attwood, D. Mehedint, L. Digiorgio, T. Schwaab (Boston, Buffalo, United States of America) 883 Near-infrared fluorescence for laparoscopic partial nephrectomy P. Macek, E. Barret, F. Rozet, R.E. Sanchez-Salas, M. Galiano, P. Ahallal, J.M. Gaya, X. Cathelineau (Paris, France) 884 Laparoscopic partial nephrectomy without ischemia using a new 1,318 nm diode laser in a porcine survival model: Histological results after 4 weeks survival R.P. Zimmermann, E.E. Foditsch, M. Hager, L. Lusuardi, B. Hoinoiu, G. Janetschek (Salzburg, Austria; Timisoara, Romania) 276 Programme Book

277 885 Intracorporeal cooling and extraction (I.C.E.) technique of robotic partial nephrectomy: Emulating the open approach C.G. Rogers, K.R. Ghani, R.K. Kumar, W. Jeong, M. Menon (Detroit, United States of America) 886 Partial nephrectomy for the treatment of renal cell carcinoma and the risk of end stage renal disease S.A. Yap, S.M. Alibhai, G.A. Tomlinson, D.R. Urbach, A. Finelli (Toronto, Canada) 887 Efficacy of floseal vs tachosil vs no hemostatic agents for partial nephrectomy: A prospective multicenter comparative study (RECORd Project) A. Antonelli, A. Minervini, N. Arrighi, G. Bianchi, S. Cosciani Cunico, V. Ficarra, C. Fiori, G. Martorana, A. Lapini, M. Medica, V. Mirone, N. Pinzi, F. Porpiglia, F. Rocco, B. Rovereto, R. Schiavina, S. Serni, C. Simeone, C. Terrone, A. Volpe, F. Zattoni, M. Carini (Brescia, Florence, Modena, Padua, Orbassano, Bologna, Sestri Levante, Naples, Lucca, Milan, Pavia, Novara, Italy) Monday EAU Milan

278 Monday, 18 March - EAU Programme Abstract Session What is new in female urology Blue Hall Level N1 Poster Session 73 Chairs: K-D. Sievert, Tübingen (DE) A. Wagg, Edmonton (CA) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 888 Psychometric validation of a 3-day bladder diary model for lower urinary tract symptoms L. López-Fando Lavalle, M.A. Jimenez Cidre, M. Esteban Fuertes, F.J. Llorens Martinez, J. Salinas Casado, D. Castro Diaz, C. Müller Arteaga, J.M. Adot Zurbano, F. Rodriguez Escobar, M.A. Bonillo Garcia, B. Madurga Patuel, M. Leva Vallejo, L. Peri Cusi, J. Conejero Sugrañes, J. Jiménez Calvo (Madrid, Toledo, Elche, Tenerife, Vigo, Burgos, Barcelona, Valencia, Cádiz, Cordoba, Sevilla, Spain) 889 The Multiple Array Probe (MAPLe): A new tool capable of measuring EMG and differentiate between individual pelvic floor muscles P.J. Voorham-Van der Zalm, H.C. Voorham, C.W.L. Van Den Bos, H. Putter, M.C. De Ruiter, R.C.M. Pelger (Leiden, The Netherlands) 890 Catheterless long-term urodynamics with three devices S. Wille, J. Hamacher, D. Tenholte, N. Muthen, M. Al Mahmid, J. Mehner, U.H. Engelmann (Cologne, Chemnitz, Germany) 891 Does structural differences in type I synthetic slings have an impact on biocompatibility? Long-term evaluation of tissue reaction to two synthetic slings in an animal model: TVT-O vs I-STOP O. El Yazami Adli, O. Loutochin, W. Mahfouz, M. Caremel, J. Corcos (Montreal, Canada) 892 Oral lactobacilli vs antibiotic prophylaxis for recurrent urinary tract infections in premenopausal women N. Stepanova, V. Kruglikov, L. Lebid, M. Kolesnyk (Kiev, Ukraine) 893 Asymptomatic bacteriuria in pregnant women A. Lavrinenko, S. Kuderinov, I. Azizov, I. Belyaev, Y. Serbo, P. Deriglazova (Karaganda, Kazakhstan) 894 Recurrent urinary tract infections in adult women: A pilot study with oral d-mannose D. Porru, A. Parmigiani, D. Barletta, D. Choussos, S. Bassi, O. Miller, B. Gardella, R.E. Nappi, A. Spinillo, B. Rovereto (Pavia, Italy) Monday 895 Altis single-incision sling procedure for stress urinary incontinence: Short term outcomes from a single centre J. Dias, A.R. Freitas, R.F. Amorim, P. Espiridião, L. Xambre, L. Costa, L. Ferraz (Gaia, Oporto, Portugal) * 896 Mid-term follow-up after Ajust single incision sling implantation for women stress urinary incontinence: Efficacy, complications and prognostic factors J-N.L. Cornu, D. Lizée, L. Peyrat, C. Ciofu, N. Henry, P. Sèbe, O. Cussenot, F. Haab (Paris, France) 897 The Tissue Fixation mini-sling System (TFS) a novel system for reconstructive surgery of pelvic floor dysfunctions in women, following the Integral-Theory. First results in 54 women F.M.E. Wagenlehner, O. Fröhlich, T. Bschleipfer, B. Altinkilic, A. Gunnemann, B. Liedl, W. Weidner (Giessen, Detmold, Munich, Germany) 278 Programme Book

279 * 898 Mini-Arc for the treatment of female stress urinary incontinence: Long-term evaluation by patient reported outcomes R.M. Oliveira, A.O. Resende, C.M. Silva, P.D. Oliveira, F.M. Cruz (Porto, Portugal) Where do we go with mini-slings K-D. Sievert, Tübingen (DE) Monday EAU Milan

280 Monday, 18 March - EAU Programme Abstract Session BPH: Genes, biomarkers and beyond Yellow Hall Level N1 Poster Session 74 Chairs: A. Bachmann, Basel (CH) R.W.G. Watson, Dublin (IE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 899 Surface CD24 distinguishes undifferentiated from transit-amplifying cells in the basal layer of the human prostate N. Petkova, J. Hennenlotter, T. Todenhöfer, M. Sobiesiak, S. Aufderklamm, M. Scharpf, A. Stenzl, H. Bühring, C. Schwentner (Tübingen, Germany) * 900 Targeting both the dynamic and static components of LUTS/BPH using a soluble guanylate cyclase stimulator compared to vardenafil: Preclinical evidences D. Behr-Roussel, A. Oudot, S. Oger, D. Gorny, P. Sandner, J. Bernabé, L. Alexandre, F. Giuliano (Montigny-Le- Bretonneux, France; Wuppertal, Germany) 901 SRD5A1 and SRD5A2 genes are associated with the treatment for benign prostatic hyperplasia with the combination of 5α-reductase inhibitors and α-adrenergic-receptor antagonist X. Gu, R. Na, W. Li, S. Tao, L. Tian, Z. Chen, Y. Jiao, J. Kang, S. Zheng, J. Xu, J. Sun, J. Qi (Shanghai, China; Winston-Salem, United States of America) 902 Is the androgen receptor the link between inflammation and benign prostatic hyperplasia? J.M. Willder, V.C. Walker, T. Christ, G.L. Halbert, C.P.C, Dick, C. Orange, T. Qayyum, P.G. Horgan, M.A. Underwood, J. Edwards (Glasgow, United Kingdom) 903 Different high-fat diets induce overweight, insulin resistance and structural alterations on prostate rats A. Furriel, P.C. Silva, P.C.G.P. Silva, D.B. De Souza, W.S. Costa, F.J.B. Sampaio, B.M. Gregório (Rio de Janeiro, Brazil) 904 Is the cyclic AMP signaling a pivotal player in the control of prostate smooth muscle? A biochemical and functional approach S. Ückert, E.S. Waldkirch, G.T. Kedia, M.A. Kuczyk (Hanover, Germany) Monday * 905 Phosphorylation of the androgen receptor at serine 308 may link benign prostate enlargement to cardiovascular disease J.M. Willder, V. Walker, T. Christ, G.L. Halbert, C.P.C. Dick, C. Orange, P.G. Horgan, M.A. Underwood, J. Edwards (Glasgow, United Kingdom) 906 Inhibition of EFS-, phenylephrine-, and thromboxane-induced contraction of human prostate smooth muscle by the receptor antagonist, picotamide M. Hennenberg, M. Miljak, F. Strittmatter, Y. Hocaoglu, B. Rutz, C. Füllhase, C.G. Stief, C. Gratzke (Munich, Germany) 907 Noradrenaline induces binding of clathrin light chain A to alpha1a-adrenoceptors in the human prostate M. Hennenberg, J. Miersch, B. Rutz, F. Strittmatter, S. Walther, R. Waidelich, A. Roosen, C.G. Stief, C. Gratzke (Munich, Germany) 280 Programme Book

281 908 The alteration of matrix metalloproteinase - 2, 9 and the expression of prostate specific antigen within the prostatic tissue following acute urinary retention of non-malignant etiology in rats W. Djatisoesanto, I.K. Sudiana, D.M. Soebadi (Surabaya, Indonesia) 909 The effects of soluble guanylyl cyclase stimulator alone and in combination with a phosphodiesterase type 5 inhibitor in normal rats and rats with partial urethral obstruction induced bladder overacticvity C. Fullhase, M. Hennenberg, P. Sandner, R. Soler, C. Stief, K.E. Andersson (Munich, Wuppertal, Germany; Sao Paulo, Brazil; Winston-Salem, United States of America) 910 A systematic review and meta-analysis of candidate gene association studies of lower urinary tract symptoms in men A. Mangera, R. Cartwright, K.A.O. Tikkinen, T. Palmer, J. Pesonen, P. Rajan, C. Ambrose, A.C. Kirby, G. Thiagamoorthy, V. Khullar, P.R. Bennett, A. Walley, M-R. Jarvelin, C.R. Chapple (Sheffield, London, Bristol, Glasgow, United Kingdom; Hamilton, Canada; Tampere, Finland; San Diego, United States of America) Summary: Results from the Goliath study A. Bachmann, Basel (CH) Monday EAU Milan

282 Monday, 18 March - EAU Programme Abstract Session Challenging reconstructive surgery euro Auditorium - Level S2 Video Session 9 Chairs: L. Peri Cusi, Barcelona (ES) G.A.N. Pignot, Le Kremlin Bicetre (FR) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V65 V66 V67 V68 V69 V70 V71 V72 Laparoscopic bladder augmentation and Mitrofanoff appendicovesicostomy: Saint Augustin technique D. Rey, M. Oderda, E. Helou, L. Lopez, P.T. Piechaud (Bordeaux, France) Laparoscopic ureteric reimplantation for missed ureteric injury after gynaecological surgery M.J. Smolski, N. McLeod, S.C. Brown, N. Oakley (Stockport, United Kingdom) Repair of recto-urethral fistula with perineal approach and interposition of gracilis muscle R. Sanseverino, G. Napodano, O. Intilla, U. Di Mauro, G. Molisso, T. Realfonso (Nocera Inferiore, Italy) Transanal repair of rectovesical fistula after radical prostatectomy using the modified Latzko technique T. Nomura, M. Kawaguchi, K. Kayanuma, S. Suzuki, J. Kobayashi, H. Ishikawa (Yamanashi, Japan) Mini-invasive transrectal repair of recto-urinary fistula after radical prostatectomy G. Nicita, V. Li Marzi, M. Mencarini, A. Cocci, D. Villari, M. Marzocco (Florence, Italy) Reconstruction of complicated redo-hypospadia in two stages with buccal mucosal graft J. Beier, A. Pandey, H. Keller (Hof, Germany) Combined therapy of stress urinary incontinence and erectile dysfunction with the implantation of Advance (XP) and AMS 700 in a single procedure B. Amend, S. Kruck, S.K. Wilson, L. Hakim, B.S. Christine, J. Brady, E.R. Castane, C. Rojas-Cruz, A. Stenzl, J. Bedke, K-D. Sievert (Tübingen, Germany; Indio, Cleveland, Homewood, Orlando, United States of America; Barcelona, Spain) Laparoscopic ureteral reimplantation in Hautmann s neobladder J.A. Peña, M. Oliveira, J.M. Santillana, A. Rosales, J. Palou, H. Villavicencio (Barcelona, Spain) Monday 282 Programme Book

283 Monday, 18 March - EAU Programme Abstract Session Surgical approaches for prostate cancer Brown Hall Level S2 Poster Session 75 Chairs: M. Burchardt, Greifswald (DE) B. Rocco, Milano (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 911 Oncological outcome and prognostic factors for locally advanced prostate cancer treated with radical prostatectomy: An EMPaCT study C.Y. Hsu, M. Spahn, A. Briganti, J. Karnes, P. Gontero, G. Marchioro, B. Tombal, J. Chun, P. Bastian, H. Van Der Poel, R. Sanchez-Salas, S. Joniau (Taichung, Taiwan; Berne, Switzerland; Milan, Turin, Novara, Italy; Rochester, United States of America; Brussels, Leuven, Belgium; Hamburg, Munich, Germany; Amsterdam, The Netherlands; Paris, France) * 912 Comparative oncologic effectiveness of radical prostatectomy and radiotherapy in prostate cancer: An analysis of mortality outcomes in 34,515 patients treated with up to 15 years follow-up P. Sooriakumaran, L. Haendler, T. Nyberg, I. Heus, M. Olsson, S. Carlsson, M. Roobol, P. Wiklund (Stockholm, Sweden; Rotterdam, The Netherlands) 913 Trifecta and SCP classification after robot-assisted radical prostatectomy M.B. Borghesi, V. Ficarra, G. Novara, E. Frumenzio, M. Gan, A. Mottrie (Aalst, Belgium; Padua, Italy) 914 A prospective randomized study to compare functional outcomes of radiofrequency and ultracision scalpels in videolaparoscopic radical prostatectomy A.L. Pastore, G. Palleschi, V. Petrozza, L. Silvestri, A. Leto, A. Ripoli, D. Autieri, A. Carbone (Latina, Italy) 915 Robot-assisted vs open radical prostatectomy: A comparison of outcomes across procedure type and volume quartile J.D. Sammon, S. Sukumar, P. Ravi, K.R. Ghani, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of America) 916 Impact of length of positive surgical margins (PSM) on biochemical recurrence (BCR) after robotic-assisted radical prostatectomy (RARP), in a single center series with a minimum follow-up of five years A. Ploumidis, P. Sooriakumaran, L. Haendler, T. Nyberg, M. Olsson, S. Carlsson, G. Steineck, P. Wiklund (Stockholm, Sweden) 917 Comparative analysis of a consecutive series of 160 brachytherapies and 153 robotic prostatectomies J.M. Conde-Sanchez, C. Garcia-Sanchez, B. Congregado-Ruiz, I. Osman-Garcia, E. Argüelles-Salido, J.M. Pena-Outeiriño, R.A. Medina-Lopez (Seville, Spain) 918 Is robotic assisted radical prostatectomy the real alternative to active surveillance? Results of perioperative and functional outcome analyses A. Gallina, N.M. Passoni, A. Nini, A. Salonia, P. Dell Oglio, M. Tutolo, D. Di Trapani, R. Colombo, R. Damiano, N. Finocchio, V. Scattoni, G. Guazzoni, N. Suardi (Milan, Catanzaro, Italy) Monday 919 Increasing cost-effectiveness in DaVinci-robot-assisted radical prostatectomy by reducing the utilization of robotic and laparoscopic instruments and disposables: Experience of two high-volume robotic European centers A. Haese, B. Rocco (Hamburg, Germany; Milan, Italy) EAU Milan

284 920 SAFE-R: A novel score, accounting for oncological safe nerve-sparing A. Becker, P. Tennstedt, M. Adam, J. Hansen, H. Heinzer, M. Graefen, T. Schlomm (Hamburg, Germany) 921 The impact of trainees on surgical outcomes following robotic assisted radical prostatectomy (RARP) L.S. Lee, B. Thomas, N.C. Shah (Singapore, Singapore; Cambridge, United Kingdom) year oncologic outcomes of endoscopic extraperitoneal radical prostatectomy (EERPE) for prostate cancer: The benefits of a mentored fellowship programme D.W. Good, S.A. McNeill, G.D. Stewart, J.U. Stolzenburg (Edinburgh, United Kingdom; Leipzig, Germany) Monday 284 Programme Book

285 Monday, 18 March - EAU Programme Abstract Session Radical surgery for bladder cancer: Patient outcomes Brown Hall 3 - Level S2 Poster Session 76 Chairs: M. Brausi, Modena (IT) O.W. Hakenberg, Rostock (DE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 923 Results of a prospective study on a new fast track regimen for patients undergoing radical cystectomy for bladder cancer A. Karl, A. Buchner, A. Becker, T. Grimm, C.G. Stief (Munich, Germany) * 924 Comparative performance of comorbidity indices for estimating perioperative and 5-year all-cause mortality following radical cystectomy S. Boorjian, S.P. Kim, M.K. Tollefson, A. Carrasco, J.C. Cheville, R.H. Thompson, P. Thapa, I. Frank (Rochester, United States of America) 925 The prognostic impact of pre-operative hematological disorders and a risk stratification model in bladder cancer patients treated with radical cystectomy T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, T. Koumi, A. Takenaka (Yonago, Matsue, Japan) * 926 Are patients at nutritional risk more prone to complications after major urological surgery? Y. Cerantola, M. Valerio, M. Hubner, K. Iglesias Rutishauser, L. Vaucher, P. Jichlinski (Lausanne, Switzerland) 927 Benefit in regionalization of care for patients treated with radical cystectomy: A nationwide inpatient sample based analyses H. Lavigueur-Blouin, M. Meskawi, F. Roghmann, Z. Tian, N. Hanna, M. Sun (Montreal, Canada; Herne, Germany) 928 Risk factors of hospital readmissions following open radical cystectomy and urinary diversion: Analysis of 1000 consecutive patients S. El-Halwagy, A. Haraz, Y.M. Osman, M. Laymon, A. Mosbah, A. Shaaban (Mansoura, Egypt) 929 Obesity heads to worse outcomes in patients with T1 high grade urothelial carcinoma of the bladder L.A. Kluth, E. Xylinas, J.J. Crivelli, N. Passoni, P.I. Karakiewicz, E. Comploj, A. Pycha, S. Holmang, T. Faison, P. Gontero, Y. Lotan, F.K.H. Chun, R. Dahlem, D.S. Scherr, S.F. Shariat (New York, Dallas, United States of America; Milan, Bolzano, Turin, Italy; Montreal, Canada; Gothenburg, Sweden; Hamburg, Germany) 930 Magnetic resonance imaging: Postoperative anatomic measurements association with urinary continence in orthotopic ileal neobladder after radical cystoprostatectomy for bladder cancer J. Lopater, A. Scherrer, V. Delmas, S. Gey, Y. Neuzillet, T. Lebret (Suresnes, Paris, France) Monday 931 A comparison of 90-day complications between ileal conduit and neobladder reconstruction after radical cystectomy: A multi-institutional retrospective study in Japan R. Matsumoto, T. Abe, N. Takada, N. Shinohara, A. Sazawa, S. Maruyama, T. Osawa, T. Shibata, T. Yutaka, Y. Shinno, S. Sato, H. Matsuda, T. Sato, K. Sugishita, S. Kamota, T. Yamashita, J. Ishizaki, T. Kaneda, S. Kanzaki, G. Mouri, T. Ono, N. Miyajima, T. Sakuta, T. Mochizuki, T. Aoyagi, Y. Kanno, H. Katano, T. Akino, H. Seki, K. Hirakawa, K. Minami, T. Seki, M. Togashi, H. Sano, K. Nonomura (Sapporo, Japan) EAU Milan

286 932 Experimental studies of relationship between configuration and urodynamics of ileal reservoirs Y.J. Yan, Y.F. Shi, J.M. Li, J. Chen, J.H. Liu (Kunmiing, China) 933 In vivo tissue-engineered augmentation cystoplasty with electrospun scaffold made of PCL and PHA: 6 months results in rats A. Vianello, L. Mearini, A. Zucchi, A. Bianco, C. Del Gaudio, G. Bellezza, A. Sidoni, M. Porena (Perugia, Rome, Italy) 934 Impact of nocturnal incontinence and chronic urinary retention after radical cystectomy and neobladder reconstruction on health related quality of life in women M.H. Zahran, A.S. El-Hefnawy, E.M. Zidan, M.A. El-Bilsha, D-E. Taha, B. Ali-El-Dein (Mansoura, Egypt) Summary O.W. Hakenberg, Rostock (DE) Monday 286 Programme Book

287 Monday, 18 March - EAU Programme Abstract Session Prostate cancer cell biology and signaling Amber Hall Level S2 Poster Session 77 Chairs: G. Jenster, Rotterdam (NL) H.Y. Leung, Glasgow (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 935 Activation of HIF1α promotes androgen independent prostate cancer cell growth M. Tran, F. Lo, A. Ramos-Montoya, H. Scott, S. Menon, T. Carroll, M. Osborne, J. Hadfield, S. Cheung, A. Warren, D. Shukla, C. Massie, P. Maxwell, I. Mills, D. Neal (Cambridge, United Kingdom) 936 MiR-221 targets IRF2 and SOCS3 - two negative regulators of the JAK/STAT pathway - and inhibits their expression in prostate cancer M. Spahn, M. Krebs, M. Schubert, H. Riedmiller, B. Kneitz (Berne, Switzerland; Würzburg, Germany) 937 Wnt signaling protein (Wisp2/CCN5) stimulates angiogenesis and invasion in prostate cancer Y. Hashimoto, R. Singh, B. Lokeshwar (Tokyo, Japan; Miami, United States of America) 938 Metformin inhibits the proliferation of human prostate cancer PC-3 cells via down-regulation of the insulin-like growth factor 1 receptor H. Kato, Y. Sekine, Y. Miyazawa, Y. Furuya, H. Koike, K. Suzuki (Maebashi, Japan) 939 ERp46 mediates prostate cancer tumorigenesis in vitro by inhibiting adiponectin-induced tumorsuppressive effects - linking obesity to prostate cancer J. Pinthus, S. Hopmans, A. Paschos, R. Austin, W. Duivenvoorden (Hamilton, Canada) 940 Sonic hedgehog signaling and androgens are linked in tumor-stromal interaction through Epithelial- Mesenchymal Transition (EMT) in prostate cancer progression K. Shigemura, F. Yamamichi, T. Shirakawa, H. Miyake, K. Tanaka, M. Fujisawa (Kobe, Japan) 941 Loss of Dickkopf-3 expression impairs prostate acinar morphogenesis via aberrant TGF-β/Smad signalling activation Y. Kawano, D. Romero, N. Bengoa, N. Maltry, M. Walker, M. Eto, J. Waxman, C. Niehrs, R. Kypta (Kumamoto, Japan; London, United Kingdom; Bilbao, Spain; Heidelberg, Germany) 942 Cancer cell specific transcriptome analysis of stroma-cancer interactions in mouse xenograft models of bone metastasis G.N. Thalmann, J. Hensel, B. Özdemir, A. Wetterwald, M. Delorenzi, M.G. Cecchini (Berne, Lausanne, Switzerland) 943 Epigenetic and transcriptional mechanisms by which MYC regulates rrna levels M. Uemura, S. Yegnasubramanian, W.G Nelson, N. Nonomura, A.M De Marzo (Suita, Japan; Baltimore, United States of America) Monday 944 Computerized quantification and planimetry of prostatic capsular nerves in relation to adjacent cancer foci J. Bründl, S. Schneider, F. Zeman, W.F. Wieland, R. Ganzer (Regensburg, Germany) 945 The genomic evolution of prostate cancer under the selective pressure of anti-androgen therapy J.R. Gsponer, T. Dietsche, A. Rufle, E. Lenkiewicz, T. Zellweger, A. Bachmann, M.T. Barrett, C.A. Rentsch, C. Ruiz, L. Bubendorf (Basel, Switzerland; Scottsdale, United States of America) EAU Milan

288 946 Identification of castrate-resistant cancer repopulating cells in localised prostate tumours D.G. Murphy, R. Toivanen, M. Frydenberg, J. Pedersen, A. Ryan, D. Pook, M. Berman, R.A. Taylor, G.P. Risbridger (Melbourne, Clayton, Mount Waverley, Australia; Kingston, Ontario, Canada) 947 Distinct role of the CTCF-binding site in IGF2/H19-ICR and of the differential methylated region in IGF2- promoter 0 in LOI and IGF2-expression in prostate cancer T. Dansranjavin, F. Wagenlehner, P. Waliszewski, K. Steger, W. Weidner, S. Gattenloehner, U. Schagdarsurengin (Giessen, Germany) Summary H.Y. Leung, Glasgow (GB) Monday 288 Programme Book

289 Monday, 18 March - EAU Programme Abstract Session Nephrectomy for RCC: Minimally invasive techniques, renal function, lymph node dissection and prognostic factors Silver Hall - Level N2 Poster Session 78 Chairs: J. Ramon, Tel Aviv (IL) R.E. Zigeuner, Graz (AT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 948 Hybrid transvaginal natural orifice transluminal endoscopic surgery (NOTES) nephrectomy: Our experience X. Zou, G. Zhang, Y. Xue, R. Xiao, Y. Yuan, G. Wu, X. Wang, D. Long, Y. Wu, F. Liu, Y. Liao (Ganzhou, China) 949 Laparoendoscopic single-site and conventional laparoscopic radical nephrectomy result in an equivalent surgical trauma: Preliminary results of a single-centre retrospective controlled study F. Greco, C. Springer, P. Fornara (Halle Saale, Germany) 950 Novel three-dimensional head-mounted display system (RoboSurgeon System) - application to the initial 60 cases of gasless single-port access urologic surgeries K. Kihara, H. Takeshita, H. Masuda, F. Koga, K. Saito, Y. Matsuoka, N. Numao, Y. Fujii (Tokyo, Japan) 951 Renal functional deterioration caused by radical nephrectomy affect comprehensive prognosis in patients with T1 renal cell carcinoma T. Sejima, H. Iwamoto, T. Masago, S. Morizane, A. Yao, T. Isoyama, A. Takenaka (Yonago, Japan) 952 Lymphadenopathy with renal carcinoma: Pathologic or reactive? A. Raja, H. Stunell, T.F. Aho, S.S. Connolly (Cambridge, United Kingdom) 953 When to perform lymph node dissection in renal cell carcinoma patients: A novel approach to preoperatively assess the risk of lymph node invasion at surgery and nodal progression during follow up U. Capitanio, F. Abdollah, R. Matloob, A. Gallina, F. Pellucchi, A. Russo, P. Capogrosso, M. Moschini, E. Di Trapani, C. Carenzi, M. Roscigno, P. Rigatti, R. Bertini (Milan, Bergamo, Italy) 954 The role of cytoreductive nephrectomy in patients with metastatic renal cell carcinoma (mrcc) who are the candidates for targeted therapy A.V. Klimov, V. Matveev, M. Volkova, V.I. Shirokorad, M. Peters (Moscow, Russia) 955 Preoperative R.E.N.A.L. nephrometry score as a predictor of pathologic stage in renal cell carcinoma J.Y. Chae, J.W. Kim, J.W. Kim, M.M. Oh, D.G. Moon, C.Y. Yoon (Seoul, South Korea) 956 Benefit in regionalization of care for patients treated with nephrectomy: A nationwide inpatient sample A. Abdo, N. Hanna, P.I. Karakiewicz, A. Becker, F. Roghmann, M. Meskawi, Q-D. Trinh (Montreal, Canada; Hamburg, Herne, Germany) Monday 957 The impact of non-clear cell histology on outcome for patients with renal cell carcinoma and venous tumor thrombus S. Boorjian, D. Kaushik, R.H. Thompson, M.S. Eisenberg, C.M. Lohse, J. Cheville, B.C. Leibovich (Rochester, United States of America) 958 Prognostic factors and risk groups in primary extensive renal cell carcinoma A.V. Poluyanchik, L.V. Mirylenka, O.G. Sukonko, A.I. Rolevich, A. Minich (Minsk, Belarus) EAU Milan

290 959 Visceral obesity is associated with better recurrence-free survival after surgeries for localized clear cell renal cell carcinoma G. Kaneko, A. Miyajima, K. Yuge, M. Hasegawa, E. Kikuchi, K. Nakagawa, M. Oya (Tokyo, Japan) 960 Conditional survival of patients with renal cell carcinoma treated with nephrectomy: A population based analysis M. Bianchi, H. Lavigueur-Blouin, A. Becker, Z. Tian, F. Roghmann, N. Hanna, M. Sun (Montreal, Canada; Hamburg, Herne, Germany) Monday 290 Programme Book

291 Monday, 18 March - EAU Programme Abstract Session Stones: PCNL Red Hall 1 - Level N1 Poster Session 79 Chairs: V. Bucuras, Timisoara (RO) G. Giusti, Milan (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 961 Mini-percutaneous nephrolithotomy for upper urinary tract calculi in children (report of 134 cases) D.Z. Long, X.F. Zou, Y.T. Wu, R.H. Xiao, Y.H. Yuan, X.N. Wang, G.X. Zhang, G.Q. Wu, J. Yang, Y.J. Xue (Ganzhou, China) 962 Minimal invasive PCNL (MPCNL) update on efficacy and safety after 745 consecutive patients V. Zimmermanns, I. Aydin, P. Liske, P. Ober, S. Lahme (Pforzheim, Germany) 963 A prospective randomized study of prone versus The Barts flank free modified supine position for percutaneous nephrolithotomy (PCNL) C. Bach, S. Kachrilas, A. Goyal, F. Zaman, A. Bourdoumis, R. McGregor, N. Buchholz, J. Masood (London, United Kingdom; Montego Bay, Jamaica) 964 Efficacy and safety in the treatment of large renal calculi with minimally invasive or conventional large bore PCNL: A retrospective comparison of two longitudinal databases M.F. Abdelhafez, G. Wendt-Nordahl, J. Bedke, B. Amend, P. Honeck, A. Stenzl, T. Knoll, D. Schilling (Tübingen, Boeblingen, Germany) 965 Withdrawn 966 Endovascular treatment of percutaneous nephrolithotomy haemorrhagic complications V. Jinga, S. Youssef, B. Braticevici, M. Mohanad, D. Diaconescu, D. Radavoi (Bucharest, Romania) 967 Does body mass index impact the outcomes of tubeless percutaneous nephrolithotomy? N. Kuntz, A. Neisius, G. Astroza, M. Tsivian, M. Iqbal, M. Ferrandino, G. Preminger, M. Lipkin (Durham, United States of America; Santiago, Chile) 968 Percutaneous renal collecting system access using a novel electromagnetic tracking: First experience in vivo pig model E.A. Rodrigues De Lima, C. Oliveira, P. Rodrigues, E. Dias, J. Correia-Pinto, J. Vilaça (Braga, Braga- Guimarães, Portugal) 969 Inferior renal displacement using ureteric balloon catheter -UBC technique- in accessing supracostal calyces during start to finish prone PCNL A. Vint, K Nalagatla (Airdrie, United Kingdom) Monday 970 Management of caliceal diverticulum with stones - our experience A.K. Chawla (Manipal, India) 971 Percutaneous nephrolithotripsy in the Galdakao-modified supine versus prone position K. Petkova, I. Saltirov, T. Petkov (Sofia, Bulgaria) 972 Standard-tract combined with mini-tract in percutaneous nephrolithotomy for renal staghorn calculi Y.B. Wang, N. Xu, H.F. Zhang, C.X. Wang (Changchun, China) EAU Milan

292 973 Percutaneous nephrolithotomy without hydrodistension M. Villalobos-Gollas, E. Cruz-Nuricumbo, L. Gómez-De-Regil (Merida, Mexico) 974 Is standard percutaneous nephrolithotomy still standard? Comparison of surgical outcomes between tubeless and standard percutaneous nephrolithotomy J.K. Oh, C.H. Kim, S.C. Lee, K.T. Kim, T.B. Kim, K.H. Kim, S.J. Yoon, H. Jung (Incheon, South Korea) Monday 292 Programme Book

293 Monday, 18 March - EAU Programme Abstract Session Renal tumours: Drug related basic research Red Hall 2 - Level N1 Poster Session 80 Chairs: F. Birkhäuser, Berne (CH) T. Klatte, Vienna (AT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. 975 Pre-clinical trial of a new dual mtor inhibitor: INK128 for renal cell carcinoma A. Ingels, A. Thong, M. Saar, M.P. Valta, R. Nolley, J. Santos, H. Zhao, D. Peehl (Stanford, United States of America) 976 Panobinostat and bortezomib inhibit renal cancer growth in vitro and in vivo by inducing endoplasmic reticulum stress and ubiquitinated protein accumulation synergistically A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan) 977 Ritonavir, a potent inhibitor of CYP3A4, enhances the anticancer effects of panobinostat in renal cancer cells in vitro and in vivo A. Sato, T. Asano, K. Ito, T. Asano (Tokorozawa, Japan) 978 A novel therapeutic approach for renal cell cancer cells using orally available phenylpiperazine derivative naftopidil Y. Iwamoto, H. Kanda, M. Kato, T. Sasaki, K. Ishii, K. Arima, T. Shiraishi, Y. Sugimura (Tsu, Japan) 979 Zoledronic acid sensitizes renal cell carcinoma cells to radiation by downregulating STAT1 T. Kijima, F. Koga, Y. Fujii, S. Yoshida, M. Tatokoro, K. Kihara (Tokyo, Japan) * 980 Optimization of Lutetium-177-G250 radioimmunotherapy in an intraperitoneal clear cell renal cell carcinoma xenograft model C.H.J. Muselaers, O.C. Boerman, D.L. Bos, W.J.G. Oyen, E. Oosterwijk, P.F.A. Mulders (Nijmegen, The Netherlands) 981 Predictive value of angiogenic biomarkers in tuberous sclerosis complex (TSC) patients with renal angiomyolipoma (AML) K. Budde, J.C. Kingswood, T. Brechenmacher, K. Stein, D. Chen, J.J. Bissler (Berlin, Germany; Brighton, United Kingdom; Rueil-Malmaison, France; East Hanover, New Jersey, Cincinnati, Ohio, United States of America) 982 Sorafenib enhances the anti-tumor effect of anti-ctla-4 antibody to kidney cancer T. Motoshima, Y. Komohara, Y. Kawano, Y. Wada, M. Eto (Kumamoto, Japan) 983 Acquired resistance to sunitinib in human renal cell carcinoma cells is mediated by constitutive activation of signal transduction pathways associated with tumor cell proliferation H. Miyake, I. Sakai, M. Fujisawa (Kobe, Japan) Monday * 984 Potential predictive markers for a response to sunitinib and their association with survival of patients with metastatic renal cell carcinoma J. Dornbusch, M. Meinhardt, K. Erdmann, A. Zacharis, S. Zastrow, S. Füssel, M.P. Wirth (Dresden, Germany) EAU Milan

294 985 Acquired resistance to temsirolimus in human renal cell carcinoma cells is mediated by constitutive activation of signal transduction pathways through mammalian target of rapamycin complex-2 K. Harada (Kobe, Japan) 986 Relationship between sunitinib effect and immature blood vessel ratio in metastatic renal cell cancer B.H. Kim, C.I. Kim, J.Y. Ha, C.H. Park, K.H. Kim, M.S. Choe, H.R. Jung (Daegu, Gyeongju, South Korea) Monday 294 Programme Book

295 Monday, 18 March - EAU Programme Abstract Session How to diagnose LUTS, BPH and obstruction? Blue Hall Level N1 Poster Session 81 Chairs: G. Novara, Padua (IT) D.S. Park, Sungnam (KR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. 987 Withdrawn 988 Obesity associated with larger prostate volume but not with worse urinary symptoms: Analysis of a large cohort undergoing trans-rectal ultrasound B. Bhindi, G. Trottier, K. Fernandes, K.M. Hersey, A. Finelli, J. Trachtenberg, A. Toi, A. Evans, T.H. Van Der Kwast, N.E. Fleshner (Toronto, Canada) 989 Body mass index predicts failure of surgical management in benign prostate hyperplasia J.M. Willder, V. Walker, G.L. Halbert, C.P.C. Dick, C. Orange, T. Qayyum, P.G. Horgan, M.A. Underwood, J. Edwards (Glasgow, United Kingdom) 990 Prediction of bladder outlet obstruction: Development of a clinical nomogram C. De Nunzio, R. Autorino, A. Bachmann, A. Briganti, S. Carter, F. Chun, G. Novara, R. Sosnowski, N. Thiruchelvam, A. Tubaro, S. Ahyai (Rome, Naples, Milan, Padua, Italy; Basel, Switzerland; London, Cambridge, United Kingdom; Hamburg, Germany; Warsaw, Poland) 991 Clinical predictors of bladder outlet obstruction in men with acute urinary retention M. Rom, M.J. Waldert, H-C. Klingler, T. Klatte (Vienna, Austria) 992 Identification of prevalence and combined risk-factors for LUTS and ED in a population of 50plus: Results of a health-screening project with validated questionnaires A. Ponholzer, C. Wehrberger, S. Madersbacher (Vienna, Austria) * 993 Can ultrasound replace urodynamics in the study of bladder outlet obstruction? A prospective study and development of a clinical score A. Ciudin, M.G. Diaconu, L. Peri, E. Garcia-Cruz, D. Gosalbez, A. Carrion, A. Garcia-Larrosa, A. Gomez, A. Franco, A. Alcaraz (Barcelona, Viladecans, Spain) 994 Reliability of estimating nocturia based on IPSS J.W. Kim, M.M. Oh, J.W. Kim, J.Y. Chae, C.Y. Yoon, D.G. Moon (Seoul, South Korea) 995 Noninvasive monitoring of detrusor contractions using ultrasound T. Idzenga, F. Farag, J.P.F.A. Heesakkers, W.F.J. Feitz, C.L. De Korte (Nijmegen, The Netherlands) 996 Free uroflowmetry vs do-it-yourself uroflowmetry in the assessment of patients with lower urinary tract symptoms G. Mombelli, D. Ratti, L. Carmignani (Magenta (Milan), San Donato (Milan), Italy) Monday 997 Usefulness of prostate volume estimation by CT using ellipsoid formula J.H. Jung, Y.J. Kim, S.H. Ryang, T.W. Kang, H.C. Chung, Y.Y. Park, J.M. Song (Wonju, Seoul, South Korea) EAU Milan

296 998 The combination of values obtained by transrectal ultrasonography is useful for predicting bladder outlet obstruction in patients with lower urinary tract symptoms suggestive of benign prostatic hyperplasia T. Suzuki, A. Otsuka, Y. Kurita, H. Shinbo, R. Matsumoto, S. Takada, S. Ozono (Hamamatsu, Japan) Monday 296 Programme Book

297 Monday, 18 March - EAU Programme Abstract Session Male incontinence: Prediction and management Yellow Hall Level N1 Poster Session 82 Chairs: R. Bauer, Munich (DE) P. Rehder, Innsbruck (AT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 999 Safety, efficacy and QOL in a European multi-center prospective study of the AdVance male sling: 2-year results D. De Ridder, P. Chauveau, R.M. Bauer, H. Fassi-Fehri, O. Haillot, P. Arano, A.N. Bader, F. Haab (Leuven, Belgium; Nantes, Lyon, Tours, Paris, France; Munich, Germany; Barcelona, Spain; Minnetonka, United States of America) * 1000 Influence of pre- and post versus postoperative pelvic floor muscle training on urinary incontinence after open and robotic radical prostatectomy: A randomized controlled trial I. Geraerts, H. Van Poppel, N. Devoogdt, S. Joniau, B. Van Cleynenbreugel, M. Van Kampen (Leuven, Belgium) 1001 Changes of pelvic floor muscles and bladder neck before and after obtaining continence after radical prostatectomy D.W. Sohn, J.S. Chung, J.Y. Joung, K.H. Lee, H.K. Seo (Seoul, Goyang, South Korea) 1002 Treatment of stress urinary incontinence: Outcome and risk factor analysis of AMS 800 : A prospective analysis T.A. Ludwig, R. Dahlem, P. Reiss, S. Riechardt, M. Fisch, S.A. Ahyai (Hamburg, Germany) 1003 Development and validation of nomograms to predict the recovery of urinary continence after radical prostatectomy: Comparisons between immediate, early, and late continence S.J. Jeong, H.S. Lee, K.B. Kim, J.K. Lee, B.K. Lee, J.W. Jeong, W.H. Cha, S.C. Lee, C.W. Jeong, S.K. Hong, S-S. Byun, S.E. Lee (Seongnam, Gyeonggi, South Korea) 1004 Primary artificial urinary sphincter implantation for male non-neurogenic stress urinary incontinence: Early and midterm results of a multicenter contemporary series J-N.L. Cornu, M.J. Drake, F. Haab, E. Haab, S.A. Ahyai, L. Kluth, R.K. Lee, B. Chughtai, A. Bachmann, N. Thiruchelvam, J.I. Martínez-Salamanca, S. Larré, T. Pichon, C. De Nunzio, M. Favro, R.M. Bauer, F. Van Der Aa (Paris, Reims, Angers, France; Bristol, Cambridge, United Kingdom; Hamburg, Munich, Germany; New York, United States of America; Basel, Switzerland; Madrid, Spain; Rome, Novara, Italy; Leuven, Belgium) 1005 Anticholinergics improved voiding symptom after radical prostatectomy in patients with prostate cancer J. Kim, S. Pak, M. Shim, J. Park, S.M. Lee, K.O. Huh, C. Song, M-S. Choo, H. Ahn (Seoul, Daejeon, South Korea) Monday 1006 The impact of 3 week clinical rehabilitation program after radical prostatectomy on early continence status M. Adam, E. Eichelberg, L. Budäus, G. Salomon, H. Isbarn, T. Steuber, T. Schlomm, U. Michl, H. Heinzer (Hamburg, Germany) EAU Milan

298 1007 Intensive preoperatory Pelvic Floor Muscle Training reduce duration and severity of stress urinary incontinence after radical prostatectomy: A randomized controlled trial A. Collado Serra, M. Pellicer Cabo, M. Ramirez Backhaus, J. Dominguez-Escrig, J. Rubio-Briones, A. Gomez- Ferrer, I. Iborra Juan, J. Casanova Ramón-Borja, J.V. Ricos Torrent, J.L. Monros Lliso, R. Dumont Martinez, E. Solsona Narbón (Valencia, Spain) 1008 Anatomic evaluation with 3T magnetic resonance imaging of continent and incontinent patients treated with advance male sling D. Pistolesi, V. Zampa, C. Gozzi, M. Santarsieri, I. Bardelli, C. Mariani, L. Faggioni, C. Bartolozzi, C. Selli (Pisa, Bressanone, Italy) 1009 More than 3 years of clinical experience with an adjustable transobturator male system (ATOMS) for treatment of stress urinary incontinence after radical prostatectomy: Results of a multicenter prospective observational study R. Hoda, G. Primus, C. Brössner, W. Bauer (Kleinmachnow, Germany; Graz, Vienna, Austria) 1010 Preoperative sphincter function and morphology of prostate apex influence recovery of urinary continence after radical prostatectomy J. Kim, S. Pak, M. Shim, J. Park, C. Song, H. Ahn (Seoul, Daejeon, South Korea) Monday 298 Programme Book

299 Monday, 18 March - EAU Programme Special Session European Urological Scholarship Programme (EUSP) Session Amber Hall Level S2 Chairs: L. Martínez Piñeiro, Madrid (ES) V. Mirone, Naples (IT) Introduction V. Mirone, Naples (IT) Presentations of sections - Centres of excellence - New directions and opportunities ESAU Andrological Urology W.H.G. Weidner, Giessen (DE) ESFFU Female and Functional Urology J.P.F.A. Heesakkers, Nijmegen (NL) ESTU Transplantation Urology A.J. Figueiredo, Coimbra (PT) ESUR Urological Research Z. Culig, Innsbruck (AT) ESGURS Reconstructive Urology Surgeons S. Deger, Ostfildern (DE) ERUS Robotic Urology A. Mottrie, Aalst (BE) ESOU Oncological Urology M. Brausi, Modena (IT) ESUI Urological Imaging J. Walz, Marseille (FR) EULIS Urolithiasis P.J. Osther, Fredericia (DK) ESIU Infections in Urology T.E. Bjerklund Johansen, Århus (DK) ESUT Uro-Technology J. Rassweiler, Heilbronn (DE) Award presentation: Best scholar V. Mirone, Naples (IT) Monday Poster viewing and EUSP get together EAU Milan

300 Monday, 18 March - EAU Programme Abstract Session Highlights & awards euro Auditorium - Level S2 Video Session 10 Chairs: A. Messas, Nanterre (FR) P.A. Geavlete, Bucharest (RO) All presentations have a maximum length of 10 minutes, followed by 4 minutes of discussion. V73 V74 V75 V76 Laparoscopic construction of continent Mitrofanoff appendicovesicostomy: Saint Augustin technique D. Rey, M. Oderda, E. Helou, L. Lopez, P-T. Piechaud (Bordeaux, France) Single incision pyeloplasty results of the initial 22 cases F. Imkamp, M.A. Kuczyk, U. Nagele, T.R.W. Herrmann (Hanover, Germany; Hall in Tirol, Austria) Deep bladder endometriosis: Laparoscopic partial cystectomy with endoscopic delimitation R. Cabello, C. Quicios, C. Simón, P. Charry, M. Rodríguez, C. González (Madrid, Spain) Robotic assisted lego construction for microsurgical skills training A. Gudeloglu, J. Brahmbhatt, K. Priola, S. Parekattil (Winter Haven, United States of America) Prize winning videos V77 V78 V79 Third Video Prize Alternative solution to current MIS robotic system S. Crouzet (Lyon, France) Second Video Prize Sequential occlusion angiography using contrast enhanced ultrasound scan (CEUS) demonstrating the avascular plane of Brodel: An adjunct to a novel technique of zero-ischaemia robot-assisted partial nephrectomy A.R. Rao, R. Gray, H. Motiwala, M. Laniado, O. Karim (Wexham, United Kingdom) First Video Prize Novel surgical tile-pro navigation with 3D prostate cancer model during robot-assisted radical prostatectomy O. Ukimura, A.L. De Castro Abreu, M. Nakamoto, S. Shoji, S. Leslie, A. Berger, A. Goh, M. Desai, M. Aron, I. Gill (Los Angeles, United States of America) Monday 300 Programme Book

301 Monday, 18 March - EAU Programme Abstract Session Prostate cancer treatment: Comorbidities and complications Brown Hall Level S2 Poster Session 83 Chairs: M. Graefen, Hamburg (DE) R.E. Sanchez Salas, Paris (FR) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion Health-related quality of life after radical prostatectomy is independent of patient s age and comorbidities K. Herkommer, H. Schulwitz, T. Klorek, S. Schmid, C. Hofer, J.E. Gschwend, M. Kron (Munich, Ulm, Germany) 1012 Analysis on overall, cancer-specific and non-cancer-specific survivals according to Charlson comorbidity index in prostate cancer patients who underwent radical prostatectomy J.Y. Lee, K.H. Kim, J.W. Park, R.R. Diaz, K.H. Kim, H.Y. Lee, W.S. Ham, N.H. Cho, Y.D. Choi, K.S. Cho (Seoul, South Korea) 1013 Perioperative and early oncological outcomes after robotic assisted radical prostatectomy in morbidly obese patients: A propensity matched study H. Abdul-Muhsin, C. Giedelman, S. Samavedi, O. Schatloff, S. Chauhan, A. Sivaraman, R. Coelho, K. Palmer, G. Ebra, V. Patel (Celebration, United States of America) 1014 The impact of abdominal obesity on surgical complications and functional outcomes in men treated with radical prostatectomy for prostate cancer: Results of an Italian multicentre survey (M.I.R.R.O.R.) M. Gacci, A. Sebastianelli, M. Salvi, C. De Nunzio, R. Schiavina, A. Simonato, A. Tubaro, V. Mirone, M. Carini, G. Carmignani (Florence, Rome, Bologna, Genova, Naples, Italy) 1015 Cardiovascular disease and prostate cancer: A competing-risks analysis J. Hansen, F.K. Chun, M. Rink, S.F. Shariat, M. Graefen, M. Sun (Hamburg, Germany; New York City, United States of America; Montreal, Canada) 1016 Is extended venous thrombo-embolism pharmacological prophylaxis required following laparoscopic radical prostatectomy? B. Horsburgh, V. Srinivasan (Denbighshire, United Kingdom) 1017 Prospective randomized study comparing transperitoneal and extraperitoneal approach during robotic prostatectomy: Anesthesiologic effects F. Dal Moro, C. Valotto, A. Mangano, R. Soncin, A. Crestani, A. Guttilla, G.M. Pittoni, F. Zattoni (Padua, Italy) 1018 Difficult radical prostatectomy did not cause inferior functional outcome U.H.G. Michl, M. Graefen, A. Haese, G. Salomon, H. Heinzer, T. Schlomm, T. Steuber, H. Huland (Hamburg, Germany) 1019 Invasiveness and post aggression metabolism in DaVinci prostatectomies - the ipod study A. Martinschek, L. Stumm, M. Ritter, E. Heinrich, L. Trojan (Ulm, Mannheim, Göttingen, Germany) Monday 1020 Characterization, incidence and severity of surgical complications using Clavien system in patients treated with minimally invasive radical prostatectomy A.M. Autran, R.E. Sanchez Salas, E. Barret, F. Rozet, D. Prapotnich, M. Galiano, N. Cathala, A. Mombet, F. Secin, X. Cathelineau (Paris, France; Buenos Aires, Argentina) EAU Milan

302 1021 The Clavien-Dindo classification of complications used for a comparison between retropubic, endoscopic and robot-assisted radical prostatectomy on the basis of a matched-pair analysis M. Hiess, C. Seitz, A. Ponholzer, M. Lamche, P. Schramek (Vienna, Austria) 1022 Bilateral peritoneal incision in open retropubic prostatectomy does not seem to lower rates of symptomatic lymphoceles J. Mundhenk, F. Miller, J. Hennenlotter, L.F. Arenas Da Silva, T. Todenhoefer, G. Gakis, C. Schwentner, A. Stenzl, D. Schilling (Tübingen, Germany) 1023 Impact of a polysaccharide hemostat on bleeding complications and pelvic lymphocele rates after radical prostatectomy: Initial results of a prospective randomized trial B. Beyer, S-R. Leyh-Bannurah, H. Isbarn, P. Tennstedt, G. Salomon, U. Michl, H. Heinzer, H. Huland, M. Graefen, L. Budäus (Hamburg, Germany) 1024 Re-assessment of 30-, 60- and 90-day mortality rates in non-metastatic prostate cancer patients treated either with radical prostatectomy or radiation therapy M. Meskawi, A. Abdo, H. Lavigueur-Blouin, Z. Tian, F. Roghmann, P.I. Karakiewicz (Montreal, Canada; Herne, Germany) Monday 302 Programme Book

303 Monday, 18 March - EAU Programme Abstract Session Radical surgery for bladder cancer: Technical aspects Brown Hall 3 - Level S2 Poster Session 84 Chairs: H. Abol-Enein, Mansoura (EG) E. Solsona, Valencia (ES) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion Promising approach in the treatment of bladder cancer: Radical cystectomy and urinary diversion in regional anesthesia M. Friedrich-Freksa, E. Schulz, T. Nitzke, O. Wenzel, G. Popken (Berlin, Germany) 1026 A restrictive fluid regimen combined with norepinephrine during open radical cystectomy decreases the postoperative complication rate and accelerates recovery F.C. Burkhard, U.E. Studer, G.N. Thalmann, P.Y. Wüthrich (Berne, Switzerland) 1027 Withdrawn 1028 Factors predicting acute kidney injury and wound complications after open radical cystectomy: Analysis of 1000 patients Y.M. Osman, A.M. Harraz, S. El-Halwagy, M. Laymon, T. Samir, A. Mosbah, A. Shaaban (Mansoura, Egypt) 1029 Transurethral resection of bladder tumour (TURBT) causes seeding of cancer cells into patient blood stream H. Engilbertsson, O. Patschan, S. Björnsson, T. Kristmundsson, L. Rydén, K. Aaltonen, S. Gudjónsson (Malmö, Lund, Sweden) 1030 Pilot feasibility study of umbilical laparoendoscopic single-site radical cystectomy for muscle-invasive bladder cancer with additional 10 mm trocar and extracorporeal urinary diversion J.C. Angulo, P. Cabrera, E. Mateo, G. Andres, A. Garcia-Tello, F. Ramon De Fata (Madrid, Spain) 1031 Intra-corporeal versus extra-corporeal urinary diversion after robot-assisted radical cystectomy: Results from the International Robotic Cystectomy Consortium K. Ahmed, S.A. Khan, M.H. Hayn, A.P. Stegemann, P.K. Agarwal, K.K. Badani, M.D. Balbay, E.P. Castle, P. Dasgupta, R. Ghavamian, K. Guru, A.K. Hemal, B.K. Hollenbeck, D. Josephson, A.K. Kader, A.S. Kibel, M. Menon, A. Mottrie, K. Nepple, J.G. Pattaras, J.O. Peabody, V. Poulakis, R.S. Pruthi, J. Palou Redorta, K.H. Rha, L. Richstone, M. Saar, D.S. Scherr, S. Siemer, M. Stöckle, A.Z. Weizer, P. Wiklund, T. Wilson, M. Woods, M.S. Khan (London, United Kingdom; Portland, Buffalo, Bethesda, New York, Scottsdale, Bronx, Winston-Salem, Ann Arbor, Duarte, San Diego, St. Louis, Detroit, Atlanta, Chapel Hill, Newark, Maywood, United States of America; Istanbul, Turkey; Aalst, Belgium; Athens, Greece; Barcelona, Spain; Seoul, South Korea; Homburg, Germany; Stockholm, Sweden) 1032 Influence of institution volume on outcomes after robot-assisted radical cystectomy: An analysis of 1118 patients from the International Robotic Cystectomy Consortium S.A.A. Khan, K. Ahmed, S. Shariat, P.K. Agarwal, K.K. Badani, D. Balbay, E.P. Castle, P. Dasgupta, K.A. Guru, M.H. Hayn, A.K. Hemal, D. Josephson, A.K. Kader, A.S. Kibel, A. Mottrie, K.G. Nepple, J.G. Pattaras, J.O. Peabody, V. Poulakis, R.S. Pruthi, J. Palou, K-H. Rha, L. Richstone, M. Saar, A.P. Stegemann, M. Stoeckle, E.M. Wallen, P. Wiklund, T. Wilson, M. Woods, B. Yuh, D.S. Scherr (London, United Kingdom; New York, Detroit, Scottsdale, Buffalo, Winston-Salem, Duarte, St. Louis, Saint Louis, Atlanta, Detroit, Chapel Hill, New Hyde Park, Buffalo, Duarte, Maywood, United States of America; Ankara, Turkey; Aalst, Belgium; Athens, Greece; Redorta, Barcelona, Spain; Seoul, South Korea; Homburg, Germany; Stockholm, Sweden) Monday EAU Milan

304 1033 A pilot prospective single-centre 3-arm randomised controlled trial of open, robotic and laparoscopic (CORAL) radical cystectomy for bladder cancer C. Gan, F. Ismail, G. Cheung, A. Patel, P. Dasgupta, P. Rimington, J. Watkins, T. O Brien, P. Hegarty, M.S. Khan (London, Eastbourne, United Kingdom) 1034 Comparative study between laparoscopic and open radical cystectomy with orthotopic ileal reservoir E. Mateo, A. Garcia-Tello, F. Caceres, I. Romero, M. Sanchez Chapado, J.C. Angulo (Madrid, Spain) 1035 The Karolinska experience in 67 robot-assisted radical cystectomies with totally intracorporeal formation of an ileal neobladder. Oncological and complication outcomes S. Tyritzis, J. Collins, D. Khazaeli, M. Jonsson, C. Adding, A. Hosseini-Aliabad, N.P. Wiklund (Stockholm, Sweden) 1036 Laparoscopic radical cystectomy with prostate capsule sparing. Oncologic and functional results: Our experience J. Gómez Rivas, S. Alonso Y Gregorio, D. López Sánchez, A. Tabernero Gómez, J. Cisneros Ledo, J.J. De La Peña Barthel (Madrid, Spain) 1037 Oncological outcomes with a median follow-up of 32 months after laparoscopic radical cystectomy for bladder cancer T.J.N. Hermans, S. Van Aarle, L.M.C.L. Fossion (Veldhoven, The Netherlands) 1038 Extended versus super-extended PLND during radical cystectomy: Comparison of two prospective series G. Simone, H. Abol Enein, M. Ferriero, R. Papalia, S. Guaglianone, A. Mosbah, M. Abdel-Latif, M. Abdelrahim, M. Ghoneim, M. Gallucci (Rome, Italy; Mansoura, Egypt). Monday 304 Programme Book

305 Monday, 18 March - EAU Programme Abstract Session Prostate cancer biomarkers and outcome prediction Amber Hall Level S2 Poster Session 85 Chairs: B. Djavan, Vienna (AT) G.N. Thalmann, Berne (CH) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 1039 Genetic testing in identification of BPH patients developing later prostate cancer L. Saaristo, T. Wahlfors, J. Schleutker, H. Lilja, T. Tammela, M. Matikainen (Tampere, Turku, Helsinki, Finland) 1040 Expression of candidate susceptibility genes in the development and progression of prostate cancer C. Debiais-Delpech, J. Godet, N. Pedretti, J. Irani, X. Cathelineau, G. Fromont (Poitiers, Gençay, Paris, France) 1041 Neurofuzzy system for prostate cancer risk evaluation L. Benecchi, F. Bocchi, M. Potenzoni, F. Russo, L. Perucchini, M. Quarta, M. Tonghini, P. Bocchi, C. Del Boca (Cremona, Parma, Italy) 1042 Detection of prostate cancer associated α2,3 sialyated free PSA in serum is more higher specificity than conventional PSA test T. Yoneyama, Y. Tobisawa, K. Mori, S. Hatakeyama, H. Yamamoto, T. Okamoto, A. Okamoto, F. Ishimura, T. Yoneyama, T. Koie, N. Kamimura, C. Ohyama (Hirosaki, Japan) 1043 Association of blood level omega-3 fatty acids with risk of prostate cancer: A meta-analysis M. Chua, M.C. Sio, M. Sorongon, M.J. Morales (Quezon City, Philippines) 1044 Frequency and prognostic significance of TMPRSS2-ERG gene fusion in prostate cancers with positive lymph nodes A. Fleischmann, I. Zlobec, T. Visakorpi, G.N. Thalmann (Berne, Switzerland; Tampere, Finland) * 1045 Urinary PCA3 and TMPRSS2:ERG help predict biopsy outcome prior to initial prostate biopsy using a risk group analysis J.R. Day, L.A. Jones, S.E. Meyer, P.N. Hodge, J. Aussie, D.R. Saltzstein, J.C. Groskopf (San Diego, San Antonio, United States of America) 1046 A new medical device for in vivo isolation of circulating tumor cells in prostate cancer patients G. Theil, M.R. Hoda, K. Fischer, K. Haubold, T. Krahn, N.G. Morgenthaler, K. Lücke, P. Fornara (Halle/Saale, Potsdam, Berlin, Germany) 1047 Expression of epithelial-mesenchymal transition markers in localized prostate cancer: Impact on clinicopathological outcomes in patients undergoing radical prostatectomy H. Miyake, H. Behnsawy, M. Fujisawa (Kobe, Japan) Monday 1048 CSAG4 and NOL4 are novel biomarkers to indicate aggressiveness of prostate cancer S. Takahashi, T. Shiraishi, B.J. Trock, P. Kulkarni, R. Getzenberg, T. Tominaga, Y. Homma (Tokyo, Japan; Maryland, United States of America) EAU Milan

306 1049 RANKL pathway proteins as risk parameters for biochemical recurrence in patients undergoing radical prostatectomy T. Todenhöfer, J. Hennenlotter, A. Wald, P. Leidenberger, G. Blumenstock, S. Aufderklamm, J. Mundhenk, G. Gakis, U. Kühs, A. Hohneder, A. Stenzl, C. Schwentner (Tübingen, Germany) 1050 Prostate cancer microparticles: A novel blood based prognosticator of metastasis A. Al-Zahrani, H.S. Leong, V. Yutkin, N. Power, J. Izawa, J. Lewis, J. Chin (Dammam, Saudi Arabia; London, Edmonton, Canada) Aims and objectives There is an increasing number of potential biomarkers in prostate cancer. Most contributions in this session focus on combining information obtained by analysis of several markers in order to identify a more aggressive disease and assess the risk. Monday 306 Programme Book

307 Monday, 18 March - EAU Programme Abstract Session Evolving concepts in testicular cancer Silver Hall - Level N2 Poster Session 86 Chairs: N. Nicolai, Milan (IT) A.R. Zlotta, Toronto (CA) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion Multi-focality of testicular germ cell tumours the findings of the last 100 cases at a tertiary referral centre J.W.R. Douglas, S. Dockree, M. Hayes, J. Theaker (Southampton, United Kingdom) * 1052 Differentiation of microvessels and lymphatic vessels in non seminomatous testicular germ cell tumors using lymph specific markers: Morphologic characteristics and clinical implications J. Heinzelbecker, M. Gross-Weege, C. Weiss, M. Liebhardt, M. Trunk, A. Haecker, C. Bolenz (Mannheim, Germany) * 1053 External validation of the Heidenreich criteria for the selection of patients for unilateral or bilateral post chemotherapy retroperitoneal lymph node dissection for residual masses of testicular cancer C. Vallier, P-H. Savoie, J.R. Delpero, F. Bladou, G. Gravis, N. Salem, J. Walz (Marseille, Toulon, France; Montreal, Canada) 1054 Bilateral laparoscopic post-chemotherapy retroperitoneal lymph-node dissection in non-seminomatous germ cell tumors a comparison to template dissection S. Aufderklamm, T. Todenhöfer, J Hennenlotter, J. Mischinger, G. Gakis, J. Mundhenk, J. Bedke, A. Stenzl, C. Schwentner (Tübingen, Germany) 1055 Modified cisplatin, etoposide and ifosfamide (PEI) salvage therapy for male germ-cell tumors (GCT). Longterm efficacy and safety outcomes A. Necchi, L. Mariani, N. Nicolai, D. Raggi, E. Farè, P. Giannatempo, L. Piva, D. Biasoni, M. Catanzaro, T. Torelli, S. Stagni, G. Pizzocaro, A. Gianni, R. Salvioni (Milan, Italy) 1056 Sequential chemotherapy for advanced testicular cancer, Japanese high volume center experience T. Nakamura, Y. Kimura, T. Ueda, Y. Naya, F. Hongo, T. Miki (Kyoto, Japan) 1057 Persistence of CD30 expression by embryonal carcinoma (EC) in the treatment time course. A retrospective series of multi-relapsing germ-cell tumors (GCT) P. Giannatempo, M. Colecchia, B. Paolini, N. Nicolai, D. Raggi, E. Farè, M. Catanzaro, D. Biasoni, T. Torelli, S. Stagni, L. Piva, R. Salvioni, A. Gianni, A. Necchi (Milan, Italy) 1058 Favorable long-term outcome in 21 patients with inguinoscrotal sarcomas M. Fröhner, R.R. Schober, A. Lossnitzer, M.P. Wirth (Dresden, Germany) Monday 1059 Elastography shows promise in cancer testicular detection A. Marsaud, C. Raffaelli, X. Carpentier, N. Mentine, M. Durand, E. Fontas, J.F. Michiels, J. Amiel, D. Chevallier (Nice, France) EAU Milan

308 1060 Thoracic metastectomy for nonseminomatous testicular tumors (NSTT): Long term survival and prognostic factors D. Argirovic, A. Argirovic, V. Stanic (Belgrade, Serbia) Summary N. Nicolai, Milan (IT) Monday 308 Programme Book

309 Monday, 18 March - EAU Programme Abstract Session Stones: URS and stents Red Hall 1 - Level N1 Poster Session 87 Chairs: B. Dore, Poitiers (FR) A. Tasca, Vicenza (IT) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 1061 Flexible ureteroscopy for upper urinary tract calculi in children Y. Wu, X. Zou, R. Xiao, Y. Yuan, X. Wang, G. Zhang, G. Wu, D. Long, J. Yang, Y. Xue (Ganzhou, China) 1062 Nanotechnology: 1.2F baskets further enhance irrigation flow in flexible ureterorenoscopy J. Bedke, U. Leichtle, A. Lorenz, U. Nagele, A. Stenzl, S. Kruck (Tübingen, Germany; Hall in Tirol, Austria) 1063 Laser lithotripsy retropulsion varies with stone mass M. Robinson, J.M.H. Teichman (Vancouver, Canada) 1064 Is prophylactic antibiotics necessary in patients with pre-operative sterile urine undergoing ureteroscopic procedures for ureteral stones? C.D. Lin, S-J.C. Chang, S.S-D. Yang, C-H. Hsieh (Taipei, Taiwan) 1065 Withdrawn 1066 Is endoscopic evaluation at the end of retrograde intrarenal surgery (RIRS) a valid predictor of stone treatment outcome? A. Bosio, P. Destefanis, E. Alessandria, A. Buffardi, E. Dalmasso, M. Carchedi, S. Santià, A. Bisconti, F. Fop, C. Ceruti, D. Fontana, B. Frea (Turin, Italy) 1067 Post-ureteroscopic lesion scale: Multicentre video-based evaluation of inter-rater reliability M. Schoenthaler, N. Buchholz, E. Farin, H. Ather, C. Bach, T. Bach, J.D. Denstedt, H.-M. Fritsche, M. Grasso, O. Hakenberg, R. Herwig, T. Knoll, F.E. Kuehhas, E. Liatsikos, P. Liske, P.J.S. Osther, J.M. Reis-Santos, K. Sarica, C. Seitz, M. Straub, O. Traxer, A. Trinchieri, B. Turney, A. Miernik (Freiburg, Hamburg, Regensburg, Rostock, Sindelfingen, Pforzheim, Munich, Germany; London, Oxford, United Kingdom; Karachi, Pakistan; London, Canada; New York, United States of America; Vienna, Austria; Patras, Greece; Fredericia, Denmark; Lisbon, Portugal; Istanbul, Turkey; Paris, France; Lecco, Italy) 1068 Analysis for predictive factors for the success of ureteroscopy as day-case surgical procedure for the treatment of ureteral calculi R. Molina, N. Gonzalez, M. Alvarez, L. Crespo, R. Alarcon, M. Dorado, A. Paez (Madrid, Spain) * 1069 Does indwelling ureteral stent preserve renal function after relief of obstructive uropathy? A.R. Elnahas, A.M. Harraz, M.H. Zahran, H. Abol-Enein (Mansoura, Egypt) Monday 1070 Trends in utilization and comparative outcomes for infected upper urinary tract stones in the United States: PCN vs stent J.D. Sammon, K.R. Ghani, S. Sukumar, J.O. Peabody, M. Menon, Q-D. Trinh (Detroit, United States of America) EAU Milan

310 1071 Prospective evaluation of stent symptoms after uncomplicated ureteroscopy using a validated questionnaire A. Bosio, P. Destefanis, E. Alessandria, E. Dalmasso, A. Bisconti, M. Carchedi, A. Buffardi, S. Santià, C. Ceruti, D. Fontana, B. Frea (Turin, Italy) 1072 Easy ureteral stent removal without cystoscopy after ureteroscopic stone removal (URS) J.H. Son, G.S. Lim, S.H. Jang, J.W. Lee, D.S. Cho (Seong Nam, South Korea) Monday 310 Programme Book

311 Monday, 18 March - EAU Programme Abstract Session History of urology 2 Red Hall 2 - Level N1 Poster Session 88 Chairs: A.J. Figueiredo, Coimbra (PT) J. Mattelaer, Kortrijk (BE) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion Review of the urological aspects in the work of Giovanni Da Vigo J. Medina-Polo, I. Otero Tejero, E. Jiménez Alcaíde, R. Díaz González (Madrid, Guadalajara, Spain) 1074 The history, evolution and development of male urinary incontinence management R.C. Nayar, A. Deshpande, I.P. Wharton (Birmingham, United Kingdom) 1075 Albucasis: The revelation of urological surgical instruments in the 10th century Islamic world F. Khan, W.Mahmalji, S. Madaan, I.K. Dickinson, S. Sriprasad (Kent, United Kingdom) 1076 From Lister to laparoscopy: 100 years of urology at King s College Hospital J.K. Makanjuola, I.K. Dickinson, A.J. Yates-Bell, J. Philpott-Howard, P.M. Thompson (London, Kent, United Kingdom) 1077 Glove at first sight history of the first surgical rubber glove J.R. Bhatt, I.R.G. Wood, C.P. Hobbs, S. Brewster (Oxford, United Kingdom) 1078 Peyronies disease, hottentot apron and kidney stones in the Italian urologists of the middle ages S. Musitelli, I. Bossi (Zibido San Giocomo, Italy) 1079 Reynaldo dos Santos: From aortography to modern urology L. Marconi, A. Figueiredo, F. Furriel, P. Dinis, A. Mota (Coimbra, Portugal) 1080 Sir Denis Browne: A titan of paediatric urology H.L. Ratan (Derby, United Kingdom) 1081 A tribute to the life and accomplishments of Mathieu Jaboulay F. Khan, W. Mahmalji, S. Sriprasad, I.K. Dickinson (Kent, United Kingdom) 1082 The history of the adrenal glands from The Bible to Jerome Conn F. Furriel, A.J.C. Figueiredo, L.S.O. Marconi, D.J.S. Castelo, G.H.A. Gomes, V.M.N. Dias (Coimbra, Portugal) 1083 The last EAU Congress in Central Europe, Budapest 1986 I. Romics, M. Romics (Budapest, Hungary) 1084 Urological papers and issues arising from the early years of the Chinese medical journal K.A. Wong, J. Chatterton, M.F. Bultitude (London, United Kingdom) Monday EAU Milan

312 Monday, 18 March - EAU Programme Abstract Session Pharmacotherapy of male LUTS Blue Hall Level N1 Poster Session 89 Chairs: C.G. Roehrborn, Dallas (US) M.J. Speakman, Taunton (GB) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion. * 1085 Adverse event profiles of alpha-1 blocker agents for male patients: Data mining of the public version of the FDA adverse event reporting system K. Yoshimura, K. Kadoyama, T. Sakaeda, Y. Sugino, O. Ogawa, Y. Okuno (Kyoto, Japan) 1086 Acute urinary retention risk in BPH patients treated with tamsulosin vs watchful waiting: A 5 year prospective community based study K. Lokshin, M. Davidov, I. Gorbunova (Moscow, Perm, Russia) 1087 The Silodosin in Real-life Evaluation (SiRE) study: Baseline characteristics of the patients enrolled in a European phase IV clinical study with silodosin in the treatment of LUTS/BPH C.R. Chapple (Sheffield, United Kingdom) 1088 Urinary retention following anticholinergics in patients with BPH in real life practice - a nationwide population-based study E.Y-H. Huang, C-C. Lin, H.-. Chung, J-P. Lin, A.T. Lin, K-K. Chen (Taipei, Taiwan) * 1089 Quality of life analyses from NEPTUNE, a phase 3 trial of combination therapy with tamsulosin OCAS and solifenacin in men with lower urinary tract symptoms M.J. Drake, R. Sokol, M. Klaver, T. Drogendijk, Z. Hakimi, I. Odeyemi, P.E.V. Van Kerrebroeck (Bristol, Chertsey, United Kingdom; Trencin, Slovakia; Leiderdorp, Maastricht, The Netherlands) 1090 Predictors of successful first-line antimuscarinics monotherapy in men with enlarged prostate and predominant storage symptoms C.H. Liao, H.C. Kuo (New Taipei City, Hualien, Taiwan) 1091 Effects of add-on mirabegron on storage symptoms in men with lower urinary tract symptoms receiving alpha-1 blocker therapy K. Ogura, A. Sengiku, Y. Miyazaki, H. Sawazaki, T. Takahashi (Otsu, Japan) Monday 1092 Combination therapy with dutasteride and tadalafil in men with moderate-to-severe benign prostatic hyperplasia H.J. Park, N.C. Park (Busan, South Korea) 1093 Clinical effects of dutasteride and finasteride: Are they different or equivalent? Results from record-linkage and match-paired analyses L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, R. Autorino, F. Berardinelli, L. Schips (Vasto-Chieti, Santa Maria Imbaro-Chieti, Naples, Italy) 1094 Clinical outcomes after combined therapy with 5alpha-reductase inhibitors and alpha-blockers or either monotherapy in men with benign prostatic hyperplasia: 4-year results from a record-linkage analysis L. Cindolo, C. Fanizza, M. Romero, L. Pirozzi, R. Autorino, F. Berardinelli, C. De Nunzio, L. Schips (Vasto- Chieti, Santa Maria Imbaro-Chieti, Naples, Rome, Italy) 312 Programme Book

313 1095 Nocturia improvement in the Combination of Avodart and Tamsulosin (CombAT) study M. Oelke, C. Roehrborn, T.H. Wilson, J-M. Palacios, R. Castro (Hanover, Germany; Dallas, North Carolina, Pennsylvania, United States of America; Madrid, Spain) 1096 Combination therapy with finasteride and tadalafil once daily for 6 months: A randomized, placebocontrolled study in men with lower urinary tract symptoms secondary to benign prostatic hyperplasia A.R. Casabe, C. Roehrborn, L.F. Da Pozza, S. Zepeda, R. Henderson, S. Sorsaburu, C. Henneges, D. Wong, L. Viktrup (Buenos Aires, Argentina; Dallas, Shreveport, Indianapolis, United States of America; Bergamo, Italy; Saltillo, Mexico; Bad Homburg, Germany) Monday EAU Milan

314 Monday, 18 March - EAU Programme Abstract Session Medical treatment of RCC Yellow Hall Level N1 Poster Session 90 Chairs: G. Kramer, Vienna (AT) H. Uemura, Osaka (JP) Poster viewing of 20 minutes. Presentations will take place on stage. Standard presentations are 2 minutes in length, followed by 2 minutes for discussion. Extended presentations (*) are 4 minutes in length, followed by 2 minutes for discussion Prognostic factors for patients with metastatic renal cell carcinoma in the era of targeted therapy D. You, I.G. Jeong, S. Park, J.Y. Joung, J.H. Hong, H. Ahn, C-S. Kim (Seoul, Ulsan, South Korea; New Brunswick, United States of America) 1098 Tumor growth rate should be applied in the definition of progression disease during molecular targeted therapy in patients with metastatic renal cell carcinoma H.L. Zhang, D.W. Ye, G.H. Shi (Shanghai, China) 1099 Individualization of medical treatment in metastasized renal cell carcinoma by measuring the plasma levels of sunitinib, sorafenib and pazopanib first clinical experiences C. Keil, A. Nockher, L. Götze, P. Olbert, R. Hofmann, A. Hegele (Marburg, Germany) 1100 Association of pharmacokinetics of sunitinib with treatment outcome and adverse events in advanced renal cell carcinoma patients N. Tsuchiya, N. Fujiyama, S. Narita, T. Inoue, K. Numakura, S. Akihama, M. Saito, S. Satoh, M. Miura, T. Habuchi (Akita, Japan) 1101 Identification of a potential molecular marker of response to high-dose interleukin-2 in metastatic renal cell carcinoma patients C.D. Jacobs, G. Lipowska-Bhalla, N. Dalal, F. Thistlethwaite, R.E. Hawkins, D.G. Rothwell (Manchester, United Kingdom) 1102 Body-mass-index and survival of patients with metastastic renal cell carcinoma: Data from the German prospective RCC Registry P.J. Goebell, L. Müller, U. Von Verschuer, H.J. Hurtz, M. Franzem, M. Vogt, N. Marschner (Erlangen, Leer, Essen, Halle (Saale), Freiburg, Germany) 1103 FDG PET/CT as imaging biomarker for advanced renal cell carcinoma N. Nakaigawa, M. Yao, N. Hayashi, U. Tateishi, T. Inoue, Y. Kubota (Yokohama, Japan) Monday 1104 Frequency and risk factors of sorafenib-induced high-grade skin rash in Japanese patients with advanced renal cell carcinoma N. Tsuchiya, S. Narita, T. Inoue, N. Hasunuma, K. Numakura, M. Saito, S. Satoh, T. Notoya, N. Fujishima, S. Hatakeyama, C. Ohyama, T. Habuchi (Akita, Japan) 1105 Neoadjuvant targeted molecular therapies in patients undergoing nephrectomy and inferior vena cava thrombectomy. A French retrospective study of 13 cases P. Bigot, J.C. Bernhard, E. Xylinas, T. Fardoun, J. Berger, M. Rouprêt, S. Lagabrielle, S. Lebdai, M. Ammi, H. Baumert, K. Bensalah, B. Escudier, N. Grenier, J.F. Hetet, J.A. Long, P. Paparel, N. Rioux-Leclercq, A-R. Azzouzi, M. Soulié, J-J. Patard (Angers, Bordeaux, Paris, Rennes, Limoges, Villejuif, Nantes, Grenoble, Lyon, Toulouse, Le Kremlin-Bicêtre, France) 314 Programme Book

315 1106 The German mrcc registry aims and results after the first 1000 patients P.J. Goebell, L. Müller, K. Blumenstengel, A. Hübner, A. Lück, M. Vogt, N. Marschner (Erlangen, Leer, Eisenach, Rostock, Freiburg, Germany) * 1107 Outcomes of patients with non clear cell renal cell carcinoma treated with targeted therapy and prognostication using the International mrcc Database Consortium Criteria N. Kroeger, W. Xie, J-L. Lee, G.A. Bjarnason, J.J. Knox, M.J. Mackenzie, L. Wood, S. Srinivas, U.N. Vaishamayan, S.Y. Rha, S.K. Pal, T. Yuasa, F. Donskov, N. Agarwal, C.K. Kollmannsberger, M.H. Tan, S.A. North, B.I. Rini, T.K. Choueiri, D.Y.C. Heng (Calgary, Toronto, Halifax, Vancouver, Edmonton, Canada; Boston, Stanford, Detroit, Utah, Cleveland, United States of America; Asan, Seoul, Duarte, South Korea; London, United Kingdom; Ariake, Tokyo, Japan; Århus, Denmark; Singapore, Singapore) * 1108 Clinical role of MHC-class I peptide vaccines for metastatic renal cell carcinoma T. Minami, T. Minami, N. Shimizu, Y. Yamamoto, M. De Velasco, T. Hayashi, H. Tsuji, M. Nozawa, K. Yoshimura, T. Ishii, H. Uemura (Osaka-Sayama, Japan) Monday EAU Milan

316 Monday, 18 March - Sponsored Sessions Workshop Overview Urinary incontinence - Optimising the patient experience and improving outcomes page 418 Amber Hall 6 - Level S2 Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division Symposia Overview Interactive debate: How seriously should I take male LUTS? page 419 Silver Hall - Level N2 Sponsored by ASTELLAS New data on androgen deprivation with a GnRH antagonist: Improving patient outcomes in prostate cancer page 420 Yellow Hall Level N1 Sponsored by FERRING PHARMACEUTICALS Castration-resistant prostate cancer in 2013: Analysing the good, the bad and the ugly page 421 Red Hall 2 - Level N1 Sponsored by PRIME ONCOLOGY Monday 316 Programme Book

317 Tuesday, 19 March - EAU Programme Plenary Session Souvenir sessions/hot topics in prostate cancer euro Auditorium - Level S2 Chairs: A. Stenzl, Tübingen (DE) H. Van Poppel, Leuven (BE) Souvenir session by the EAU Scientific Congress Office Prostate disease M.S. Michel, Mannheim (DE) Prostate cancer A. Briganti, Milan (IT) Urothelial cancer J.W.F. Catto, Sheffield (GB) Renal, testicular and penile cancer G. Janetschek, Salzburg (AT) Neurourology, voiding dysfunction and incontinence F.C. Burkhard, Berne (CH) Stone disease B. Tombal, Brussels (BE) Paediatric urology W.F.J. Feitz, Nijmegen (NL) Andrology J.O.R. Sonksen, Herlev (DK) Reconstruction, transplantation and trauma L. Martínez Piñeiro, Madrid (ES) EAU policy on live surgery K.F. Parsons, Liverpool (GB) Aims and objectives In mid 2012, the EAU established a panel of internationally recognised experts to address the issue of the ethics of live surgical demonstrations in urology. The culmination of their work is a formal EAU policy statement which will be presented to the Congress on their behalf. This will include the underpinning governance documents which have been formulated. The methodology, including the supporting literature review and the Delphi process used to determine the consensus view, will be shown, together with proposals for continuing prospective audit of all live surgical events undertaken under the auspices, and with the endorsement of the EAU Introduction to the plenary session A. Stenzl, Tübingen (DE) Update New urological weapons in the treatment of CRPC A. Heidenreich, Aachen (DE) Tuesday EAU Milan

318 Late breaking news I Can Zometa prevent bone metastases in high risk prostate cancer patients? First Results of the Zometa European Study (ZEUS). M. Wirth, Dresden (DE) Prostate cancer in China Y-H. Sun, Shanghai (CN) State-of-the-art lecture Is there a role for intermittent androgen deprivation? T.L.J. Tammela, Tampere (FI) Debate High risk PC: Surgery vs radiation vs systemic therapy Moderator: M. Jewett, Toronto (CA) Surgery: H. Van Poppel, Leuven (BE) Radiation: A. Bossi, Villejuif (FR) Systemic therapy: P. Iversen, Copenhagen (DK) Aims and objectives The optimal management for men presenting with high risk prostate cancer remains controversial. Experts will debate the merits of radical prostatectomy, radiation therapy and systemic therapy alone or in combination. At the end of the session, the delegates will better understand how to personalize the care of the individual patient presenting with this life threatening disease to achieve the best chance of cure while minimizing the burden of treatment Late breaking news II Swedish Registry Study P. Wiklund, Stockholm (SE) Debate Why focal therapy instead of active surveillance for low risk prostate cancer Moderator: Pro: Con: F.C. Hamdy, Oxford (GB) M. Emberton, London (GB) M. Wirth, Dresden (DE) Report on the Consensus Statement for Prostate Cancer Prevention J. Cuzick, London (GB) Update European PSA screening ERSPC perspective J.E. Hugosson, Göteborg (SE) Aims and objectives Screening for prostate cancer is controversial. While a large randomized study has shown a benefit of screening in terms of prostate cancer mortality. Generally accepted evidence on a proper balance on advantages and disadvantages is lacking. The purpose of this session will be to inform on the present status of screening and proper decision taking. Tuesday 318 Programme Book

319 Patient perspective T. Hudson, Dublin (IE) EAU perspective P-A. Abrahamsson, Malmö (SE) Debate on European PSA screening P-A. Abrahamsson, Malmö (SE) J.E. Hugosson, Göteborg (SE) T. Hudson, Dublin (IE) Aims and objectives Prostate cancer is a major health problem, and the main cause of male cancer deaths. However, current published data are insufficient to recommend the adoption of population screening for prostate cancer as a public health policy due to the large over-treatment effect. Before screening is considered by national health authorities, the level of current opportunistic screening, overdiagnosis, overtreatment, quality of life, costs, and cost-effectiveness should be taken into account. Overdiagnosis of prostate cancer leads potentially to significant overtreatment. Health professionals, especially urologists, should avoid overtreatment by developing safe methods of cancer surveillance/ monitoring without invasive therapy. Invasive therapies should be tailored to patients needs and the prognosis of cancers diagnosed. Current screening algorithms are insufficient for population screening or individual early diagnosis due to a lack of specificity and lack of selectivity for aggressive cancers which require treatment. The development of novel diagnostic and prognostic markers and imaging modalities is needed urgently to enhance the predictive value of screening tools. In the absence of population screening, the EAU advises men who consider screening by PSA testing and prostate biopsy to obtain information on the risks and benefits of screening and individual risk assessment. The European Association of Urology and the ERSPC study group represent essential European stakeholders to further develop health strategies for prostate cancer screening. The EAU promotes the quality of care for prostate cancer patients in Europe in collaboration with the patient support organization Europa Uomo ( through the development of information and guidelines. The EAU wishes to support and foster research needed to develop reliable active surveillance protocols for low-risk prostate cancers, prognostic markers, and targeted therapies in order to deliver optimal patient care Closing remarks P-A. Abrahamsson, Malmö (SE) Tuesday EAU Milan

320

321 ESU Courses, 16 March ESU Course 1 ESU Courses Prostate cancer Screening, diagnosis and staging Green Hall 1 - Level N-1 Chair: F.C. Hamdy, Oxford (GB) Screening F.C. Hamdy, Oxford (GB) Diagnosis A.R. Zlotta, Toronto (CA) Staging A.R. Zlotta, Toronto (CA) Aims and objectives The incidence of prostate cancer has increased dramatically over the last 10 to 15 years and it is now the most common cancer in males in developed countries. The increase is mainly caused by the growing use of opportunistic screening or case-finding based on the use of prostate-specific antigen (PSA) testing in serum. Using this approach, prostate cancer is detected 5 to 10 years before giving rise to symptoms and on average 17 years before causing the death of the patient. While this has led to detection of prostate cancer at a potentially curable stage, it has also led to substantial overdiagnosis, i.e. detection of cancers that would not surface clinically in the absence of screening. This is confounded by recent evidence that screening reduces disease-specific mortality. A major challenge is thus to identify the cases that need to be treated while avoiding diagnosing patients who will not benefit from being diagnosed and who will only suffer from the stigma of being a cancer patient. Therefore, prognostic markers, which can predict those patients who need to be diagnosed and those who do not, are of major importance. This course is designed for urological trainees and established urologists, who wish to update themselves on the latest information regarding screening, diagnosis and staging in prostate cancer. The course allows interaction with the audience and is in part based on case-scenarios for discussion with the delegates, followed by state-of-the-art presentations. In addition, emphasis will be placed on controversial issues and recent progress in terms of diagnostic tools, staging procedures and prognostic factors. At the end of the course, the participants should have obtained good insights on the following: What are the best approaches to screening and early detection of prostate? How can we reduce the risk of overdiagnosis and overtreatment? How can we identify patients who are best managed by active monitoring/surveillance rather than immediate more active treatment? Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

322 ESU Courses ESU Courses, 16 March ESU Course Advanced course on urethral stricture surgery Green Hall 2 - Level N-1 Chair: C.R. Chapple, Sheffield (GB) Management of anterior urethral stricture disease an evidence based approach. C.R. Chapple, Sheffield (GB) Urethroplasty for posterior urethral injuries an evidence based approach S.G.Joniau, Leuven (BE) Female strictures C.R. Chapple, Sheffield (GB) Case discussion A Roosen, Munich (DE) Round table discussion The panel Aims and objectives To be able to counsel and advise a patient on the therapeutic options available. To review the treatments available for urethral stricture disease and to do so in the context of different patient based scenarios, in an interactive fashion. To provide a clearer understanding of the role and potential for both anastomotic and substitution urethroplasty in the management of urethral stricture disease. To review the different materials and techniques used in substitution urethroplasty To outline the principles of the surgical management of patients with urethras that have been injured by trauma. Participants of the course will obtain a clear view on the current role of surgery for the management of urethral stenosis affecting both the anterior and posterior urethra in contemporary clinical practice. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

323 ESU Courses, 16 March ESU Course 3 ESU Courses Metastatic prostate cancer Green Hall 3 - Level N-1 Chair: K. Pummer, Graz (AT) First and second line hormonal therapy: What should be considered? K. Miller, Berlin (DE) What is the role of chemotherapy and immunotherapy in patients with CRPC? G. Mickisch, Bremen (DE) New therapeutic options for patients with CRPC more possibilities, more questions? K. Pummer, Graz (AT) Case discussion G. Mickisch, Bremen (DE) K. Miller, Berlin (DE) K. Pummer, Graz (AT) Aims and objectives The aim of this course is to provide comprehensive state-of-the-art information about the optimal management of patients with metastatic prostate cancer. The first lecture will give an overview of the various forms of currently available androgen deprivation therapies such as LHRH analogs and antagonists, address the potential advantages or disadvantages of intermittent treatment, as well as outline the optimal timing of hormonal therapy. In addition, the role of possible second-line hormonal manipulations will be presented. The second lecture will present and critically discuss the role of chemotherapy as well as immunotherapy at the time when hormone resistance has developed with a special emphasis on efficacy, side effects, sequencing and patients` selection. The third lecture will address recent achievements as well as future challenges by reviewing the mode of action and the current role of newer therapeutic options such as testosterone synthesis inhibitors, androgen receptor antagonists, or radionuclide therapy. At the end of the course, interactive cases will be discussed together with the audience and there will be plenty of time for questions and answers. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

324 ESU Courses ESU Courses, 16 March ESU Course Retropubic radical prostatectomy Tips, tricks and pitfalls Orange Hall 1 - Level N-1 Chair: H. Van Poppel, Leuven (BE) Surgical anatomy O.W. Hakenberg, Rostock (DE) Step by step radical retropubic prostatectomy H. Van Poppel, Leuven (BE) Tips, tricks and pitfalls O.W. Hakenberg, Rostock (DE) Treatment of complications H. Van Poppel, Leuven (BE) Discussion and interaction Faculty Aims and objectives In many parts of Europe, open retropubic radical prostatectomy is still the gold standard for treating localised prostate cancer. Although laparoscopic, eventually robot assisted, radical prostatectomy is getting more popular in selected centres, and the open surgical approach is still the most often performed operative procedure in many countries throughout Europe. Localised prostate cancer is being more and more detected in its earlier stages and surgery undoubtedly offers the best local control. The urologist s surgical skill must be outstanding and the urological community is responsible for guaranteeing optimal surgical quality through adequate training. The competition with external beam radiotherapy, brachytherapy and novel minimally invasive techniques like cryosurgery and HIFU, should encourage young urologists to optimally perform the surgical resection with the best possible tumour control and the least impact on continence and potency. This course aims to bring to the modern urologist the different technical steps of the classical retropubic prostatectomy with an emphasis on the preservation of continence and potency and discusses the special tips and tricks that must enable every contemporary urologist to obtain good results with minimal complications. Also, the prevention and treatment of complications are discussed. This teaching course is a must for the elder resident and the younger urologist beginning his career but well trained urologists who do not treat many patients with localised prostate cancer, will benefit. The participants will get inside the detailed surgical anatomy, the pre-operative measures and the intra-operative steps of a very systematic and safe operation. Also the experienced uro-oncological surgeon will enjoy the tricks and pitfalls and will learn how to solve intra- and postoperative complications. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

325 ESU Courses, 16 March ESU Course 5 ESU Courses Office management of male sexual dysfunction Orange Hall 2 - Level N-1 Chair: C. Stief, Munich (DE) Diagnostics - What is necessary? I. Eardley, Leeds (GB) Testosterone replacement C. Stief, Munich (DE) Oral therapy for ED I. Eardley, Leeds (GB) Therapy of ED when pills fail D. Ralph, London (GB) Medical therapy for premature ejaculation I. Eardley, Leeds (GB) Surgical topics: Penile implants, priapism, Peyronie s D. Ralph, London (GB) What to do after radical prostatectomy? C. Stief, Munich (DE) Aims and objectives The course is aimed at providing practical advice on how to diagnose and treat a patient with premature ejaculation or ED. It will allow an up-to-date understanding of the underlying mechanisms of the erectile process and the aetiology of ED. The recent development of various orally available drugs with different modes of action and distinctly different side-effect profiles enables individually tailored therapies. However, an individually adopted regimen requires an adequate work up that will be comprehensively presented. Although currently available and future oral drugs will be covered in depth, alternative options such as testosterone supplementation, local pharmacotherapy or various devices will be presented with special emphasis since their adequate indication and appropriate use by the urologist makes the distinctive difference in comparison to other specialists in the field. The indications for, and specific aspects for penile prosthesis will be discussed since prostheses still represent an important option for select patients. Then, specific topics with high practical importance as the cardiovascular patient with ED or the post-prostatectomy case will be covered. The course will be very interactive allowing in-depth information on the various aspects of the cutting edge of ED. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

326 ESU Courses ESU Courses, 16 March ESU Course Prolapse management and female pelvic floor problems Orange Hall 3 - Level N-1 Chair: D.J.M.K. De Ridder, Leuven (BE) Introduction D.J.M.K. De Ridder, Leuven (BE) Vaginal surgical anatomy for urologists E. Kocjancic, Chicago (US) Investigations and imaging for POP D.J.M.K. De Ridder, Leuven (BE) Vaginal native tissue repair D.J.M.K. De Ridder, Leuven (BE) Vaginal mesh repair E. Kocjancic, Chicago (US) Open/laparoscopic/robotic repair E. Costantini, Perugia (IT) The politics of mesh repair D.J.M.K. De Ridder, Leuven (BE) Management of complications E. Costantini, Perugia (IT) Aims and objectives This course gives practical information about prolapse management by urologists. From anatomy to mesh implant and the management of complications. The recent turmoil on the vaginal mesh implantation will be discussed in detail. Also laparoscopic and robotic approaches will be evaluated. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

327 ESU Courses, 17 March ESU Course 7 ESU Courses Management of small renal tumours Green Hall 1 - Level N-1 Chair: P. Gontero, Turin (IT) Active surveillance P. Gontero, Turin (IT) Ablative therapies J.J.M.C.H. De La Rosette, Amsterdam (NL) Surgery F. Keeley, Bristol (GB) Aims and objectives The aims of this course are to review the various therapeutic strategies in small localised RCC. The techniques such as surgery (open and laparoscopy) radical and nephron sparing, cryotherapy, radiofrequency and HIFU will be presented. Their respective indications including surveillance will be discussed. An overview of the published results will be presented and analysed. Interaction is the most important way to have an efficient course. Video and clinical cases will be used as a tool to stimulate exchange. We hope to meet you in Milan during the EAU Annual Congress to enjoy lots of discussions on this interesting topic. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

328 ESU Courses ESU Courses, 17 March ESU Course Renal transplantation: Technical aspects, diagnosis and management of early and late urological complications Green Hall 2 - Level N-1 Chair: F.J. Burgos Revilla, Madrid (ES) Selection and urological preparation of transplant recipients; surgical aspects of nephrectomy in living and deceased donor A.J. Figueiredo, Coimbra (PT) Laparoscopic living donor nephrectomy: Technical aspects and controversies F.J. Burgos Revilla, Madrid (ES) Avoiding complications by proper techniques of renal transplantation; tricks and tips A.J. Figueiredo, Coimbra (PT) How to diagnose and manage postoperative and long-term complications following renal transplantation F.J. Burgos Revilla, Madrid (ES) Aims and objectives Given the dramatic improvement in short- and long-term graft and patient survival, renal transplantation has become the most effective treatment of end stage renal failure. Recipients considered for transplantation are currently older and pose more problems than in the past, in some cases requiring specific urological preparation. We would like to share our experience concerning the selected items with the audience. These include how to select and to prepare transplant recipients with surgical or urological problems, how to choose the most safe technique for performing deceased donor and living donor nephrectomy, how to deal with unusual situations of renal procurement or transplantation and finally, for urologists, how to diagnose and manage postoperative and long-term urological and other complications. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) Programme Book

329 ESU Courses, 17 March ESU Course 9 ESU Courses Advanced course on upper tract laparoscopy (UPJ, adrenal and stones) Green Hall 3 - Level N-1 Chair: G. Janetschek, Salzburg (AT) Transperitoneal approach to the kidney and adrenal gland: Standard technique and modifications G. Janetschek, Salzburg (AT) Retroperitoneoscopy: Lateral and posterior approach F. Porpiglia, Turin (IT) Dismembered pyeloplasty: Technique, problems, complications H. Baumert, Paris (FR) Non-dismembered pyeloplasty: Indication, technique G. Janetschek, Salzburg (AT) Adrenalectomy H. Baumert, Paris (FR) Partial adrenalectomy G. Janetschek, Salzburg (AT) Stone surgery F. Porpiglia, Turin (IT) Questions and discussion Faculty Aims and objectives Surgery of the kidney and adrenal gland by means of laparoscopy has become standard of care. Most frequently this surgery is performed transperitoneally; this approach has been standardized. However, the anatomy of the right and left side differs substantially which has to be taken into consideration. Also several modifications have been developed such as a direct approach to the left renal pelvis through the colonic mesentery. Retroperitoneoscopy is an alternative which should be mastered as well. Adrenalectomy was the first widely recognized indication for laparoscopy in urology, and open surgery has almost vanished for this indication. Partial adrenalectomy may be considered as an alternative in benign solitary tumours such as Conn adenoma but is strongly recommended in familial bilateral pheochromocytoma. For the treatment of UPJ obstruction laparoscopy has to compete with both open surgery and endopyelotomy. Compared to open surgery the results are the same but morbidity is lower. Morbidity of endopyelotomy is lower, however, but the results are not as good in the long-term. The technique of dismembered and nondismembered pyeloplasty will be discussed in detail. Laparoscopic stone surgery is usually not a first line therapy. In specific situations it may be helpful, however. EAU Milan

330 ESU Courses All the mentioned techniques will be presented in an interactive way. Essential steps will be highlighted by video clips. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

331 ESU Courses, 17 March ESU Course 10 ESU Courses Advanced course on laparoscopic nephrectomy Orange Hall 1 - Level N-1 Chair: V. Pansadoro, Rome (IT) Introduction H.P. Beerlage, s-hertogenbosch (NL) V. Pansadoro, Rome (IT) Indications for laparoscopic nephrectomy V. Pansadoro, Rome (IT) Transperitoneal access V. Pansadoro, Rome (IT) Extraperitoneal access H.P. Beerlage, s-hertogenbosch (NL) V. Pansadoro, Rome (IT) Transperitoneal safe control of the renal pedicle V. Pansadoro, Rome (IT) Extraperitoneal safe control of the renal pedicle H.P. Beerlage, s-hertogenbosch (NL) Hemostatis H.P. Beerlage, s-hertogenbosch (NL) High energy tools V. Pansadoro, Rome (IT) Critical view of safety H.P. Beerlage, s-hertogenbosch (NL) Indications and technique for partial nephrectomy V. Pansadoro, Rome (IT) Indications and technique for partial nephrectomy. The Padua score H.P. Beerlage, s-hertogenbosch (NL) Pedicle control. Advantages and disadvantages of the different systems. (Vascular clamp, tourniquet, bulldog clamp) V. Pansadoro, Rome (IT) EAU Milan

332 ESU Courses Classical laparoscopy or robotic enucleation? H.P. Beerlage, s-hertogenbosch (NL) V. Pansadoro, Rome (IT) Parenchymal clamping H.P. Beerlage, s-hertogenbosch (NL) Surgical tips for the nephroureterectomy V. Pansadoro, Rome (IT) Conversions H.P. Beerlage, s-hertogenbosch (NL) Vascular emergencies during renal surgery H.P. Beerlage, s-hertogenbosch (NL) V. Pansadoro, Rome (IT) Conclusion H.P. Beerlage, s-hertogenbosch (NL) V. Pansadoro, Rome (IT) Aims and objectives Different access to radical nephrectomy will be discussed. Best way to control the pedicle with the different approaches. Indications and surgical technique to partial nephrectomy. Pedicle control and efficient hemostasis. All the subjects will be discussed from a practical point of view with tips, tricks and pitfalls. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

333 ESU Courses, 17 March ESU Course 11 ESU Courses Painful bladder / chronic pelvic pain; In men and women Orange Hall 2 - Level N-1 Chair: J.J. Wyndaele, Antwerp (BE) Welcome J.J. Wyndaele, Antwerp (BE) Neurophysiology of chronic pelvic pain, causes and confusable diseases J.J. Wyndaele, Antwerp (BE) Chronic prostatitis and chronic pelvic pain in men S. Elneil, London (GB) Bladder pain syndrome BPS/IC J.J. Wyndaele, Antwerp (BE) Discussion, case presentations and conclusion Faculty Aims and objectives Painful diseases of the pelvis are not rare. The clinical entity is not an easy one, both in diagnosis and in treatment. Interactions between organs complicate the approach. The list of confusable diseases is long and the most direct way to the most probable diagnosis needs to be determined while avoiding the danger of overlooking another dangerous pathology. An increase in knowledge has been important during the last couple of years. The scope of the course is to bring participants up to date, so that after the course they can perform the most optimal evaluation of the patients with chronic pelvic pain and give the treatment best adapted to our actual knowledge. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

334 ESU Courses ESU Courses, 17 March ESU Course Lower urinary tract dysfunction and urodynamics Orange Hall 3 - Level N-1 Chair: P. Abrams, Bristol (GB) The scientific basics of urodynamics P. Abrams, Bristol (GB) Urodynamics - Getting philosophy and technique correct P. Abrams, Bristol (GB) Urodynamics in neurourology S. Madersbacher, Vienna (AT) Urodynamics in female urology P. Abrams, Bristol (GB) Urodynamics in the child and in men S. Madersbacher, Vienna (AT) Aims and objectives Having attended the course, the attendee should: Understand the basic physical principles referable to urodynamics Be able to assess the quality of a urodynamic trace Recognise common artefacts and know how to correct them Know the indications for urodynamic studies in children, men, women and neurological patients. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

335 ESU Courses, 17 March ESU Course 13 ESU Courses Pathology (prostate, bladder/uut, kidney, testicles/penis) Green Hall 1 - Level N-1 Chair: E. Compérat, Paris (FR) How to get best results for your patient. Challenges in pathology of the prostate and bladder E. Compérat, Paris (FR) New insights and changes in pathology of the kidney and testis F. Algaba, Barcelona (ES) Aims and objectives This course for urologists will treat prostate, bladder, kidney and testicular pathology. It is not a course of pathology, but wants to improve the urologist-pathologist interaction. The attended aim is to get correct diagnosis, understand as well problems which pathologists may encounter, as the most important details mentioned in a pathology report. Several question frequently asked by urologists will be treated: I.) Clinical practice and optimal handling of pathology specimen. Is my clinical practice optimal to obtain best pathology report, how can I improve the interaction with the pathologist? - The importance of clinical information and well edited, good sampling will be explained, especially limits of diagnosis in case of artefacts. Solutions how to avoid them will be discussed. - Which information has to be exchanged between the urologists and the pathologists? The importance of clinical information and history will be underlined. - Robustness of pathology reports and when urologists should ask for a second opinion will be discussed. II.) When ask for frozen sections and biopsies that are possible results. Evaluation of surgical margins - The indication of frozen sections and biopsies is a topic of major concern. Indications of frozen sections have to be precise and useful; otherwise it becomes an expensive and time spending procedure. We point out the right indications. - Another important point which overlaps with the above mentioned is the evaluation of the surgical margins, limits in pathology and how we can improve. - We also want to discuss the usefulness of biopsies in kidney tumours, prostate, bladder and upper urinary tract. Where are our limits, what do urologists expect expectations and how to proceed to get optimal results? III.) Pathology report. How to read and understand all included information The aim is to discuss the major items of a pathology report. - Am I using all the information which is in a pathological report? - Do I know the latest staging and grading? - Which information do I have to expect and ask in case of absence? - Understand why the pathologist does immunohistochemistry. - The most important antibodies (understanding of which antibody is in favour of which lesion and evokes which hypothesis). IV.) Novelties in Uro-Onco Pathology. Applications in daily practice - Many new acquisitions are regularly made in Uro-Oncological Pathology. The latest news in burning research topic will briefly be discussed. EAU Milan

336 ESU Courses - The presentation of new pathological entities with clinical implications will be treated. We will discuss the correlation between morphology and biology which special emphasis about the role that the pathologist plays in the detection of the therapeutic targets, especially in renal cell cancer. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) Programme Book

337 ESU Courses, 17 March ESU Course 14 ESU Courses Surgical management of locally advanced and metastatic renal cancer Green Hall 2 - Level N-1 Chair: M. Kuczyk, Hanover (DE) State of the art regarding systemic treatment of matastasized renal cancer S. Osanto, Leiden (NL) Surgical options for metastasized renal cell cancer M. Kuczyk, Hanover (DE) Surgical treatment of locally advanced renal cell cancer A. Bex, Amsterdam (NL) Aims and objectives Although most renal cancers are small and incidentally found, a significant proportion of patients still present with locally advanced or even metastatic renal cell carcinoma (RCC) at first diagnosis or develop metastatic spread during the further course of the disease. RCC is a unique disease where we had important developments in the last 2 decades both in surgical as well as nonsurgical and systemic therapies. Although we have now at least 7 drugs with proven efficacy in metastatic RCC, surgery still remains the only curative therapy. The first aim of this course is to highlight the role of surgery versus a conservative therapeutic approach. The efficacy of metastasectomy, for example, will be weighed against that of a medical treatment that is mainly based on anti VEGF directed agents. In addition, new therapeutic concepts including neoadjuvant treatment upfront surgery for locally advanced disease including patients with intracaval thrombosis will be highlighted. Surgery for locally advanced disease particularly in patients with vena caval thrombus is a challenging situation and tips and tricks of this type of surgery including the clinical results that can be achieved by an aggressive surgical management will be indicated. And finally, the place of cytoreductive nephrectomy during the treatment of metastatic RCC and the role of surgery for the treatment of locally recurrent disease will be discussed. This course is an excellent opportunity to learn what the urologist can offer to renal cancer patients with difficult tumours and metastatic RCC. The course is an ideal opportunity for all; residents, the practicing urologist and the oncologic urologist. Don t miss this course if you see patients with advanced RCC in your practice! Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) 21 EAU Milan

338 ESU Courses ESU Courses, 17 March ESU Course Laparoscopy for beginners Green Hall 3 - Level N-1 Chair: A.D. Joyce, Leeds (GB) Indications for laparoscopy A.D. Joyce, Leeds (GB) Instrumentation and haemostasis X. Cathelineau, Paris (FR) Peritoneal access and effects of pneumoperitoneum A.D. Joyce, Leeds (GB) Avoiding complications X. Cathelineau, Paris (FR) Aims and objectives Urologists interested in undertaking laparoscopy must be properly trained in order to minimise the risk of potential complications and to ensure patient safety. Currently training in urological laparoscopy is limited due to several factors: A shortage of designated training centres A shortage of recognised trainers Lack of either appropriate facilities, limitations of equipment, expertise or support All of which restrict the trainee from access to high quality training. This course aims to provide the potential trainee with the recognised core knowledge with regard to case selection, correct use of the equipment and imaging systems, and the important protocols for accessing and exiting the abdomen, including how to recognise and avoid potential complications prior to starting with the skills acquisition. The central highlight of the course is the use of video clips to illustrate many of the essential points and to promote discussion amongst the delegates. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) Programme Book

339 ESU Courses, 17 March ESU Course 16 ESU Courses Testicular cancer Orange Hall 1 - Level N-1 Chair: P. Albers, Düsseldorf (DE) Testis cancer Early stages N.W. Clarke, Manchester (GB) Testis cancer Case discussion N.W. Clarke, Manchester (GB) Testis cancer Advanced stages P. Albers, Düsseldorf (DE) Testis cancer Case discussion P. Albers, Düsseldorf (DE) Aims and objectives The EAU guidelines on testicular cancer have been updated for Based on this European consensus, this ESU course will provide the auditorium with the latest information on diagnostic tools, staging and treatment of testis cancer stage by stage. In early-stage cancer, organ-sparing surgery, the question of testicular microlithiasis, the conflicting issue of testis biopsy and current histopathological prognostic factors for surveillance and individualised treatment options will be discussed with the auditorium including case presentations. The role of conventional as well as laparoscopic RPLND in early stages will be clarified. In advanced-stage cancer, the course participants will learn about stage by stage treatment according to IGCCCG classification. Detailed information on chemotherapy regimens and the handling of side-effects will be provided. In this section of the course, tips and tricks of residual tumour resection will be presented using case reports and intraoperative pictures. In addition, salvage strategies will be discussed in cases of treatment failures. Participants will have enough time to ask questions and discuss their own cases. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) 21 EAU Milan

340 ESU Courses ESU Courses, 17 March ESU Course Management and outcome in invasive and locally advanced bladder cancer Orange Hall 2 - Level N-1 Chair: A. Alcaraz, Barcelona (ES) Cystectomy in the management of bladder invasive and locally advanced bladder cancer A. Alcaraz, Barcelona (ES) Case discussion on cystectomy in the management of bladder invasive and locally advanced bladder cancer B. Malavaud, Toulouse (FR) Bladder sparing approaches to muscle invasive bladder cancer A. Alcaraz, Barcelona (ES) Case discussion on bladder sparing approaches to muscle invasive bladder cancer B. Malavaud, Toulouse (FR) Cytotoxic chemotherapy in bladder cancer: Neoadjuvant and adjuvant setting and treatment of metastatic disease B. Malavaud, Toulouse (FR) Aims and objectives Bladder cancer is the second most common oncological malignancy in Europe. Invasive and locally advanced bladder tumour is the urological malignancy with the highest mortality. The course will begin with the definition of the disease and different prognostic factors. Among prognosticators of outcome will be discussed the role of early cystectomy in T1 patients with poor prognosis indicators and the limitations of cystectomy in elderly and poor performance status patients. The course will continue with the discussion of the different treatment options. Rationale for considering cystectomy as gold standard, as well as a clear definition of multidisciplinary strategies for bladder sparing treatments with special emphasis in patient selection and potential limitations will be discussed. Finally, the role of systemic chemotherapy in the neoadjuvant and adjuvant to cystectomy setting will be presented, as well as in the treatment of metastatic disease. Specially recommended for elder residents and young urologists starting their career in the field of urooncology. Also experienced uro-oncological surgeons will benefit from this course through an update, focused on clinical issues and a practical approach. At the conclusion of this course, the participants should get better insights in terms of: - Stratifying the patients with invasive and locally advanced bladder cancer in different groups of risk. - Understanding the rationales outcome and limitations of cystectomy and bladder sparing treatments. - Defining the current role of neoadjuvant and adjuvant chemotherapy for invasive and locally advanced bladder cancer. - Measuring the benefits of systemic chemotherapy in terms of progression free survival and overall survival. 340 Programme Book

341 Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) 21 ESU Courses EAU Milan

342 ESU Courses ESU Courses, 17 March ESU Course Robot renal surgery Green Hall 1 - Level N-1 Chair: A. Mottrie, Aalst (BE) Introduction A. Mottrie, Aalst (BE) Pyeloplasty G. Guazzoni, Milan (IT) Clinical cases UPJ Obstruction; Nephrectomy for RCC J. Hubert, Nancy (FR) Partial nephrectomy A. Mottrie, Aalst (BE) Clinical cases RCC; Nephroureterectomy J. Hubert, Nancy (FR) Conclusion G. Guazzoni, Milan (IT) Aims and objectives 1. Explain the advantages of robotics over classical laparoscopy in surgery of the upper urinary system 2. Teach the different operations step-to-step 3. Discuss difficult clinical cases Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

343 ESU Courses, 17 March ESU Course 20 ESU Courses How to write a manuscript and get it published in European Urology Green Hall 2 - Level N-1 Chair: F. Montorsi, Milan (IT) How to get your manuscript published in European Urology F. Montorsi, Milan (IT) Why publishing (and publishing on European Urology) is important for you C. Gratzke, Munich (DE) Clinical research original article: How to write the introduction and methods section G. Novara, Padova (IT) The importance of statistical design and analysis R.J. Sylvester, Brussels (BE) Clinical research original article: How to write the results and discussion sections J.W.F. Catto, Sheffield (GB) Clinical research original article: The editor s tricks S.F. Shariat, New York (US) How to write a basic research article to be relevant for the readers of European Urology C. Gratzke, Munich (DE) How your submission will be evaluated by European Urology reviewers: Reviewer template and publication guidelines J.W.F. Catto, Sheffield (GB) Surgery in Motion: How to combine the best possible manuscript and video for the Surgery in Motion Section H.G. Van Der Poel, Amsterdam (NL) Questions and answers Aims and objectives The objectives of the course are to provide the principles of writing the two key types of publication: the review article and the clinical study report. Specifically covered will be how to decide whether you should actually publish your data and how to choose the most suitable journal once that decision is made. The How to do it for a scientific paper will represent the core of the course. This will be illustrated with case studies on each aspect of the paper with a workshop style discussion with attendees. How to use references in your article and the different options for easy referencing will also be discussed. The tips and tricks section will provide insider information to help in your writing. Finally, we all have to deal with reviewer s comments and information will be presented on how this should be carried out to best advantage. Attendees are-on EAU Milan

344 ESU Courses expected to leave the course with a full knowledge of the fundamental requirements to be successful in having a scientific paper accepted by a major journal. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

345 ESU Courses, 17 March ESU Course 21 ESU Courses Advanced vaginal reconstruction Green Hall 3 - Level N-1 Chair: D. Pushkar, Moscow (RU) Introduction: Are you involved in reconstructive urology? D. Pushkar, Moscow (RU) Midurethral slings in : The current status F.C. Burkhard, Berne (CH) Management of urinary incontinence associated with urethral loss D. Pushkar, Moscow (RU) Obstructive slings: What to do? F.C. Burkhard, Berne (CH) D. Pushkar, Moscow (RU) Management of mesh complications D. Pushkar, Moscow (RU) F.C. Burkhard, Berne (CH) Management of non-index stress urinary incontinence (recurrent cases, intrinsic sphincter deficiency, mixed incontinence). F.C. Burkhard, Berne (CH) Modern approach to vesicovaginal fistulae and urethral diverticulae (comprehensive video presentation) D. Pushkar, Moscow (RU) Adjournment F.C. Burkhard, Berne (CH) Aims and objectives Clinicians involved in the care of female patients should know vaginal surgery. A specific goal of the faculty is to employ scientific principles, published information and clinical experience to describe and position newly developed techniques in current management of urinary incontinence. Special attention will be given to new techniques that use synthetics tapes in SUI surgery. This course will also cover the management of complications of surgery for stress incontinence and mesh complications. Treatment of recurrent urinary incontinence and incontinence with mixed symptoms also will be under discussion. Management of vesicovaginal fistulas, urethral diverticulae and some rare conditions will be shown both during podium and video presentations. An interactive course means active participation by the audience and participants are encouraged to prepare and present interesting and challenging clinical cases for consultation by the faculty. After this course, participants should know how to apply the newest technique in patients with stress incontinence, urethral loss and iatrogenic injuries of lower urinary tract. This course will facilitate the decision making process for those who are just starting their careers and for advanced surgeons. EAU Milan

346 ESU Courses Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

347 ESU Courses, 17 March ESU Course 22 ESU Courses Radical cystectomy and orthotopic bladder substitution Surgical tricks and management of complications Orange Hall 1 - Level N-1 Chair: U.E. Studer, Berne (CH) Preoperative investigations and selection of patients for orthotopic bladder substitution J.E. Gschwend, Munich (DE) Arguments for nerve sparing cystectomy with orthotopic bladder substitution A. Stenzl, Tübingen (DE) How to do a nerve-sparing cystectomy in male and female patients, surgical tricks to avoid complications with orthotopic bladder substitution U.E. Studer, Berne (CH) Tips on how to obtain good functional results in female patients A. Stenzl, Tübingen (DE) Active post-operative management is the most important step U.E. Studer, Berne (CH) How to treat complications during follow-up J.E. Gschwend, Munich (DE) Discussion Faculty Aims and objectives In this course, special emphasis is placed on patient selection and on practical surgical steps: on how to do meticulous pelvic lymph node dissection and nerve-sparing cystectomy in male and female patients, as well as how to do various types of orthotopic bladder substitutes with good long-term functional results. The course is aimed to be interactive with 50% of the time reserved for questions and discussions with the audience. At the end of the course, participants should know all the essential and practical steps needed in order to achieve good results with cystectomy and orthotopic bladder substitution. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

348 ESU Courses ESU Courses, 17 March ESU Course Surgery or radiotherapy for localised and locally advanced prostate cancer Orange Hall 2 - Level N-1 Chair: B. Djavan, Vienna (AT) Localised prostate cancer Introduction B. Djavan, Vienna (AT) Treatment options and strategies in localised prostate cancer B. Djavan, Vienna (AT) How and when to use nomograms and networks R.J.A. Van Moorselaar, Amsterdam (NL) Oncological and functional results of radical prostatectomy B. Djavan, Vienna (AT) Oncology results of radiation therapy A. Bossi, Villejuif (FR) Advanced prostate cancer Radiotherapy with or without hormonal treatment in advanced PCA A. Bossi, Villejuif (FR) Results of radical prostatectomy for T3 disease B. Djavan, Vienna (AT) Adjuvant therapies following radical prostatectomy: What is the standard and what is new? R.J.A. Van Moorselaar, Amsterdam (NL) Take home messages B. Djavan, Vienna (AT) Aims and objectives The decision process towards surgery/active surveillance or radiation is a constantly evolving matter that requires a multitude of various information and inputs. In localised disease old habits have been jeopardised and surgical management seems to be fused with active surveillance in an increasing number of patients with good prognosticators. This course will summarise the decision process and indications for patients with clinically localised disease and help select the optimal treatment based on most recent oncological and functional data. In locally advanced disease, growing evidence supports the notion of radical surgery to improve outcome. US and European data endorse this policy in a selected group of patients. New radiation protocols and 348 Programme Book

349 strategies combined with hormone therapy offer as much adequate alternatives. In the second part of this course, controversies regarding the optimal management of locally advanced prostate cancer patients will be discussed and clear recommendations made to facilitate patient counselling and treatment. ESU Courses Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

350 ESU Courses ESU Courses, 17 March ESU Course Flexible ureterorenoscopy and retrograde intrarenal surgery: Instrumentation, technique, tips and tricks, indications Orange Hall 3 - Level N-1 Chair: O. Traxer, Paris (FR) Welcome message and introduction of the course O. Traxer, Paris (FR) Instrumentation: Endoscopes O. Traxer, Paris (FR) Instrumentation: Laser and lithotripsy devices M. Grasso, New York (US) Instrumentation: Disposable (wires, retrieving devices, UAS, irrigation devices and others) P.J. Osther, Fredericia (DK) Technique: Stones O. Traxer, Paris (FR) Technique: Urothelial tumours and strictures M. Grasso, New York (US) Tips and tricks and special circumstances O. Traxer, Paris (FR) Indications (guidelines) and clinical cases P.J. Osther, Fredericia (DK) Conclusions O. Traxer, Paris (FR) Aims and objectives This course will teach the principles of evidence based medicine (EBM) in the context of daily decisionmaking in urology. We will introduce urology-relevant resources to search and retrieve the latest clinical research studies and provide the tools to systematically evaluate these studies for the quality of evidence they provide. In practical exercises, we will first demonstrate how to assess a study s methodological strengths and weaknesses to determine how much confidence we can place in its results. Second, we will analyze the actual study results and the degree of certainty with which they are reported. Finally, we will discuss important considerations when deciding whether the results of a given study can and should be applied to the care of an individual patient. A workshop-style, interactive format is chosen to teach this course. The educational objective is to empower participants to independently search and appraise clinical research studies and retrieve high quality evidence as it becomes available. This course is therefore of exceptional value to all urologists that are seeking to enhance their EBM skills and thereby improve patient care. 350 Programme Book

351 Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 ESU Courses EAU Milan

352 ESU Courses ESU Courses, 18 March ESU Course The infertile couple - Urological aspects Green Hall 1 - Level N-1 Chair: W. Aulitzky, Vienna (AT) Diagnostic work-up, medical treatment W.H.G. Weidner, Giessen (DE) Pathophysiology, diagnosis and treatment of varicocele W. Aulitzky, Vienna (AT) Microsurgical refertilisation W. Aulitzky, Vienna (AT) Sperm retrieval techniques and genetic aspects of IVF/ICSI W.H.G. Weidner, Giessen (DE) Aims and objectives This course provides state-of-the-art information on urological aspects of diagnosis and therapy of modern reproductive medicine. Diagnostic procedures should be standardised and coordinated in a timely fashion for both partners, focussing on the possible urological, hormonal and genetic causes of male infertility. In terms of therapy, this course will provide updated information on evidence based data and will discuss the importance of varicoceles in male infertility. We will show microsurgical techniques on video and explain why proper training and skills perfection is key to successful case management. A successful IVF/ICSI outcome depends upon the use of state-of-the-art techniques for sperm retrieval and sperm preparation. We will also provide information on genetic aspects and stress the responsibility of the urologist as an adviser and gatekeeper for the treatment of the infertile couple. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

353 ESU Courses, 18 March ESU Course 26 ESU Courses Update on stone disease Green Hall 2 - Level N-1 Chair: A. Patel, London (GB) Introduction A. Patel, London (GB) Medical aspects of urinary stones F. Millán-Rodríguez, Barcelona (ES) SWL N.N-P. Buchholz, London (GB) Uretero-Renoscopy A. Breda, Barcelona (ES) Percutaneous nephrolithotomy and questions and answers A. Patel, London (GB) Interactive case discussion Aims and objectives Modern stone therapy has eliminated much of the previously devastating burden of upper tract urolithiasis, and is gradually also changing the clinical presentation. Complex stones are becoming rarer, and therapy is moving to the outpatient setting. Nevertheless, successful management requires competence in all aspects of stone management. The challenge today is employing the ideal approach for the specific situation. After a brief review of new developments present treatment strategies are demonstrated in detailed case presentations. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

354 ESU Courses ESU Courses, 18 March ESU Course Diagnosis and management of non-muscle invasive bladder cancer (NMIBC) Green Hall 3 - Level N-1 Chair: J.A. Witjes, Nijmegen (NL) Introduction and objective of course J.A. Witjes, Nijmegen (NL) Diagnosis of bladder cancer (including markers and importance of TUR) and case discussion J. Palou, Barcelona (ES) New diagnostic tools such as PDD and NBI M. Babjuk, Prague (CZ) Guideline treatment and follow-up including case discussion J.A. Witjes, Nijmegen (NL) Comments on guideline treatment recommendations including case example and discussion M. Babjuk, Prague (CZ) BCG failures and treatment options, including case discussion J.A. Witjes, Nijmegen (NL) What to do with extravesical urothelial cancer and case discussion J. Palou, Barcelona (ES) Closure and evaluation Aims and objectives With the comments of the last years this course will again fine tuned and obviously it will be updated according to the 2013 EAU guideline and latest literature. The emphasis lies on the discussion of problems seen in daily practice, when dealing with patients with non muscle-invasive bladder cancer (NMIBC). Many of these problems have been raised in previous courses and are the basis for the current presentations and case discussions. We have learned that discussion of these problems with the audience is very productive, interactive and highly appreciated. So, although the emphasis is on what one should do (the EAU guideline and its recommendations), we often see patients in daily practice that do not fit into guideline rules and need a different approach. We will present potential options for these patients and discuss cases like that with the audience to illustrate the possibilities beyond the guideline diagnosis and treatment solutions. As can be seen in the program subjects that will be lectured, discussed and illustrated with cases are (1) diagnostics (white light cystoscopy; cytology and markers; (re-)tur technique), (2) diagnostic innovations (PDD, NBI), (3) risk classification and therapy/follow per risk group, (4) potential exceptions to the guideline recommendations (e.g. single post-tur instillation, BCG maintenance therapy), (5) BCG failures, and finally (6) urothelial carcinoma outside the bladder. 354 Programme Book

355 The objective of this course is that attendees will know when to follow the guideline in NMIBC, when there are points of discussion, and what potential alternatives might be. ESU Courses Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

356 ESU Courses ESU Courses, 18 March ESU Course Robot-assisted laparoscopic prostatectomy Orange Hall 1 - Level N-1 Chair: P.T. Piechaud, Bordeaux (FR) Introduction P.T. Piechaud, Bordeaux (FR) General principles of robotic radical prostatectomy W. Artibani, Verona (IT) P. Dasgupta, London (GB) Step by step operative procedure Bladder neck approach P. Dasgupta, London (GB) P.T. Piechaud, Bordeaux (FR) Posterior dissection W. Artibani, Verona (IT) P.T. Piechaud, Bordeaux (FR) Lateral dissection P. Dasgupta, London (GB) W. Artibani, Verona (IT) P.T. Piechaud, Bordeaux (FR) Apex and DVC P. Dasgupta, London (GB) W. Artibani, Verona (IT) P.T. Piechaud, Bordeaux (FR) Anastomosis W. Artibani, Verona (IT) P. Dasgupta, London (GB) P.T. Piechaud, Bordeaux (FR) Lymphadenectomy W. Artibani, Verona (IT) Specific situations P.T. Piechaud, Bordeaux (FR) Postoperative complications P. Dasgupta, London (GB) 356 Programme Book

357 Anatomical and functional results W. Artibani, Verona (IT) ESU Courses Conclusion P.T. Piechaud, Bordeaux (FR) Aims and objectives The course about the technique of robotic radical prostatectomy has for main goal to give the participants all the technical elements of this surgery. The procedure will be described step by step by the various speakers. Different versions of the standard technique will be also described. The technique of this surgery in particular situations will be precised (prostatecomy post TURP, salvage prostatectomy). The main complications of this surgery will be explained and an analysis of the anatomical and functional results will be presented at the end of the course. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

358 ESU Courses ESU Courses, 18 March ESU Course Minimally invasive treatment for localized prostate cancer Orange Hall 2 - Level N-1 Chair: S.F.M. Thüroff, Munich (DE) Introduction S.F.M. Thüroff, Munich (DE) Brachytherapy Update 2013 S. Machtens, Bergisch Gladbach (DE) Questions and answers Cryotherapy Update 2013 J.P.M. Sedelaar, Nijmegen (NL) Questions and answers HIFU therapy Update 2013 S.F.M. Thüroff, Munich (DE) Questions and answers Focal brachy S. Machtens, Bergisch Gladbach (DE) Questions and answers Focal cryotherapy J.P.M. Sedelaar, Nijmegen (NL) Questions and answers Focal HIFU S.F.M. Thüroff, Munich (DE) Questions and answers What do EAU guidelines say? S. Machtens, Bergisch Gladbach (DE) Clinical cases and discussion S. Machtens, Bergisch Gladbach (DE) S.F.M. Thüroff, Munich (DE) J.P.M. Sedelaar, Nijmegen (NL) 358 Programme Book

359 Conclusion S.F.M. Thüroff, Munich (DE) ESU Courses Aims and objectives Today, earlier diagnosis of localized prostate cancer has caused as a trend to more low risk, early stage as an elevated number of prostate cancers at first diagnosis. While surgery and radiation therapy are golden standard therapies choosen by the urologist, modern less invasive technologies are greeted with ever more enthusiasm by patients. This simply creates a dilemma. In this course about minimal invasive PCa therapy status quo and long term results, indispensible for correct oncological evidence based evaluation are reported, as well as presentation and discussion of pilotstudies in specific indications, not yet subject to local minimal invasive treatment today. Brachy-, Cryo- and HIFU-therapy as representatives for low invasive minimal invasive technologies are not experimental but investational, clinically available therapies for urologists and derserving attention. Urologists have to be informed about their potential, side effects and limitations to give updated informations to their patients. This course will demonstrate these technologies, their results and complications on the other side highlight, why in selected cases hightech prostate cancer therapy might be equal or individually superior to conventional therapeutic approaches. Discussion about focal therapy, clinical cases and current guideline status quo -as exchange of opinions with the participants-will close this 3 hour course. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

360 ESU Courses ESU Courses, 18 March ESU Course Paediatric urology for the adult urologist: A practical update Orange Hall 3 - Level N-1 Chair: J.M. Nijman, Groningen (NL) Obstructive uropathy: What to do when, from neonate till puberty G.A. Bogaert, Leuven (BE) How to deal with congenital malformations of the external genitalia, when is surgery indicated and how to do it S. Tekgül, Ankara (TR) Urinary infection, reflux and voiding dysfunction: New insights in pathology, diagnostic work-up and management J.M. Nijman, Groningen (NL) Aims and objectives During this course an update is provided on common problems of the genito-urinary tract in children by means of state-of-the-art lectures, cases and interactive participation. Also the interaction between paediatric urologist, adult urologist, gynaecologist and paediatrician will be discussed. Corrections of congenital malformations of the urogenital tract have major implications for the quality of life, but also for long-term follow-up, future interventions and treatment of complications. Over the past few years our ideas about treatment of reflux and obstructive uropathy have changed; many so-called dogmas had to be revised. During this 3 hour course we will try to give an overview of the latest developments in the field of paediatric urology, focussing on topics of interest to the general urologist. The course is of particular interest to general urologists and those in training. Participants are encouraged to participate in the course as much as possible and there will be ample time for discussion and presentation of cases. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

361 ESU Courses, 18 March ESU Course 31 ESU Courses Current concepts and controversy in the diagnosis and management of upper tract urothelial carcinoma (UTUC) Green Hall 1 - Level N-1 Chair: S.F. Shariat, New York (US) Epidemiology, diagnosis, evaluation M. Roupret, Paris (FR) Prognostic and predictive factors, pathology S.F. Shariat, New York (US) Treatment of low risk cancer (high grade Ta, T1 and CIS) M. Roupret, Paris (FR) Treatment of localized high risk (invasive) and metastatic cancer S.F. Shariat, New York (US) Aims and objectives Upper tract urothelial carcinoma (UTUC) is an uncommon disease with little evidence-based data to guide clinical decision-making. Recently, the tools available for the diagnosis and management of UTUC have improved significantly, complementing a growing understanding of the biology of this disease. UTUC requires appropriate management at all stages, since both the cure rate and morbidity are very sensitive to nuances of treatment. Yet proper risk stratification remains a challenge owing to the difficulty of clinical staging. This course will address contemporary concepts and controversies, including the timely and accurate diagnosis of UTUC, emphasizing the integration of pathologic and radiographic variables for appropriate risk stratification. Important features regarding the natural history of UTUC will also be emphasized; the role of imaging and endoscopy in clinical decision making, diagnosis, staging and follow-up; and, common pathways of metastatic spread. Up-to-date information regarding boundaries of surgical resection, indication and extent of lymphadenectomy, clinical staging of UTUC, and the role of neoadjuvant chemotherapy in patients with high risk UTUC will be detailed. Patient selection and treatment options for patients with UTUC such as endoscopic management, distal ureterectomy, radical nephroureterectomy and chemotherapy will be discussed. Objectives: After attending this course, participants should be able to: identify problems associated with clinical staging of UTUC illustrate importance of accurate staging techniques and their role in clinical decision making maximize ureteroscopic diagnostic biopsy and tumor resection be aware of newer modalities such as endoluminal ultrasound and other novel staging methods cite current concepts and controversies in the management of low-stage and high-stage UTUC discuss and compare the risk, benefit, and side effects of laparoscopic and open radical nephroureterectomy understand the management of the bladder cuff understand the current role of multimodal therapy for high risk patients- integration of systemic therapy neo-adjuvant vs. adjuvant treatment discuss the need and boundaries of the recommended lymph node dissection EAU Milan

362 ESU Courses Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) Programme Book

363 ESU Courses, 18 March ESU Course 32 ESU Courses Advanced course on laparoscopic prostatectomy Green Hall 2 - Level N-1 Chair: J-U. Stolzenburg, Leipzig (DE) Introduction J-U. Stolzenburg, Leipzig (DE) Anatomy of the prostate and urethral sphincter K. Touijer, New York (US) Anatomy of the neurovascular bundles and fascias - extrafascial, interfascial, intrafascial where is the difference J-U. Stolzenburg, Leipzig (DE) Operative set-up, access, trocar position: Extra versus transperitoneal approach J-U. Stolzenburg, Leipzig (DE) K. Touijer, New York (US) Pelvic lymphadenectomy how to perform K. Touijer, New York (US) Steps of the procedure (video): Endoscopic extraperitoneal radical prostatectomy J-U. Stolzenburg, Leipzig (DE) Steps of the procedure (video): Transperitoneal laparoscopic radical prostatectomy K. Touijer, New York (US) How can we reduce the positive margins? J-U. Stolzenburg, Leipzig (DE) K. Touijer, New York (US) Management of complications (based on real cases) J-U. Stolzenburg, Leipzig (DE) K. Touijer, New York (US) Tips and tricks for difficult cases J-U. Stolzenburg, Leipzig (DE) K. Touijer, New York (US) Conclusion J-U. Stolzenburg, Leipzig (DE) Aims and objectives Laparoscopic/endoscopic radical prostatectomy needs to be well standardised to be reproduced. Besides the approaches the results of radical prostatectomy are based on our understanding of the prostatic anatomy. EAU Milan

364 ESU Courses Thus, we will first give precise information on the anatomy of the prostate, the sphincter muscle, fascias and the bundles in order to have a better understanding of the operative laparoscopic anatomy. The experts will then go through each step of the surgery. For this, short well-selected video clips will be presented and discussed e.g. the best way to perform the space for the extraperitoneal approach, how to spare the bladder neck, to make easy dorsal vein complex control, the apical dissection and the anastomosis. Different aspects (interfascial, intrafascial) of nerve-sparing surgery will be addressed. The participants will be aware of the risk of complications or difficulties for each part of the procedure. The tricks for shortening the operative time will also be discussed. Finally, complications and their management will be addressed and discussed on the basis of real cases. At the end of the session, the participants, if they are beginners, should have a better comprehension of each step of the technique. If they are experienced, the course should help to improve their technique by picking out some important tricks. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) Programme Book

365 ESU Courses, 18 March ESU Course 33 ESU Courses Modern management of BPH Green Hall 3 - Level N-1 Chair: K.M. Anson, London (GB) Introduction/scene setting BPH 2013 K.M. Anson, London (GB) Assessment and medical management T.E. Bjerklund Johansen, Århus (DK) Surgical management Electrosurgery K.M. Anson, London (GB) Surgical management Lasers and less invasive options R.M. Kuntz, Berlin (DE) Case presentations T.E. Bjerklund Johansen, Århus (DK) Aims and objectives To help delegates understand the basic principles behind the assessment of a BPH patient To summarise the evidence base for both the medical and surgical management of BPH To help delegates understand the patient factors that influence treatment choices using case presentations and delegate participation To debate the different health care system factors across Europe that influence patient and surgeon choice of treatment modalities Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

366 ESU Courses ESU Courses, 18 March ESU Course Urinary tract and genital trauma Orange Hall 1 - Level N-1 Chair: L. Martínez Piñeiro, Madrid (ES) Introduction L. Martínez Piñeiro, Madrid (ES) Blunt and penetrating renal trauma L. Martínez Piñeiro, Madrid (ES) Ureteric, bladder, and genital (penile and testicular) trauma. Aetiology, diagnosis and treatment H. Abol-Enein, Mansoura (EG) Aims and objectives 1. To review the current classifications of renal, bladder and genital trauma 2. To outline the principles of diagnosis and management of renal, bladder and genital trauma 3. To provide a clearer understanding of the role of the treatments which are available for specific patient scenarios 4. To interact with the audience and discuss together management and treatment of real cases Participants of the course will obtain a clear view on the current management of blunt and penetrating injuries affecting the kidney, bladder or genitals in contemporary clinical practice. More than 50% of the time of the course will be spent with the discussion of real clinical cases. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) Programme Book

367 ESU Courses, 18 March ESU Course 35 ESU Courses Ultrasound for the urologist - TRUS and TRUS guided biopsies Orange Hall 2 - Level N-1 Chair: P. Hammerer, Braunschweig (DE) Indications for TRUS and biopsy P. Hammerer, Braunschweig (DE) Practical aspects of TRUS and TRUS guided biopsies P. Hammerer, Braunschweig (DE) Indications for rebiopsy V. Scattoni, Milan (IT) Update on new technical developments V. Scattoni, Milan (IT) Aims and objectives The purpose of this ESU course is to define the optimal transrectal ultrasound and to discuss new ultrasound techniques for prostate cancer detection, as well as defining a new standard for transrectal ultrasoundguided prostate biopsies. In addition, techniques to reduce morbidity and to increase patient acceptance will be discussed. Transrectal ultrasound has been performed for more than 15 years, and this technique is now an important part of prostate cancer diagnosis and staging. Anatomic studies of prostatectomy specimens that defined the zonal anatomy of the prostate and provided a detailed mapping of the tumour location have increased our understanding of transrectal ultrasound images, as well as enabling optimal placement of the biopsy needles. The stage migration revealed by PSA-based screening has resulted in most tumours being non-palpable at diagnosis. Therefore in the PSA arena, with tumours at an early stage (non-palpable and sometimes ultrasonografically isoechoic) transrectal ultrasound is needed to enable sampling of all relevant areas of the prostate including those that appear normal. The systematic sampling of the prostate by the sextant biopsy technique improved the detection rate of prostate cancer over sampling hypoechoic or palpable suspicious lesions. However, in men with initially negative biopsies a second set of sextant biopsies will be positive in about 20-30%. Several groups have demonstrated that the sextant technique is inadequate for sampling of larger prostates and they advocated additional samples. Will an increase of prostate biopsies result in patient discomfort? Although some studies report no additional morbidity from the more extensive biopsy protocols, it seems likely that discomfort for the patient would be increased. What can be done to reduce pain and discomfort and improve tolerance for additional biopsies? Simple and efficacious methods are now available to provide anaesthesia in men undergoing prostate biopsies. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) 21 EAU Milan

368 ESU Courses ESU Courses, 18 March ESU Course Laparoscopic and robot-assisted laparoscopic radical cystectomy Orange Hall 3 - Level N-1 Chair: P. Wiklund, Stockholm (SE) 368 Programme Book Introduction laparoscopic cystectomy; Pre-surgery considerations R.F. Van Velthoven, Brussels (BE) Introduction robot-assisted laparoscopic cystectomy P. Wiklund, Stockholm (SE) Female cystectomy J. Rassweiler, Heilbronn (DE) Male cystectomy R.F. Van Velthoven, Brussels (BE) Lymph node dissection J. Rassweiler, Heilbronn (DE) Extracorporeal urinary diversion R.F. Van Velthoven, Brussels (BE) Intracorporeal urinary diversion P. Wiklund, Stockholm (SE) Outcome after laparoscopic cystectomy; Oncological, functional and complications J. Rassweiler, Heilbronn (DE) Outcome after robot-assisted laparoscopic cystectomy; Oncological, functional and complications P. Wiklund, Stockholm (SE) Aims and objectives At the conclusion of this educational activity, participants should be able to: Identify the current indications and contraindications for laparoscopic and robot assisted laparoscopic radical cystectomy with extended lymph node dissection. Illustrate the operative steps and techniques for laparoscopic and robot assisted laparoscopic radical cystectomy and extended pelvic lymph node dissection. Identify the current indications and contraindications for laparoscopic and robot assisted laparoscopic creation of an intracorporeal and extracorporeal urinary diversion. Discuss surgical tricks and tips learned from review of video clips of laparoscopic and robot assisted laparoscopic radical cystectomy. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21

369 ESU Courses, 18 March ESU Course 37 ESU Courses Post-surgical urinary incontinence in males Green Hall 1 - Level N-1 Chair: M.M. Fisch, Hamburg (DE) Etiology and workup F.A. Van der Aa, Leuven (BE) Management of overactive bladder and conservative management of stress incontinence F.A. Van der Aa, Leuven (BE) Surgical management of stress incontinence M.M. Fisch, Hamburg (DE) Case discussion M.M. Fisch, Hamburg (DE) Aims and objectives Post-surgical incontinence has a severe impact on the social life of the patient. This course will answer the questions, how much and which investigations are needed for an adequate diagnosis and what the therapeutic options are that can we offer to the patient. The available conservative therapy is described and data on success and failure rates are provided. There is also a focus on new and alternative treatment options. The surgical procedures to solve the problem are presented and data of the literature critically analysed. An important part of the course will be the interactive case discussion with the panel and participants. At the end of the course the participants should know: How to diagnose post surgical urinary incontinence and how to make symptoms objective Which conservative therapy should be offered and for how long Which operative procedures will provide the best long-term results for the individual situation of the patient Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) 21 EAU Milan

370 ESU Courses ESU Courses, 18 March ESU Course General neuro-urology Green Hall 2 - Level N-1 Chair: F.R. Cruz, Porto (PT) Introduction F.R. Cruz, Porto (PT) Diagnostics M.J. Drake, Bristol (GB) Therapy F.R. Cruz, Porto (PT) Case discussion Aims and objectives The course aims at introducing neuro-urology to urologists and other caregivers in training and at refreshing the topic to those who consider this subspeciality important for their current clinical practice. For many urologists neuro-urology is a less well known subspeciality that is considered less appealing due to the use of a specific terminology, methods of diagnosis and evaluation and a treatment that very frequently requires individualisation. For many urologists neuro-urology is not part of their training. However as patients with micturition problems of neurogenic cause have nowadays a life span very close to that of normal individuals, expertise in this field will be an inevitable requisite for the average urologist. Terminology has been updated in recent years and its familiarity is necessary not only in order to facilitate communication between caregivers but also to increase access to relevant literature. This will be the object of a complete review. Investigation is a decisive part of the management of patients with micturition problems of neurogenic origin. This is not intended as a urodynamic course but rather as a useful session in which the use of urodynamic and other tools will be clarified. Finally, management of these patients will be reviewed, from the more classic to the more experimental approaches, always keeping in mind that the expected audience will be the average urologist who is willing to increase their knowledge in the field. Thus the different therapeutic approaches will be presented in a more practical and useful way instead of a classical pharmacological approach. This is expected to facilitate the transfer the available information into everyday practice. Particular attention will be given to the use of botulinum toxin. Ultimately, different conditions will be simulated in order to rehearse the main topics. By the end of the course it is expected that participants will be able to adequately investigate and manage the most frequent neuro-urological situations. Registration fee excluding VAT EAU members 32 Non-EAU members 47 Residents (members/non-members) Programme Book

371 ESU Courses, 18 March ESU Course 39 ESU Courses Percutaneous nephrolithotripsy (PCNL) Orange Hall 1 - Level N-1 Chair: E. Liatsikos, Patras (GR) PCNL instrumentation Suite organisation, wires, dilators and lithotriptors C.M. Scoffone, Turin (IT) From Skin to Stone: Step-by-Step access using only fluoroscopy (Prone position) E. Liatsikos, Patras (GR) From Skin to Stone: Step-by-Step access using US and fluoroscopy (Supine position) C.M. Scoffone, Turin (IT) MiniPerc - Indications, equipment and technique T. Knoll, Sindelfingen (DE) Management of complications; In the OR and in the wards E. Liatsikos, Patras (GR) Tips and tricks in PCNL E. Liatsikos, Patras (GR) PCNL versus ESWL versus URS: The debate continues T. Knoll, Sindelfingen (DE) Analysis of demanding / unusual cases T. Knoll, Sindelfingen (DE) Round table discussion Faculty Aims and objectives The objective of the course is to provide an overview of the key points of PCNL technique and its implementation. A step-by-step approach to access methods will be emphasized, allowing beginners to familiarize themselves with the details of the techniques. The debate surrounding optimal patient positioning will be addressed, with extensive information on prone and supine PCNL techniques. A presentation on MiniPerc will showcase the equipments and indications of this alternative method. The identification and management of immediate and delayed complications will be reviewed. Also, challenging PCNL cases will be presented, demonstrating the frontiers of PCNL for experienced surgeons. Finally, tips and tricks of the technique will be shown, offering practical shortcuts to frequent problems encountered in PCNL. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) 21 EAU Milan

372 ESU Courses ESU Courses, 18 March ESU Course Single port NOTES and minilaparoscopy: Is this the way to go? Orange Hall 2 - Level N-1 Chair: A. Rane, Redhill (GB) Instrumentation - Access A. Rane, Redhill (GB) Nephrectomy: Single port, hybrid techniques A. Rane, Redhill (GB) Pyeloplasty: Sinlge port, hybrid technique T.R.W. Herrmann, Hanover (DE) Adrenalectomy: Single port T.R.W. Herrmann, Hanover (DE) Partial nephrectomy: Single port, hybrid technique J.H. Kaouk, Cleveland (US) Robotic single port: Upper tract, prostatectomy J.H. Kaouk, Cleveland (US) Complications - How do we avoid them? T.R.W. Herrmann, Hanover (DE) Why single port? Are you convinced? A. Rane, Redhill (GB) Aims and objectives The objective is to introduce single port surgery principles to the attendees. The presentations are made in a step by step fashion so that everyone can have a clear idea of the procedures, and can be exposed to tips and tricks that would make these procedures more appealing to them. The true indications of single port are presented as well as its integration with other hybrid procedures. Three mm instruments or hybrid tansvaginal approach are also issues that are addressed. The main purpose of this course is to convince the attendees about the usefulness and feasibility of single port surgery and its combination with other hybrid procedures. Single port surgery should not be considered a mission impossible and this is certainly the main goal of our endeavor. Registration fee excluding VAT EAU members 47 Non-EAU members 69 Residents (members/non-members) Programme Book

373 ESU Hands-on, 16 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and standard cases - Basic course 1 ESU Hands-on Turquoise Hall 2 - Level N-1 Chairs: G.H. Fournier, Brest (FR) J.A. Thomas, Bridgend (GB) C.M. Capitan Manjon, Madrid (ES) C. Gratzke, Munich (DE) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual reality models. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS EAU Milan

374 ESU Hands-on ESU Hands-on, 16 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and standard cases - Basic course 2 Turquoise Hall 2 - Level N-1 Chairs: G.H. Fournier, Brest (FR) J.A. Thomas, Bridgend (GB) C.M. Capitan Manjon, Madrid (ES) C. Gratzke, Munich (DE) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual reality models. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS 374 Programme Book

375 ESU Hands-on, 16 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and standard cases - Basic course 3 ESU Hands-on Turquoise Hall 2 - Level N-1 Chairs: A. Bachmann, Basel (CH) O. Reich, Munich (DE) F. Schiefelbein, Wurzburg (DE) U. Witzsch, Frankfurt am Main (DE) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual reality models. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS EAU Milan

376 ESU Hands-on ESU Hands-on, 16 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and standard cases - Basic course 4 Turquoise Hall 2 - Level N-1 Chairs: A. Bachmann, Basel (CH) O. Reich, Munich (DE) F. Schiefelbein, Wurzburg (DE) U. Witzsch, Frankfurt am Main (DE) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using virtual reality models. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS 376 Programme Book

377 ESU Hands-on, 16 March ESU/ESUT Hands-on training Endourology course 1 ESU Hands-on Amber 5 - Level S2 Chair: N.N-P. Buchholz, London (GB) P.A. Geavlete, Bucharest (RO) A.D. Joyce, Leeds (GB) F. Keeley, Bristol (GB) T. Sulser, Zurich (CH) Aims and objectives Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy) have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is still limited in Europe, laparoscopic training programmes have become very important. Hands-on training courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH EAU Milan

378 ESU Hands-on ESU Hands-on, 16 March ESU/ESUT Hands-on training Endourology course 2 Amber 5 - Level S2 Chair: R. Muschter, Rotenburg (DE) A.J. Gross, Hamburg (DE) A.G. Martov, Moscow (RU) P. Rischmann, Toulouse (FR) G.G. Tailly, Brasschaat (BE) Aims and objectives Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy) have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is still limited in Europe, laparoscopic training programmes have become very important. Hands-on training courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH 378 Programme Book

379 ESU Hands-on, 17 March ESU/ESUT Hands-on training Laparoscopy course 1 ESU Hands-on Turquoise Hall 1 - Level N-1 Chair: D. Teber, Heidelberg (DE) R.T. Bardan, Timisoara (RO) F. Greco, Leipzig (DE) U. Nagele, Hall in Tirol (AT) L. Tunc, Ankara (TR) Aims and objectives Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy) have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is still limited in Europe, laparoscopic training programmes have become very important. Hands-on training courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL EAU Milan

380 ESU Hands-on ESU Hands-on, 17 March ESU/ESUT Hands-on training Laparoscopy course 2 Turquoise Hall 1 - Level N-1 Chair: E. Liatsikos, Patras (GR) P. Chlosta, Wroclaw (PL) B. Guillonneau, Paris (FR) F. Porpiglia, Turin (IT) C. Schwentner, Tübingen (DE) Aims and objectives Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy) have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is still limited in Europe, laparoscopic training programmes have become very important. Hands-on training courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL 380 Programme Book

381 ESU Hands-on, 17 March ESU/ESUT Hands-on training Laparoscopy course 1 ESU Hands-on Amber 5 - Level S2 Chair: M. Burchardt, Greifswald (DE) A.S. Gözen, Heilbronn (DE) A. Minervini, Florence (IT) M.J. Ribal, Barcelona (ES) B.S.E.P. Van Cleynenbreugel, Leuven (BE) Aims and objectives Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy) have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is still limited in Europe, laparoscopic training programmes have become very important. Hands-on training courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH EAU Milan

382 ESU Hands-on ESU Hands-on, 17 March ESU/ESUT Hands-on training Laparoscopy course 2 Amber 5 - Level S2 Chair: F. Gaboardi, Milan (IT) T. Kalogeropoulos, Athens (GR) P. Macek, Prague (CZ) R. Rabenalt, Düsseldorf (DE) TBC Aims and objectives Laparoscopic procedures are continuously evolving in urology based on the increasing expertise of urologic surgeons. This includes ablative procedures, such as radical nephrectomy as well as reconstructive techniques, such as pyeloplasty. Some advanced procedures (i.e. radical prostatectomy, radical cystectomy) have both, ablative and reconstructive steps. Since the number of centres with laparoscopic expertise is still limited in Europe, laparoscopic training programmes have become very important. Hands-on training courses at the pelvi-trainer represent one of the main steps of such courses. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from OLYMPUS EUROPA HOLDING GMBH 382 Programme Book

383 ESU Hands-on, 17 March ESU/ERUS Hands-on training on Robotic surgery course 1 ESU Hands-on Turquoise Hall 2 - Level N-1 Chair: H.G. Van Der Poel, Amsterdam (NL) N.M. Buffi, Genova (IT) N.D. Doumerc, Toulouse (FR) N.S. Patel, Oxfordshire (GB) Aims and objectives The European School of Urology (ESU) and the EAU Robotic Urology Section (ERUS) offer an intensive handson training course. We will provide training using simulators. The main aims of this 90 minutes course are: improving the participants control-skills and hand-eye-coordination, as well as an objective benchmarking of console performance and an introduction into standardized surgical steps in robot-assisted procedures. Therefore, each course is limited to the small number of 8 participants, to facilitate an optimal training setting with only 2 participants per faculty. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC EAU Milan

384 ESU Hands-on ESU Hands-on, 17 March ESU/ERUS Hands-on training on Robotic surgery course 2 Turquoise Hall 2 - Level N-1 Chair: J.H. Witt, Gronau (DE) N.M. Buffi, Genova (IT) N.D. Doumerc, Toulouse (FR) N.S. Patel, Oxfordshire (GB) Aims and objectives The European School of Urology (ESU) and the EAU Robotic Urology Section (ERUS) offer an intensive handson training course. We will provide training using simulators. The main aims of this 90 minutes course are: improving the participants control-skills and hand-eye-coordination, as well as an objective benchmarking of console performance and an introduction into standardized surgical steps in robot-assisted procedures. Therefore, each course is limited to the small number of 8 participants, to facilitate an optimal training setting with only 2 participants per faculty. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC 384 Programme Book

385 ESU Hands-on, 17 March ESU Hands-on training course on Urodynamics ESU Hands-on Amber Hall 6 - Level S2 Chair: H. Hashim, Bristol (GB) M.J. Drake, Bristol (GB) J. Ellis Jones, Bristol (GB) A. Gammie, Bristol (GB) Aims and objectives This workshop aims to provide a practical course offering an interactive hands-on environment for doctors, nurses and technicians to improve their skills in urodynamics, with an emphasis on practical aspects including equipment used, interpretation of traces, quality control and trouble-shooting. The use of recorded tests, access to equipment and small groups means that individual problems can be addressed. All the speakers are involved in similar hands-on courses, which have ran successfully in the United Kingdom and abroad. The small group format has been shown to work well in addressing individual needs. Access to teaching aids and equipment will simulate the clinical scenario as much as possible within the constraints of the conference setting. At the end of the workshop delegates should feel more confident in their practice of urodynamics. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from MEDIWATCH EAU Milan

386 ESU Hands-on ESU Hands-on, 17 March ESU/ESUT/EULIS Hands-on training Ureterorenoscopy course 1 Turquoise Hall 1 - Level N-1 Chair: A. Skolarikos, Athens (GR) A. Breda, Barcelona (ES) G. Giusti, Milan (IT) P. Krombach, Mannheim (DE) Aims and objectives The European School of Urology (ESU), the EAU Section of Uro-Technology (ESUT) and the EAU Section of Urolithiasis (EULIS) offer an intensive hands-on training course with different models focussing on the endoscopic management of urolithiasis. The delegates will be taken through a sequential programme of Ureterorenoscopy using normal endoscopic instruments in different models. The use of various guide-wires, baskets and intracorporeal lithotripters will be demonstrated. The ESUT and the EULIS faculty consist of experienced surgeons in the field of Ureterorenoscopy. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL 386 Programme Book

387 ESU Hands-on, 18 March ESU/ESUT/EULIS Hands-on training Ureterorenoscopy course 2 ESU Hands-on Turquoise Hall 1 - Level N-1 Chair: P.J. Osther, Fredericia (DK) A. Hoznek, Creteil (FR) T. Knoll, Sindelfingen (DE) B. Turna, Izmir (TR) Aims and objectives The European School of Urology (ESU), the EAU Section of Uro-Technology (ESUT) and the EAU Section of Urolithiasis (EULIS) offer an intensive hands-on training course with different models focussing on the endoscopic management of urolithiasis. The delegates will be taken through a sequential programme of Ureterorenoscopy using normal endoscopic instruments in different models. The use of various guide-wires, baskets and intracorporeal lithotripters will be demonstrated. The ESUT and the EULIS faculty consist of experienced surgeons in the field of Ureterorenoscopy. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL EAU Milan

388 ESU Hands-on ESU Hands-on, 18 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advanced course 1 Amber 5 - Level S2 Chair: G. Muir, London (GB) C. Gratzke, Munich (DE) C.M. Capitan Manjon, Madrid (ES) F. Gomez Sancha, Madrid (ES) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Treatment of high risk patients will be discussed (anticoagulant). Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS 388 Programme Book

389 ESU Hands-on, 18 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advanced course 2 ESU Hands-on Amber 5 - Level S2 Chair: G. Muir, London (GB) C. Gratzke, Munich (DE) C.M. Capitan Manjon, Madrid (ES) F. Gomez Sancha, Madrid (ES) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Treatment of high risk patients will be discussed (anticoagulant). Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS EAU Milan

390 ESU Hands-on ESU Hands-on, 18 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advanced course 3 Amber 5 - Level S2 Chair: A. Bachmann, Basel (CH) N. Barber, Canterbury (GB) S. Carl, Emmendingen (DE) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Treatment of high risk patients will be discussed ( anticoagulant ). Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS 390 Programme Book

391 ESU Hands-on, 18 March ESU/ESUT Hands-on training in Green light laser vaporisation; Technique and large adenoma - Advanced course 4 ESU Hands-on Amber 5 - Level S2 Chair: A. Bachmann, Basel (CH) N. Barber, Canterbury (GB) S. Carl, Emmendingen (DE) TBC Aims and objectives The European School of Urology (ESU) and the European Section of Uro-Technology (ESUT) offer an intensive hands-on training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Green-light-laservaporisation using a virtual reality model, especially focussing on more complicated applications (ie large intravesical obstructing middle lobes, patients under anti-coagulation, cardiological considerations) A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Treatment of high risk patients will be discussed (anticoagulant). Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from AMERICAN MEDICAL SYSTEMS EAU Milan

392 ESU Hands-on ESU Hands-on, 18 March ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar TURP course 1 Turquoise Hall 1 - Level N-1 Chair: C.M. Scoffone, Turin (IT) T.R.W. Herrmann, Hanover (DE) K-D. Sievert, Tübingen (DE) TBC Aims and objectives The European School of Urology (ESU) and the EAU Section of Uro-Technology (ESUT) offer an intensive handson training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Bipolar TURP using normal endoscopic instruments in different models. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL 392 Programme Book

393 ESU Hands-on, 18 March ESU/ESUT Hands-on training Transurethral therapy of LUTS - Bipolar TURP course 2 ESU Hands-on Turquoise Hall 1 - Level N-1 Chair: V. Bucuras, Timisoara (RO) A. De La Taille, Creteil (FR) S. Gravas, Larissa (GR) A. Lapini, Florence (IT) Aims and objectives The European School of Urology (ESU) and the EAU Section of Uro-Technology (ESUT) offer an intensive handson training course with different models focussing on the endoscopic management of LUTS. The delegates will be taken through a sequential programme of Bipolar TURP using normal endoscopic instruments in different models. A video demonstrating the different steps and tasks of the procedures will be presented and afterwards the delegates will be instructed according to their level of experience in small teams at the models. Finally, all remaining questions can be answered and discussed with all tutors including the demonstration of tips and tricks. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from KARL STORZ GMBH & CO.KG and COOK MEDICAL EAU Milan

394 ESU Hands-on ESU Hands-on, 18 March ESU/ERUS Hands-on training on Robotic surgery course 3 Turquoise Hall 2 - Level N-1 Chair: C.M. Annerstedt, Stockholm (SE) F. Annino, Arezzo (IT) G. De Naeyer, Aalst (BE) C. Wijburg, Arnhem (NL) Aims and objectives The European School of Urology (ESU) and the EAU Robotic Urology Section (ERUS) offer an intensive handson training course. We will provide training using simulators. The main aims of this 90 minutes course are: improving the participants control-skills and hand-eye-coordination, as well as an objective benchmarking of console performance and an introduction into standardized surgical steps in robot-assisted procedures. Therefore, each course is limited to the small number of 6 participants, to facilitate an optimal training setting with only 2 participants per faculty. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC 394 Programme Book

395 ESU Hands-on, 18 March ESU/ERUS Hands-on training on Robotic surgery course 4 ESU Hands-on Turquoise Hall 2 - Level N-1 Chair: H. John, Winterthur (CH) F. Annino, Arezzo (IT) G. De Naeyer, Aalst (BE) C. Wijburg, Arnhem (NL) Aims and objectives The European School of Urology (ESU) and the EAU Robotic Urology Section (ERUS) offer an intensive handson training course. We will provide training using simulators. The main aims of this 90 minutes course are: improving the participants control-skills and hand-eye-coordination, as well as an objective benchmarking of console performance and an introduction into standardized surgical steps in robot-assisted procedures. Therefore, each course is limited to the small number of 6 participants, to facilitate an optimal training setting with only 2 participants per faculty. Registration fee excluding VAT 25 Supported by an unrestricted educational grant from INTUITIVE SURGICAL and MIMIC EAU Milan

396 Webcasts of sponsored sessions have been approved by the sponsoring company. The EAU is not responsible for the content of these webcasts.

397 Friday, 15 March Sponsored Session Extending survival outcomes in RCC and CRPC: Current evidence and future horizons Red Hall 2 - Level N1 Symposium Chair: B. Tombal, Brussels (BE) What can we learn from the latest data in RCC? M. Kuczyk, Hanover (DE) Sponsored Sessions How should we tailor the RCC treatment strategy for individual patients? C. Porta, Pavia (IT) Unmet treatment needs in CRPC: Where are we now? S. Gillessen, St. Gallen (CH) Future horizons in CRPC: Where are we going? B. Tombal, Brussels (BE) Panel discussion and meeting close B. Tombal, Brussels (BE) Aims and objectives Review recent progress in metastatic Renal Cell Carcinoma (RCC) and Castration-Resistant Prostate Cancer (CRPC), with particular focus on survival improvements, and in managing bone metastases in CRPC. Evaluate current unmet needs in these disease settings, and consider where additional treatment options are required to improve patient care. Examine how the latest data in RCC, and emerging agents in CRPC, will help shape future treatment paradigms. Sponsored by BAYER HEALTHCARE EAU Milan

398 Friday, 15 March Sponsored Session New data in metastatic RCC: Applying the evidence to clinical practice Sponsored Sessions Yellow Hall Level N1 Symposium Chair: A. Mejean, Paris (FR) Welcome and introduction A. Mejean, Paris (FR) First-line treatment selection: Weighing up the evidence T. Powles, London (GB) Impact of treatment decisions: The patient experience P. Schöffski, Leuven (BE) Applying the latest evidence to clinical practice A. Mejean, Paris (FR) I. Duran, Madrid (ES) Q&A session A. Mejean, Paris (FR) Closing remarks A. Mejean, Paris (FR) Aims and objectives To review the latest head-to-head data in mrcc and explore the clinical implications through patient case discussions To highlight the importance of proactive detection and management of side-effects To discuss the importance of taking a holistic approach to treatment decisions Sponsored by GLAXOSMITHKLINE ONCOLOGY 398 Programme Book

399 Friday, 15 March Sponsored Session Urological challenges in managing patients with angiomyolipoma (AML) Amber Hall Level S2 Symposium Chair: K. Budde, Berlin (DE) Welcome and introduction K. Budde, Berlin (DE) Sponsored Sessions Case study presentation: Surgical option for the treatment of AML A.L. Serra, Zurich (CH) Overview of AML and the urologic challenges B. Zonnenberg, Utrecht (NL) Clinical data on mtor inhibition for the management of AML K. Budde, Berlin (DE) Integrating surgical approaches with pharmacotherapy in the management of AML M. Staehler, Munich (DE) Case study: Individualising care for patients with TSC A.L. Serra, Zurich (CH) Panel discussion Aims and objectives Increase understanding of current treatment approaches for the management of AML; the unmet needs; and integration of current therapeutic approaches for the treatment of angiomyolipomas (AMLs) for improved patient outcomes Increase the understanding of advances in the molecular basic of AML and the potential for integrating pharmacotherapy into the management of AML Highlight the importance of treatment selection on an individualized, case-by-case basis Sponsored by NOVARTIS ONCOLOGY EAU Milan

400 Friday, 15 March Sponsored Session Innovations in clinical urology Sponsored Sessions Blue Hall Level N1 Symposium Chair: B. Malavaud, Toulouse (FR) Digital FURS loves big stones O. Traxer, Paris (FR) A balanced review of PDD and NBI in bladder cancer B. Malavaud, Toulouse (FR) Plasma-button long-term outcomes and recent advances - A green light to become standard BPH treatment in 2013? B. Geavlete, Bucharest (RO) The potential benefits of 3D laparoscopy for EERPE J-U. Stolzenburg, Leipzig (DE) Complex renal surgery using 3D vision A. Alcaraz, Barcelona (ES) Aims and objectives Discover clinical innovations by Olympus. The Olympus symposium will focus on innovations in clinical urology: 3D Laparoscopy, beyond laser; TUR with bipolar plasma, improving NMIBC detection by NBI and the latest in stone management. We look forward to your participation. Sponsored by OLYMPUS 400 Programme Book

401 Friday, 15 March Sponsored Session Metastatic castration-resistant prostate cancer: Integrating new learnings to optimise treatment outcomes Brown Hall 3 - Level S2 Symposium Chair: J.M. Fitzpatrick, Dublin (IE) Welcome and introduction J.M. Fitzpatrick, Dublin (IE) Sponsored Sessions The evolving mcrpc landscape: Challenges and opportunities N. Mottet, Saint Etienne (FR) The androgen signaling pathway in mcrpc: Implications in daily practice J.M. Fitzpatrick, Dublin (IE) Tailoring therapy to optimise treatment outcomes in mcrpc S. Oudard, Paris (FR) Managing mcrpc in real life practice A. Bahl, Bristol (GB) Closing remarks J.M. Fitzpatrick, Dublin (IE) Aims and objectives The objectives of this symposium are (1) to discuss the current and emerging treatment options in metastatic castration-resistant prostate cancer, (2) to reach a better understanding of the complexity of androgen receptor signaling pathway and how these new agents interfere with it, and (3) to share views on how to best sequence or combine available therapies. Sponsored by SANOFI EAU Milan

402 Saturday, 16 March Sponsored Session Navigating the new landscape in CRPC Sponsored Sessions euro Auditorium - Level S2 Symposium Chairs: A. Heidenreich, Aachen (DE) C.N. Sternberg, Rome (IT) Introduction to symposium A. Heidenreich, Aachen (DE) CRPC: The rationale for targeting the androgen receptor J.A. Schalken, Nijmegen (NL) New and emerging post-chemotherapy CRPC treatments: Clinical experience C.N. Sternberg, Rome (IT) Implications of the evolving pre-chemotherapy landscape A. Heidenreich, Aachen (DE) Interactive Q&A discussion session: Optimising patient care in the new CRPC era N.W. Clarke, Manchester (GB) Closing summary C.N. Sternberg, Rome (IT) Aims and objectives To provide the rationale for targeting the androgen receptor in CRPC To present clinical experience of new and emerging therapies in patients with CRPC who have received prior chemotherapy To highlight and discuss the implications of emerging treatments for patients with CRPC who have not received prior chemotherapy To discuss the potential impact of new and emerging therapies on the CRPC treatment landscape, patient pathway and the dynamics of the multidisciplinary team Sponsored by ASTELLAS 402 Programme Book

403 Saturday, 16 March Sponsored Session LUTS/BPH and sexual health - Bridging the gap Brown Hall Level S2 Symposium Chair: H. Porst, Hamburg (DE) Welcome and introduction H. Porst, Hamburg (DE) Sponsored Sessions Sexual health and male LUTS - Tackling a sensitive issue F. Giuliano, Garches (FR) Tadalfil 5mg once daily - Which patients benefit most? J.J.M.C.H. De La Rosette, Amsterdam (NL) Discussion Challenging questions: Tadalafil once-daily in BPH/LUTS - and now? F. Giuliano, Garches (FR) H. Porst, Hamburg (DE) J.J.M.C.H. De La Rosette, Amsterdam (NL) Wrap-up H. Porst, Hamburg (DE) Aims and objectives The Eli Lilly satellite symposium LUTS/BPH and Sexual Health Bridging the Gap will provide insights into recent progress been made in the deeper understanding of the pathophysiology of male LUTS, in particular its strong link to erectile dysfunction and other co-morbidities. A wealth of evidence has been published on innovative pharmacological approaches for male LUTS, recently having led to the approval of Tadalafil 5 mg once daily, for the treatment of the signs and symptoms of benign prostatic hyperplasia in adult males, in addition to the existing indication for erectile dysfunction. The faculty will discuss the pathophysiological link of ED and LUTS/BPH, the current spectrum of available medical treatment options for LUTS/BPH with a particular focus on sexual quality of life and will define their position on the expected role of Tadalafil 5 mg once daily in the current treatment algorithm for male LUTS. Sponsored by ELI LILLY AND COMPANY EAU Milan

404 Saturday, 16 March Sponsored Session Sponsored Sessions Risk stratification to optimize the management of men with symptomatic BPH at risk of progression Platinum Hall - Level S3 Symposium Chair: V. Mirone, Naples (IT) Session outline V. Mirone, Naples (IT) Why is BPH progression important and how can we use risk factors to identify patients at risk of progression? M. Marberger, Vienna (AT) What is the evidence for treating patients with BPH based on their risk of progression? M. Emberton, London (GB) Benefit/risk of treatments for patients with BPH at risk of progression G. Andriole, St. Louis (US) Case study discussions: Implications in daily practice for BPH management Q&A session Aims and objectives To evaluate and argue on the risk/benefit profile of currently recommended medical treatment options for patients at risk of BPH progression debating the most recent scientific evidence and with a focus to the latest evidence on risk factors that categorize BPH as a progressive disease and risk stratification that allows the right allocation of treatment to patients Sponsored by GLAXOSMITHKLINE 404 Programme Book

405 Saturday, 16 March Sponsored Session Increasing evidence of effectiveness of GAG therapy in different forms of cystitis Amber Hall Level S2 Symposium Chair: P.F. Bassi, Rome (IT) The scenario of bladder dysfunctions: Insights into the therapeutic potential of GAG therapy P.F. Bassi, Rome (IT) Sponsored Sessions Management of interstitial cystitis/bladder pain syndrome with GAGs M. Cervigni, Rome (IT) Efficacy of GAGS treatment in chemical and radiation cystitis E. Finazzi Agro, Rome (IT) Management of recurrent urinary tract infections with IALURIL R. Damiano, Catanzaro (IT) Clinical experience with IALURIL : Results of a multicentric survey R. Tomaskin, Martin (SK) Final remarks P.F. Bassi, Rome (IT) Discussion Aims and objectives Glycosaminoglycan (GAG) therapy is now being studied for the treatment of a wide variety of acquired and inherited diseases in different therapeutic areas, including bladder disorders such as urinary tract infections, painful bladder syndrome/interstitial cystitis, cystitis following radiation therapy or chemical agents. The positive outcomes obtained with a combination of hyaluronic acid and chondroitin sulphate administered intravesically in patients with an history of bladder damage, with the aim of restoring the integrity of the glycosaminoglycan layer of the urothelium, suggest that such therapeutic approach might be beneficial. A faculty of experts will review the results of the recent clinical investigations with this GAG combination and discuss its therapeutic applications. Sponsored by IBSA INSTITUT BIOCHIMIQUE EAU Milan

406 Saturday, 16 March Sponsored Session Transurethral resection of bladder tumor: How to reach excellence Sponsored Sessions Brown Hall 3 - Level S2 Symposium Chair: M. Brausi, Modena (IT) Introduction M. Brausi, Modena (IT) Improving the diagnosis and treatment of non-muscle invasive bladder cancer (NMIBC) J.A. Witjes, Nijmegen (NL) Reviewing the data: The hexaminolevulinate-guided blue light cystoscopy metaanalysis M. Burger, Würzburg (DE) Blue-light cystoscopy for treatment of NMIBC: Further cost-effectiveness analysis J.A. Witjes, Nijmegen (NL) New developments in instillation therapy S.M. Di Stasi, Rome (IT) Tying it together: Reaching excellence M. Brausi, Modena (IT) Aims and objectives The goal of this symposium is to present recent developments in the diagnosis and treatment of nonmuscle invasive bladder cancer (NMIBC) and discuss how these can impact the patient s prognosis. Accurate diagnosis, staging and treatment of NMIBC could be more important than any possible adjuvant therapy. An increasing body of data shows that blue-light cystoscopy is extremely helpful in improving diagnosis accuracy and reducing the recurrence rate. In this symposium this new modality and alternative treatments of NMIBC will be described and discussed. New data on cost-effectiveness of blue-light cystoscopy will be presented and commented. Interaction will be the main characteristic of the symposium. Sponsored by IPSEN 406 Programme Book

407 Saturday, 16 March Sponsored Session Holmium Life Enhancing Plan (HoLEP) - The real BPH lifetime solution Amber Hall 6 - Level S2 Workshop Chair: T. Aho, Cambridge (GB) Introduction T. Aho, Cambridge (GB) Sponsored Sessions Tips on getting started: Business plan, equipment, instruments, training G. Rix, Colchester (GB) Why HoLEP - How he has chosen HoLEP D. Pushkar, Moscow (RU) HoLEP technique: Surgical videos and animation I. Vavassori, Treviglio (IT) HoLEP for very large prostates, urinary retention, anticoagulated patients. Tips and literature review R.M. Kuntz, Berlin (DE) A review of the RCTs M. Cynk, Tunbridge Wells (GB) Comparison of laser techniques for BPH (illustrated with videos) T. Aho, Cambridge (GB) Conclusions and discussion T. Aho, Cambridge (GB) Aims and objectives The aim of our symposium is to provide the urologists a better understanding of the HoLEP (Holmium Laser Enucleation of the Prostate). HoLEP is the only technique for the treatment of BPH (Benign Prostate Symptoms) with clinical publications of 10 year follow up. During the symposium, some experts from different regions around Europe, will cover all the relevant points of HoLEP. We want to show that HoLEP is the gold standard of BPH treatment and a lifetime solution to the patients. Sponsored by LUMENIS EAU Milan

408 Saturday, 16 March Sponsored Session Premature ejaculation treatment: New perspectives for the couple Sponsored Sessions Yellow Hall Level N1 Symposium Chair: I. Moncada, Madrid (ES) Opening and welcome I. Moncada, Madrid (ES) Premature ejaculation: Looking beyond a male sexual dysfunction A. Graziottin, Milan (IT) Premature ejaculation diagnosis and treatment in daily practice I. Eardley, Leeds (GB) Premature ejaculation on demand treatment with dapoxetine: From clinical evidence to real practice D.G. Hatzichristou, Thessaloniki (GR) Q&A and closing remarks I. Moncada, Madrid (ES) Aims and objectives Premature Ejaculation (PE) is the most prevalent male sexual dysfunction that affects multiple dimensions of the patient s life, ranging from personal to relational domains, with a major effect on couple sexual relationship as demonstrated by observational studies. Despite of that, significant barriers to obtaining assistance from physicians exist and PE remains often under-diagnosed and consequently under-treated so, further efforts to promptly identify and approach PE are required. Dapoxetine is a fast-acting SSRI, specifically developed for the on demand treatment of PE. Its clinical efficacy and safety have been demonstrated in 5 phase III clinical trials that involved 6,081 men diagnosed with PE, in over 25 countries, showing an improvement in IELT and subjective measures of perceived amelioration in terms of control over ejaculation, satisfaction with sexual intercourse, personal distress and interpersonal difficulty. Recent trials provided interesting findings on the effect of Dapoxetine in daily practice, strengthen its positive safety profile and provide a preliminary picture of the trend of utilization in real life. Sponsored by MENARINI 408 Programme Book

409 Sunday, 17 March Sponsored Session Urinary incontinence - Optimising the patient experience and improving outcomes Amber Hall 6 - Level S2 Workshop Chair: K.P. Jünemann, Kiel (DE) Introduction and welcome K.P. Jünemann, Kiel (DE) Sponsored Sessions Injecting with DIGNITY in the long term F.R. Cruz, Porto (PT) Injecting tips for managing urinary incontinence with botulinum toxin type A M. Spinelli, Milan (IT) Injecting with botulinum toxin type A in the bladder and BoNee needle - Patient case video K.P. Jünemann, Kiel (DE) Injecting to improve patient outcomes - Standardisation of the procedure G. Karsenty, Marseille (FR) Chair summary and close K.P. Jünemann, Kiel (DE) Aims and objectives Provide an update and review the DIGNITY long-term extension study data Presentations of practical guidance on the use of botulinum toxin type A for neurogenic detrusor overactivity (NDO) in clinical practice Demonstration, via a pre-filmed injection video, of botulinum toxin type A injection procedure in the bladder Discussions on standardising the injection technique, including appropriate needle selection, in order to improve outcomes Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division EAU Milan

410 Sunday, 17 March Sponsored Session Management of OAB: Electing the right candidate for the right patient Sponsored Sessions euro Auditorium - Level S2 Symposium Chair: M.J. Speakman, Taunton (GB) Chairman s introduction M.J. Speakman, Taunton (GB) Historic milestones in the management of OAB P. Abrams, Bristol (GB) The heritage party policy I. Milsom, Gothenburg (SE) F. Haab, Paris (FR) The new party policy C.R. Chapple, Sheffield (GB) C. Gratzke, Munich (DE) Putting policies into practice - case study discussion P. Abrams, Bristol (GB) C.R. Chapple, Sheffield (GB) C. Gratzke, Munich (DE) I. Milsom, Gothenburg (SE) M.J. Speakman, Taunton (GB) Closing remarks from each party C.R. Chapple, Sheffield (GB) I. Milsom, Gothenburg (SE) Chairman s summary M.J. Speakman, Taunton (GB) Aims and objectives With the arrival of additional therapeutic options for OAB, this symposium will provide a topical and interactive evaluation of current and future treatments and consider how they may fit in future treatment algorithms, utilising clinical data, experience and case studies. Sponsored by ASTELLAS 410 Programme Book

411 Sunday, 17 March Sponsored Session Nocturia: Definitive diagnosis for better patient outcomes Yellow Hall Level N1 Symposium Chair: P.E. Van Kerrebroeck, Maastricht (NL) Welcome and introduction P.E. Van Kerrebroeck, Maastricht (NL) Sponsored Sessions Breaking the patient stereotype A.J. Wein, Philadelphia (US) What is different about nocturia? M. Oelke, Hanover (DE) Non-antidiuretic vs antidiuretic pharmacotherapy for nocturia J. Weiss, New York (US) Round-up of patient case studies P.E. Van Kerrebroeck, Maastricht (NL) Questions and answers Aims and objectives This Ferring Pharmaceuticals-sponsored symposium aims to provide an overview of the variety of clinical characteristics of patients with nocturia, and the multifactorial nature of the mechanism of the disease. The symposium will: Provide an overview of the prevalence and consequences of nocturia (Philip Van Kerrebroeck, the Netherlands) Discuss case studies of patients with nocturia and their diagnoses through audience interaction (Alan Wein, USA) Review current understanding of the mechanism of nocturia and discuss treatment algorithms and guidelines (Matthias Oelke, Germany) Summarise the evidence for efficacy of available pharmacotherapies for nocturia (Jeffrey Weiss, USA) Sponsored by FERRING PHARMACEUTICALS EAU Milan

412 Sunday, 17 March Sponsored Session Sponsored Sessions Towards individualisation of prostate cancer treatments: From bench to bedside Brown Hall 3 - Level S2 Symposium Chair: P. Hammerer, Braunschweig (DE) Introduction P. Hammerer, Braunschweig (DE) Learnings from breast cancer management in treatment indivualisation (biology and treatment strategy) G. Curigliano, Milan (IT) Biology on prostate cancer: Will future biomarkers kill PSA? L. Martínez Piñeiro, Madrid (ES) A. Thompson, London (GB) Enhanced individualisation through new strategies in CRPC M. Eisenberger, Baltimore (US) Treatment individualisation up to patient support P. Hammerer, Braunschweig (DE) Aims and objectives The goal of this symposium is to promote the individualized approach of prostate cancer treatment. Learning from the treatment individualization approach in breast cancer management could generate new possibilities to stratify prostate cancer with regards to its aggressiveness. The introduction of targeted therapeutics into the clinical therapeutic arsenal generates major opportunities for further development of cancer biomarkers. Finally, the arrival of new hormonal pathway targeting drugs will stimulate the development of new treatment strategies leading to a more individualized treatment of prostate cancer patients. Sponsored by IPSEN 412 Programme Book

413 Sunday, 17 March Sponsored Session Clinical conundrums in the treatment of metastatic castrationresistant prostate cancer Silver Hall - Level N2 Symposium Chair: P.F.A. Mulders, Nijmegen (NL) Moderator: C. Hood, London (GB) Sponsored Sessions Introduction P.F.A. Mulders, Nijmegen (NL) Defining disease progression in metastatic CRPC J.E. Gschwend, Munich (DE) The role of corticosteroids in the treatment of metastatic CRPC M. De Santis, Vienna (AT) C. Parker, London (GB) Emerging treatment options for the chemotherapy naive patient P.F.A. Mulders, Nijmegen (NL) Q&A session. Summary and close M. De Santis, Vienna (AT) J.E. Gschwend, Munich (DE) P.F.A. Mulders, Nijmegen (NL) C. Parker, London (GB) Aims and objectives Recently a number of therapies have been approved providing more options for treatment and improving outcomes for men with advanced prostate cancer. The satellite symposium sponsored by Janssen Pharmaceutical Companies of Johnson & Johnson entitled Clinical conundrums in the treatment of metastatic castration-resistant prostate cancer will address key topics on the management of patients with metastatic castration-resistant prostate cancer (CRPC) in daily clinical practice. The different definitions of disease progression in metastatic CRPC, and ways in which progression in the clinic is monitored will be explored. The role of corticosteroids in the treatment of metastatic CRPC will be considered and the latest data for androgen biosynthesis inhibition in the pre-chemotherapy setting will also be presented. Throughout the symposium you will be invited to participate in an interactive activity to provide your views on key topics in management of patients with metastatic CRPC. A panel discussion is also included in the program to encourage you to ask questions, exchange ideas, and to share experiences relevant to everyday clinical practice. Sponsored by JANSSEN PHARMACEUTICAL COMPANIES OF JOHNSON & JOHNSON EAU Milan

414 Sunday, 17 March Sponsored Session Burden of illness and optimal management of recurrent cystitis Sponsored Sessions Amber Hall Level S2 Symposium Chair: K.G. Naber, Straubing (DE) Antimicrobial susceptibility and resistance in urological infections worldwide: Surveillance and prevention F.M.E. Wagenlehner, Giessen (DE) Guidelines in urinary tract infections (UTI): The place of immunoactive-prophylaxis in recurrent UTI management K.G. Naber, Straubing (DE) Burden of illness of recurrent UTI: Clinical benefit of oral immunostimulation and impact on patients quality of life B. Wullt, Lund (SE) Responders profile and evidence in clinical practice P. Tenke, Budapest (HU) Aims and objectives Progressive increase of antibiotic resistance is a major concern worldwide. Resistance surveillance programs and infection control measures may be useful in delaying resistance, but rarely capable to reduce the incidence of infections caused by multi-drug resistant (MDR) organisms. On the other hand, new antimicrobials will not likely become available before the next decade. Specifically, with regard to recurrent urinary tract infection (ruti), the increasing resistance to several antibiotic classes support the need to use alternative preventative approaches in order to spare the limited antibiotic armamentarium. European Association of Urology (EAU) Guidelines recommend: i) counseling and behavioral modifications to eliminate modifiable risk factors for ruti and ii) non-antimicrobial prophylaxis before any antibiotic prevention. Several non-antimicrobial measures that do not increase antibiotic resistance are currently available with different grades of recommendation according to the scientific level of evidence. The oral immunoactive prophylaxis with E.coli extracts (OM-89) deserves the highest grade of recommendation in the EAU Guidelines compared to other alternative strategies because its efficacy is sufficiently well documented in several randomized double blind placebo controlled studies and 2 meta-analysis. The immunological properties and the clinical safety and efficacy of oral bacterial lysates (OM-89) will be addressed in details in the symposium. Furthermore the detrimental impact of recurrent cystitis on patients quality of life will also be highlighted and the beneficial effects of the immunoactive therapy on life quality indicators will be presented. There is some evidence that specific populations, including patients at higher risk for recurrent cystitis, could benefit more by immunoprophylaxis but further controlled studies are desirable. In the meantime, useful evidence comes from daily clinical practice; some case studies will be shown and debated. Sponsored by OM PHARMA SA 414 Programme Book

415 Sunday, 17 March Sponsored Session BPH and inflammation, from lab to clinic Red Hall 1 - Level N1 Symposium Chair: R. Bartoletti, Florence (IT) State of the art: The link between BPH and inflammation M.J. Ribal, Barcelona (ES) Sponsored Sessions Clinical approach: Why and how to evaluate prostatic inflammation? V. Ficarra, Padua (IT) Therapeutic approach: How to take charge of prostatic inflammation? A. De La Taille, Creteil (FR) Aims and objectives Emerging evidence indicates that prostatic inflammation may contribute to prostate growth. During this symposium, the relation between inflammation and BPH will be discussed. Some authors found a strong correlation between the amount of inflammatory infiltrate, IPSS, prostate volume and BPH progression. If inflammation is correlated with BPH, the ability of detecting inflammation without analysing prostate tissue specimens can be discussed. Finally, it is of interest to determine if inflammation could be considered as a therapeutic target for BPH, and with which therapeutic approaches. Sponsored by PIERRE FABRE MEDICAMENT EAU Milan

416 Sunday, 17 March Sponsored Session Silodosin: A first choice for the pharmacological treatment of BPH Sponsored Sessions Brown Hall Level S2 Symposium Chair: F. Montorsi, Milan (IT) Opening remarks F. Montorsi, Milan (IT) BPH: Where we are today F.C. Hamdy, Oxford (GB) Which patient and why - An analysis of pooled data from the phase III studies in EU and US H. Lepor, New York (US) G. Novara, Padova (IT) The real life profile of the BPH patient H. Botto, Suresnes (FR) Clinical cases and discussion F. Montorsi, Milan (IT) Concluding remarks F. Montorsi, Milan (IT) Aims and objectives This symposium will discuss the potential role of silodosin, a highly selective alpha 1a-antagonist, with reference to its usefulness as a first line pharmacological treatment of BPH. This innovative and interactive programme will include a review of the latest pooled data analysis from studies across the EU and US, highlighting the efficacy and safety of silodosin in a large patient population and in particular subpopulations. It will look at the real life profile of a patient with BPH with a presentation emphasizing the appropriate clinical management of patients presenting with symptoms of LUTS/BPH. The faculty will also present interactive clinical cases and the audience will be encouraged to participate in the discussions around appropriate management of these patients. Sponsored by RECORDATI 416 Programme Book

417 Sunday, 17 March Sponsored Session Focal therapy in localised prostate cancer Amber Hall Level S2 Symposium Chair: C. Stief, Munich (DE) Guest of honour P. Palma, Campinas (BR) Sponsored Sessions Welcome and opening remarks C. Stief, Munich (DE) Mechanism of action H.G. Van Der Poel, Amsterdam (NL) Phase II studies meta-analysis (safety, efficacy and quality of life) J. Rassweiler, Heilbronn (DE) 4 years results of the phase II studies/retreatments (no loss of chance) E. Barret, Paris (FR) European phase III trial update A.R. Azzouzi, Angers (FR) Focal therapy for prostate cancer a new paradigm E. Solsona, Valencia (ES) Questions/answers and panel discussion Aims and objectives The current choice for men with localized prostate cancer is either radical therapy or active surveillance. In the last decade a new therapeutic approach, aiming at the focal treatment of the cancer, has gained increasing use. TOOKAD Soluble Vascular Targeted Photodynamic (VTP) therapy is a novel focal therapeutic modality that enables the occlusion of the entire tumor vasculature in a few minutes of treatment, which results in the necrosis of the prostatic tumor. During this symposium, participants will hear new information regarding this new molecule: TOOKAD Soluble, gain a good understanding of the mechanism of action, efficacy, safety and tolerability of the product, and will receive updated information on the ongoing European Phase III study. Sponsored by STEBA BIOTECH EAU Milan

418 Monday, 18 March Sponsored Session Sponsored Sessions Urinary incontinence - Optimising the patient experience and improving outcomes Amber Hall 6 - Level S2 Workshop Chair: K.P. Jünemann, Kiel (DE) Introduction and welcome K.P. Jünemann, Kiel (DE) Injecting with DIGNITY in the long term F.R. Cruz, Porto (PT) Injecting tips for managing urinary incontinence with botulinum toxin type A M. Spinelli, Milan (IT) Injecting with botulinum toxin type A in the bladder and BoNee needle - Patient case video K.P. Jünemann, Kiel (DE) Injecting to improve patient outcomes - Standardisation of the procedure G. Karsenty, Marseille (FR) Chair summary and close K.P. Jünemann, Kiel (DE) Aims and objectives Provide an update and review the DIGNITY long-term extension study data Presentations of practical guidance on the use of botulinum toxin type A for neurogenic detrusor overactivity (NDO) in clinical practice Demonstration, via a pre-filmed injection video, of botulinum toxin type A injection procedure in the bladder Discussions on standardising the injection technique, including appropriate needle selection, in order to improve outcomes Sponsored by ALLERGAN and PORGÈS, a COLOPLAST division 418 Programme Book

419 Monday, 18 March Sponsored Session Interactive debate: How seriously should I take male LUTS? Silver Hall - Level N2 Symposium Chair: K-D. Sievert, Tübingen (DE) Introduction K-D. Sievert, Tübingen (DE) Sponsored Sessions Entertaining debate on male LUTS, covering topics you are confronted with in daily clinical practice, such as quality of life impairment, changing regulations and EU budget cuts P. Dixon, London (GB) M.J. Drake, Bristol (GB) R. Elliott, Nottingham (GB) R. Bergstrom, Brussels (BE) Aims and objectives Are you still not interested in a condition that affects most men at some point in life? Do you want to be part of something completely different? Do you enjoy when evidence is challenged in a dynamic way? Then join this debate on male LUTS, covering topics you are confronted with in daily clinical practice. Don t miss the interactive and provocative keynote from Patrick Dixon, futurist and top stand-up moderator, proven to tell a good story!. It will change your view on male LUTS. Enjoy the debate LUTS/BPH is an unimportant medical condition and no-one cares about it. Why should it be reimbursed? where Patrick Dixon will challenge the faculty of 2 urologists, a health economics expert and the Director General of the EFPIA about issues such as changes in priorities of government budgets for spending on LUTS. Sponsored by ASTELLAS EAU Milan

420 Monday, 18 March Sponsored Session Sponsored Sessions New data on androgen deprivation with a GnRH antagonist: Improving patient outcomes in prostate cancer Yellow Hall Level N1 Symposium Chairs: T.M. De Reijke, Amsterdam (NL) Welcome and introduction T.M. De Reijke, Amsterdam (NL) Radiotherapy with androgen deprivation: A combined approach to improve outcomes T. Wiegel, Ulm (DE) Is intermittent androgen deprivation really equivalent to continuous therapy? I.J. De Jong, Groningen (NL) Disease control: Comparative data from degarelix vs LHRH agonists T.M. De Reijke, Amsterdam (NL) Cardiovascular risk and ADT: New data, new insights P.C. Albertsen, Farmington (US) Panel discussion and concluding remarks T.M. De Reijke, Amsterdam (NL) Aims and objectives To present the latest data on androgen deprivation therapy for prostate cancer, in a clinically meaningful way that will facilitate improved patient care Sponsored by FERRING PHARMACEUTICALS 420 Programme Book

421 Monday, 18 March Sponsored Session Castration-resistant prostate cancer in 2013: Analysing the good, the bad and the ugly Red Hall 2 - Level N1 Symposium Chairs: K. Miller, Berlin (DE) Welcome and introduction K. Miller, Berlin (DE) Sponsored Sessions Making the most of the multidisciplinary team for castration-resistant prostate cancer (CRPC) S. Joniau, Leuven (BE) New treatment options for metastatic CRPC J. Bellmunt, Barcelona (ES) Questions & answers Bone metastases: A defining feature of clinical course in CRPC K. Miller, Berlin (DE) Bone-targeted therapy: A new era K. Fizazi, Villejuif (FR) Interactive faculty panel discussion Concluding remarks K. Miller, Berlin (DE) Aims and objectives Target audience This educational activity is appropriate for urologists, radiation oncologists, clinical oncologists, medical oncologists, and other healthcare professionals interested in the treatment of patients with castrationresistant prostate cancer (CRPC). The goal of this educational activity is to improve participants ability to provide optimal medical care for patients with CRPC. Learning objectives At the conclusion of this activity, participants should be able to: Evaluate strategies for effectively collaborating in a multidisciplinary team when managing patients with castration-resistant prostate cancer (CRPC) Select optimal second-line therapies for patients with docetaxel-resistant CRPC Employ best practices when managing bone metastases in men with CRPC Integrate novel bone-directed therapies and approaches when treating men with CRPC Sponsored by PRIME ONCOLOGY EAU Milan

422 A new vision to understanding medicine Handbook of Clinical Gender Medicine Editors Karin Schenck-Gustafsson, Stockholm Paula R. DeCola; Donald W. Pfaff, New York, N.Y. David S. Pisetsky, Durham, N.C. ATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCA GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCGTG ATCCAATGATAAGCATCACGGTATCCAATGATAAG GTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATC ATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCA GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCAA CGGTATCCAATGATAAGCATCACGG GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATG ATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCAC GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGA CATCACGGTATCCAATG GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTATCCAATGAT ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT GCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTA GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAA AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT GCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCA GTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATG ATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCA GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG GCTCACGGTATCCAATGATAAGCATCACGGT AGCATGATAAGCTCACGGTATCCAATGA GCATCACGGTATCCAATGATAAGCATGATGA TCCAATGATAAGCATGATAAGCTCACGGTA AATGATAAGCATCACGGTATCCAATGATAAG CACGGTATCCAATG GGT GCATGA TATCCAATGATAAG CCAATGATAAGCAT GGT GCATCA GATAAGCATGATAA CCAATGATAAGCAT ATG GCTCAC GT TC TGA TCCAA AT G TGA AATGAT A TG GGT GCATGA AGCATCACGGTATC AT GTA GCATCA AAGCTCACGGTATC AT ATG GCCACG TATCCAATGATAAG CACGGTATCCAATGAT TCCAATGATAAGCATGATAGCATGATAT ATCCAATGATAAG TAAG CAATGATAAGCATGA AATGATAAGCATCACGGTATCACGGT AGCATGATAAGCTC TGATAAGCATCACGGT GCATGATAAGCTCACGGT AGCATCACGGTATC ATGATAAGCTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAAT TG GCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTA AT ATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCA GTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT TCCAAT TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCA GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT CTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAG AAGCATCACGGTAT CAATGATAAG GTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATC ATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCA GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAAT GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGA ATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGA AATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGT GCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGT GCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATG GCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCAGCATG Handbook of Clinical Gender Medicine Editors Karin Schenck-Gustafsson Paula R. DeCola Donald W. Pfaff David S. Pisetsky ACGGT TATCCAATGA GATAA AAG AGCA ACGG CACGGTATCCAATG ATCACGGTGT ACGG GTATCCA TCCA ATGATAAG GCATG TGAT TAAG AGCATCACGGTATACGG ATCCAATGATA CAAT A AGCAT CACGGTATCCAATGATAAGCATGATAAG TATCCAATGATA XVI p., 62 fig., 4 in color, 63 tab.,soft cover, 2012 CHF 69. / EUR 51. / USD ISBN , e-isbn Prices subject to change EUR price for Germany, USD price for USA only In well-referenced chapters, experts cogently and concisely explain how the incorporation of gender issues into research can affect the medical understanding and treatment of heart disease, osteoporosis, arthritis, pain as well as malaria among other conditions. This intriguing and unique medical textbook provides readers with a valuable new perspective on how to incorporate gender issues into the different branches of medicine. More information and sample essays at: An independent international forum for clinically oriented research Editors M.P. Wirth, Dresden M. Porena, Perugia O.W. Hakenberg, Rostock D. Castro-Diaz, Santa Cruz de Tenerife B. Wullich, Erlangen Pay-per-View and Subscriber Access to Full Text Full Table of Contents Full Editorial Board Free Abstracts and Selected Articles Online Sample Issue Submission/Guidelines for Authors Subscription Details Free Alert Service Online Library Recommendation More information at: Deutsche Gesellschaft für Urologie KI13635 S. Karger AG, P.O. Box CH 4009 Basel (Switzerland) Fax orders@karger.com

423 EAU Membership What are benefits of being a member of the European Association of Urology? EAU Members benefit from many advantages: Publications European Urology, the official scientific EAU journal (12 issues per year, plus all published supplements). European Urology Today, the official EAU newsletter (6 issues each year). This publication aims at distributing information about the Association and about European urology in the broadest sense. European Urology Video Journal, a quarterly published DVD aiming to distribute the best information on urological diseases and techniques. The EAU Urology Updates, an educational publication, quarterly published as a supplement of European Urology. EAU Guidelines, a extensive series of guidelines on many urological diseases produced by the EAU Health Care Office. Historia Urologiae Europaeae (one volume each year on European historical subjects). Uroweb, the official EAU website, on which members have access to all different activities and programmes, such as slide library, European Urology on-line, webcasts of the congresses, on-line ESU courses etc. EU-ACME Programme Active, Active International, Junior and Junior International member of the EAU will be automatically participating in the European Urology - Accredited Continuing Medical Education (EU-ACME) Programme. The EU-ACME Programme is based on the EBU/UEMS rules and its primary task is the implementation, promotion and organisation of Continual Medical Education (CME) among European Urologists. It provides the urologists with the system which helps them to keep track of their educational activities, irrespective of the country they practice in or where they have participated in CME and/or CPD activities. For more information see also page 46 and 47. So if you are not yet an EAU member, make certain to become one in Milan and visit the EAU Booth H17 in the exibition on level S0. About EAU EAU Congress and Meetings EAU Members will receive regular information on the Annual EAU Congress, as well as the meetings organised by the different EAU Sections, the EAU Education Office and the EAU Regional Office. Moreover, members will be able to receive a considerable discount on the registration fees of all EAU related meetings and events. EAU Education Programme EAU Members will receive regular information on all the activities organised by the European School of Urology, the EAU Office of Education. Members will be able to participate in the post-graduate teaching activities at reduced registration fees. EAU Members are also entitled to apply for the European Urological Scholarship Programme, which provides grants and organises clinical fellowships, short term visits and scholarship programmes. EAU Milan

424 EAU Offices About EAU EAU Board Executive Committee Secretary General P-A. Abrahamsson, Malmö (SE) Adjunct Secretary General Executive Member related to Science W. Artibani, Verona (IT) Adjunct Secretary General Executive Member related to Education H. Van Poppel, Leuven (BE) Treasurer and Executive Member related to Communication M. Wirth, Dresden (DE) Board Members C. Chapple, Sheffield (GB) B. Djavan, Vienna (AT) T. Esen, Istanbul (TR) D. Jacqmin, Strasbourg (FR) I. Korneyev, St. Petersburg (RU) L. Martínez-Piñeiro, Madrid (ES) V. Mirone, Naples (IT) R. Nijman, Groningen (NL) J. Palou, Barcelona (ES) K. Parsons, Liverpool (GB) D. Schultheiss, Giessen (DE) A. Stenzl, Tübingen (DE) Offices related to education EAU Education Office (ESU) Chairman J. Palou, Barcelona (ES) Members M. Babjuk, Prague (CZ) M. Drake, Bristol (GB) M. Kuczyk, Hanover (DE) E. Liatsikos, Patras (GR) O. Traxer, Paris (FR) H. Van Der Poel, Amsterdam (NL) J. Van Moorselaar, Amsterdam (NL) Consultant D. Pushkar, Moscow (RU) Ex-officio Members L. Martínez-Piñeiro, Madrid (ES) A. Mottrie, Aalst (BE) H. Van Poppel, Leuven (BE) EU-ACME Office Chairman R. Nijman, Groningen (NL) Members M. Brehmer, Stockholm (SE) A. Figueiredo, Coimbra (PT) S. Müller, Bonn (DE) P. Nyirády, Budapest (HU) J. Palou, Barcelona (ES) H. Van Poppel, Leuven (BE) Ex-officio Member P-A. Abrahamsson, Malmö (SE) European Urological Scholarship Programme Office Chairman V. Mirone, Naples (IT) Past Chairman C-C. Abbou, Creteil (FR) Members T. Borkowski, Warsaw (PL) M. Burchardt, Greifswald (DE) M. Ribal, Barcelona (ES) J. Witjes, Nijmegen (NL) Ex-officio Members S. Larré, Reims (FR) L. Martínez-Piñeiro, Madrid (ES) J. Schalken, Nijmegen (NL) H. Van Poppel, Leuven (BE) Guidelines Office Chairman K. Parsons, Liverpool (GB) Members M. Fall, Gotenborg (SE) J. Irani, Poitiers (FR) C. Llorente, Madrid (ES) J. N Dow, Aberdeen (GB) R. Sylvester, Brussels (BE) Ex-officio Member H. Van Poppel, Leuven (BE) Young Urologists Office Chairman T. Esen, Istanbul (TR) Chair Italian Resident Organisation G. Patruno, Rome (IT) Chair UK Resident Organisation B. Grey, Salford (GB) Chair French Resident Organisation J-E. Terrier, Lyon (FR) Chair Turkish Resident Organisation O. Ergün, Isparta (TR) Chair German Resident Organisation S. Schöne, Neustadt an der Weinstrasse (DE) Chair Spanish Resident Organisation A. Vilaseca Cabo, Barcelona (ES) ESRU Secretary G. Martinez, Koper (SL) ESRU Chair Z. Tandoğdu, Istanbul (TR) ESRU Chair Elect C. Ruf, Hamburg (DE) Young Academic Urologists S. Larré, Reims (FR) F. Sanguedolce, Barcelona (ES) M. Sedelaar, Nijmegen (NL) Ex-officio Member H. Van Poppel, Leuven (BE) Offices related to science Regional Office Chairman B. Djavan, Vienna (AT) 424 Programme Book

425 Scientific Congress Office Chairman A. Stenzl, Tübingen (DE) Members A. Alcaraz, Barcelona (ES) C. Bangma, Rotterdam (NL) A. Briganti, Milan (IT) F. Burkhard, Berne (CH) X. Cathelineau, Paris (FR) J. Catto, Sheffield (GB) Z. Culig, Innsbruck (AT) A. De La Taille, Creteil (FR) D. De Ridder, Leuven (BE) W. Feitz, Nijmegen (NL) G. Janetschek, Salzburg (AT) S. Michel, Mannheim (DE) P. Radziszewski, Warsaw (PL) J. Sønksen, Herlev (DK) B. Tombal, Brussels (BE) Consultant M. De Santis, Vienna (AT) Ex-officio Members P-A. Abrahamsson, Malmö (SE) W. Artibani, Verona (IT) B. Djavan, Vienna (AT) L. Martínez-Piñeiro, Madrid (ES) F. Montorsi, Milan (IT) J. Palou, Barcelona (ES) K. Parsons, Liverpool (GB) H. Van Poppel, Leuven (BE) M. Wirth, Dresden (DE) Video Congress Committee Chairman A. Messas, Nanterre (FR) Members A. Carbone, Latina (IT) I. De Jong, Groningen (NL) P. Geavlete, Bucharest (RO) F. Van Der Aa, Leuven (BE) Section Office Chairman L. Martínez-Piñeiro, Madrid (ES) Chairmen Sections ERUS: A. Mottrie, Aalst (BE) ESAU: W. Weidner, Giessen (DE) ESFFU: J. Heesakkers, Nijmegen (NL) ESGURS: S. Deger, Ostfildern (DE) ESIU: T. Bjerklund Johansen, Århus (DK) ESOU: M. Brausi, Modena (IT) ESTU: A. Figueiredo, Coimbra (PT) ESUI: J. Walz, Marseille (FR) ESUP: A. Lopez-Beltran, Cordoba (ES) ESUR: Z. Culig, Innsbruck (AT) ESUT: J. Rassweiler, Heilbronn (DE) EULIS: P. Osther, Fredericia (DK) Offices related to communication History Office Chairman D. Schultheiss, Giessen (DE) Members C. Alamanis, Athens (GR) J. Elo, Helsinki (FI) R. Engel, Baltimore (US) L. Fariña-Pérez, Vigo (ES) J. Felderhof, Hoofddorp (NL) P. Figdor, Vienna (AT) A. Figueiredo, Coimbra (PT) A. Jardin, Paris (FR) J. Mattelaer, Kortrijk (BE) S. Musitelli, Milan (IT) P. Rathert, Düren (DE) I. Romics, Budapest (HU) M. Skopec, Vienna (AT) R. Sosnowski, Warsaw (PL) P. Thompson, London (GB) A. Verit, San Liurfa (TR) Offices related to governance International Relations Office Chairman C. Chapple, Sheffield (GB) Consultants F. Cruz, Porto (PT) C. Llorente, Madrid (ES) M. Marberger, Vienna (AT) A. Patel, London (GB) J. Thüroff, Mainz (DE) Ex-Officio Members P-A. Abrahamsson, Malmö (SE) W. Artibani, Verona (IT) H. Van Poppel, Leuven (BE) M. Wirth, Dresden (DE) Membership Office Chairman I. Korneyev, St. Petersburg (RU) Strategy Planning Office Chairman D. Jacqmin, Strasbourg (FR) Members M. Brausi, Modena (IT) S. Buntrock, Bad Wildungen (DE) B. Malavaud, Toulouse (FR) H. Hashim, Bristol (GB) C. Surcel, Bucharest (RO) H-G. Tiselius, Stockholm (SE) Ex-officio Member P-A. Abrahamsson, Malmö (SE) Search & Nomination Committee 2012/2013 Chairman P-A. Abrahamsson, Malmö (SE) Members R. Ackermann, Düsseldorf (DE) W. Artibani, Verona (IT) C. Chapple, Sheffield (GB) D. Jacqmin, Strasbourg (FR) M. Wirth, Dresden (DE) About EAU EAU Milan

426 Additional EAU Foundation for Urological Research Chairman P. Mulders, Nijmegen (NL) Members T. Bjerklund Johansen, Århus (DK) M. Colombel, Lyon (FR) A. Patel, London (GB) A. Tubaro, Rome (IT) B. Watson, Dublin (IE) W. Witjes, Arnhem (NL) About EAU Ex-Officio Member V. Mirone, Napels (IT) Academy of Urology Chairman R. Ackermann, Düsseldorf (DE) Members P. Alken, Mannheim (DE) L. Boccon-Gibod, Paris (FR) A. Borkowski, Warsaw (PL) F. Debruyne, Arnhem (NL) P. Ekman, Stockholm (SE) U. Jonas, Hanover (DE) U. Studer, Berne (CH) P. Van Cangh, Brussels (BE) R. Vela Navarrete, Madrid (ES) European Urology Official journal of the EAU Editor in chief F. Montorsi, Milan (IT) 426 Programme Book

427 Historical Overview EAU Congresses September Padua, Italy September Prague, Czech Republic June Monte Carlo, Monaco May Athens, Greece May Vienna, Austria May Copenhagen, Denmark June Budapest, Hungary May London, United Kingdom June Amsterdam, The Netherlands July Genoa, Italy July Berlin, Germany About EAU September Paris, France March Barcelona, Spain April Stockholm, Sweden April Brussels, Belgium April Geneva, Switzerland February Birmingham, United Kingdom March Madrid, Spain March Vienna, Austria March Istanbul, Turkey April Paris, France March Berlin, Germany March Milan, Italy March Stockholm, Sweden April Barcelona, Spain March Vienna, Austria February Paris, France March Milan, Italy EAU Milan

428 Join the European Association of Urology, become a member, get involved! The EAU is the voice of European urologists, a non-profit scientific organisation dedicated to serving their members and representing their professional interests! Learn about the many benefits of being a member of the European Association of Urology. Free subscriptions to: EAU Scientific Journal: European Urology, Supplements, EAU-EBU Update Series EAU Newsletter: European Urology Today Historia Urologiae Europaeae EAU Guidelines European Urology Video Journal Member discounts on EAU products and services Registration benefits for EAU meetings EAU ID Card for automatic registration of EU-ACME credit points The EAU has a number of membership categories catering to all professionals involved in the speciality of urology. We invite you to become a member today!

429 Abstract authors A Aaltonen K Aaronson N.K. 239 Abad C. 229 Abascal R. 229 Abassi Z. 202 Abbas M. 198 Abbona A.M. 130 Abbou C-C. 716, 753, V15 Abboudi H. 14 Abd-Alazeez M.A 218 Abdalla A. 836 Abdel Naeim M.A.A. 788 Abdel-Hakim A.M. 536 Abdel-Karim A. 537, 552 Abdel-Latif M Abdelbaky A.M. 865 Abdelbary A. 668 Abdelhafez M.F. 812, 964 Abdelrahim M Abdo A. 175, 178, 233, 262, 534, 820, 956, 1024 Abdollah F. 140, 179, 185, 187, 289, 474, 686, 687, 693, 694, 695, 714, 806, 953 Abdul-Muhsin H. 18, 299, 689, 1013, V10, V13 Abdulhak A. V16 Abe T. 931 Abl-Azzeez M. 717 Abo-Elenen M. 214 Abol Enein H. 1038, 1069 Abolfotoh A. 537 Abou Hashem S.E. 836 Aboumarzouk O. 370, 599 Abrams P. 737 Abramyan K.N. 115 Abrate A. 583, 831, 832 Abroaf A. 781 Abt D. 310 Aburatani H. 764 Acar I.C. 291 Adam G. 359 Adam M. 293, 920, 1006 Adamowicz J.A. 869 Adanur S. 417, 616 Addali M. V16 Adding C Adot Zurbano J.M. 888 Adsan Ö. 111, 794 Afandiyev F. 527 Afoko A.A. 212 Afshar-Oromieh A. 227 Agarwal N Agarwal P.K. 1031, 1032 Agarwal V Agelidou M. 423 Aggamy M. 668 Agra C. 606, 607 Agrawal S. 600 Agreda F. 6, 682 Agresta T.S. 525 Agudelo J.A. V36, V39 Aguiar S. 557 Aguilera A. 498 Ahallal P. 883 Ahallal Y. 352, V48 Ahmad S. 599 Ahmadi H. 220 Ahmed H.U. 218, 353, 584, 585 Ahmed H. 717 Ahmed K. 14, 19, 20, 1031, 1032 Ahn H. 80, 196, 466, 469, 478, 771, 807, 1005, 1010, 1097 Ahn H.S. 460 Ahn J.H. 691 Ahn T.Y. 410 Aho T.F. 952 Ahyai S.A. 866, 990, 1002, 1004 Aikawa K. 446 Aillet G. 472 Aisain I. 595 Aitken E. 374, 377, 495 Aizawa N. 64, 67 Akagashi K. 121 Akbarov I.A. 624 Akduman B. 128 Aki F.T. 643 Akihama S.A. 610, 1100 Akihiro K. 59 Akino T. 931 Akita H. 818 Aksenov A.V. 188, 358 Aksoy Y. 417 Akyurek E. 128 Al Mahmid M. 890 Al Qahtani S.M. 432 Al Wadaani H. 420 Al-Ahmadie H.A. 749 Al-Bulushi Y. 72, 514 Al-Matar B. 812 Al-Qahtani S.M. 366 Al-Salam S. 609 Al-Shukri S.K. 667 Al-Zahrani A Alam Z. 530 Alamanis C. 41 Alarcon R Albanesi L. 486 Albei C. 405 Albersen M. 252, 324, 326, 327, 328 Alberts A.R. 688 Albertsen P. 677 Albisinni S. 800 Alcaraz A. 34, 206, 208, 236, 237, 313, 378, 383, 436, 489, 491, 494, 496, 498, 595, 639, 993 Aldahshoury M. 528 Aldayel A. 668 Aldridge P. 623 Alekseev B.Y. V43 Alemozaffar M. V12 Alessandria E. 376, 431, 1066, 1071 Alexander C.E. 523 Alexandre L. 449, 900 Algaba F. 281, 287 Ali A.S.M. 623 Ali Z. 44 Ali-El-Dein B. 822, 934 Alibhai S.M. 886 Alipanah R. 598 Alivizatos G. 521 Aljabery F. 481 Allasia M. 95, 864 Allen C. 218, 267, 584, 585, 717 Allen S.E. 314 Allory Y. 716, 753 Alloussi S.H. 72, 514, V59 Alloussi S. 72, 514 Almousa R. 668 Alnajjar H.M. 389 Alonso Prieto M.A. V60 Alonso Rodriguez D. 113 Alonso Y Gregorio S. 556, 1036 Alsudani M. 39 Althaus P. 192 Altin R. 128 Indices Numbers refer to abstract numbers EAU Milan

430 Abstract authors Indices Altinkilic B. 897 Alturas Silva J. 669 Alumkal J.J. 100 Alvarez E. 606 Alvarez M Alvarez Rodríguez S. 346, 501 Alvarez-Ossorio Fernandez J.L. V33 Alvarez-Vijande R. 34, 313, 436, 489, 494, 639 Alves E.F. 30 Amano M. 197 Amarenco G. 401, 743 Ambrose C. 910 Amend B. 306, 629, 964, V54, V71 Ametov R.E. 797 Ameye F. 360 Amiel J Amin M. 287 Ammi M. 87, 778, 1105 Amore D. 412 Amorim R.F. 895 Amparore D. 204, 630, 875 Amsellem-Ouazana D. 235 Amón J.H. 760 An J. 325 Anastasio De Las Heras P. 334 Anastasopoulos P. 548 Anderson P. 85, 145, 704 Andersson F. 405, 406 Andersson K-E. 68, 443, 447, 909 Ando R. 311 Andres G. 524, 1030, V7 Andrianov A.N. V43 Angelergues A. 104 Angerri O. V35 Angulo J. 40, 401, 524, 760, 1030, 1034, V5, V7, V8, V9 Anis E. 511 Ansieau J-P. 171, 176 Antonelli A. 172, 259, 264, 340, 499, 887 Antunes Lopes T. 669, 673 Anyamene N. 268 Aoyagi T. 931 Apostolidis A. 733 Appel B. 131 Arafat W. 72, 514 Aragona M. 867 Arai Y. 21, 720 Arakawa S. 663 Arance I. V8 Arano P. 999 Araujo A.B. 211 Arcaniolo D. 560, 622 Ardelt P. 697 Arden-Close E.J. 275 Arellano J. 99 Arenas Da Silva L.F Arentsen H.C. 153, 700 Areskoug B. 120 Arfi N. 705 Argirovic A. 518, 1060 Argirovic D. 518, 1060 Arguelles-Salido E. 804 Argun B. 529 Argüelles-Salido E. 917 Arias E. V36, V39 Arias Fúnez F. 346, 379 Arima K. 978 Arisawa C. 572, 819 Arlandis S. 746 Armitage J.N. 658 Arnaud L. 245 Arnoux V.A 563 Aroasio E. 204 Aron M. 220, V45, V79 Arosio M. 692 Arrabal Martin M. 312 Arrabal Polo M.A. 312 Arriaga J. V6 Arrighi N. 499, 887 Artmann A. 250, 871 Artmann G.M. 250 Arum C.J. 152 Arumi D. 740 Arver S. 211 Arvin-Berod A. 283 Arya M. 16, 717, 879 Asakuma J. 574, 827 Asano T. 57, 144, 827, 976, 977 Asano T. 57, 144, 574, 827, 976, 977 Ascalone L. 382, V50 Ashworth D. 395 Asiain I. 208 Aslan Y. 615 Astroza G. 653, 661, 967 Atac F. 117, 163, 381 Atan A. 615 Ataus S. 479 Atduev V. 354 Ather H Atiemo H. 119 Attisani F. 486, 580 Attwood K. 882 Audenet F. 87 Audet A. 449 Auerbach S.M. 739 Aufderklamm S. 364, 861, 899, 1049, 1054 Aureli M. 146 Aurelian J. 17 Aurora H. 126 Aus G. 808 Ausmees K. 216 Aussie J Austin R. 939 Autenrieth M. 809 Autier P. 353 Autieri D. 914 Autorino R. 20, 91, 255, 256, 257, 552, 990, 1093, 1094, V2, V3, V22, V27, V30 Autran A.M Avances C. 283 Avelino A. 65 Awad H. 202 Awrey S. 50 Axell R. 142 Aydin I. 962 Ayis S. 16 Ayres B. 593 Aytac B. 652 Aziz A. 282, 286, 815 Azizov I. 893 Azone I. 74 Azzabi F.Z. 246, 874 Azzouzi A.R. 87, 778, 1105 B Baba S. 21 Babjuk M. 276, 575, 601, 697, 815, 822 Bach C. 654, 963, 1067 Bach T. 636, 1067 Bachke S. 152 Bachmann A. 167, 461, 618, 634, 945, 990, 1004 Numbers refer to abstract numbers 430 Programme Book

431 Baco E. 221 Bacsu C. 732 Badalato G.M. 284 Badani K.K. 1031, 1032 Bader A.N. 999 Badescu B.G. 384 Badke A. 306 Bae J.H. 445, 611 Bae K-H. 535 Bae W.J. 445, 611 Bagrodia A. 552 Bahilo P. 543 Bahl A. 230 Bahn D. 265 Baig M.B. 530 Baiocchi G. 557 Baker K. 785 Bakshi S. 541 Balasch J. 34 Balasubramanian S. 823 Balbay M.D. 1031, 1032 Balconi G. 583 Ballanger P. 96, 763 Ballesca J.L. 34 Baltzer P. 345 Banakhar A. 307 Banchik E.L. 787 Banckwitz R. 321 Banfi A. 868 Bangma C.H. 1, 5, 217, 680 Baniel J. 697, 815 Bannowsky A. 127 Banyra O. 507 Barbanti G. 798 Barber N. 638 Bardelli I Bardonnaud N. 426, 427, 429 Barentsz J.O. 12, 582 Barker A.T. 403 Barletta D. 894 Baron A. 306 Barrass B.J.R. 762 Barrese F. 517 Barret E. 352, 589, 679, 883, 1020, V48, V64 Barrett M.T. 945 Barrett T. 142, 224 Barry Delongchamps N. 141, 235 Bartkowiak D. 192 Bartoletti R. 166, 508, 509, 619, 697 Bartolozzi C Bartsch G. 825 Bascu C. 114 Baskin-Bey E. 674 Bassi S. 894 Bastarós J.M. 6 Bastian P. 286, 686, 688, 911 Bastien L. 87 Baston C. 384 Battaglia A. 95, 864 Battaglia F. 770 Battaglia M. 662 Bauer C. 863 Bauer R.M. 726, 999, 1004 Bauer W Baukloh V. 27 Baumert H. 87, 170, 171, 176, 1105 Baumgart S. 774 Baumgartner M. 133 Beatrice J. 133 Beatty J. 268 Bechara G.R. 29 Becher E. 587 Becht E. 696 Beck S. 51 Becker A. 175, 178, 272, 293, 685, 718, 752, 820, 920, 956, 960 Becker A. 844, 847, 923 Becker F. 338, 703 Becker T. 644 Bedke J. 306, 629, 964, 1054, 1062, V71 Beer T.M. 97, 103 Beermann S. 272 Behnsawy H Behr-Roussel D. 449, 900 Behre H.M. 211 Behrendt M. 554 Beier J. 790, 795, V70 Bektic J. 7, 803 Belfield J. 590 Belgrano E. 817 Belldegrun A.S. 193 Bellec L. 87, 170, 171, 176 Bellessort A. 743 Bellezza G. 147, 933 Bellina M. 864 Bellomo F. 592 Belomyttcev S.V. 796 Beltran L. 58 Belyaev I. 893 Ben Ali M. 520 Ben Messaoud N. 768 Ben Rais N. 520 Ben-Zvi T. 638 Benadiba S. 734 Bendahl P.O. 750 Benecchi L Benedetto G. 319 Benelli A. 817 Bengoa N. 941 Benigni F. 69, 146, 328, 451, 651, 831, 832 Benito Garcia P. V42 Bennett P.R. 910 Bensadoun H. 500 Bensalah K. 87, 176, 261, 576, 813, 852, 1105 Benson M.C. 485 Benvenuto S. 838 Benvenuto S. 817 Benzon Larsen S. 858 Berardinelli F.B. 408, 1093, 1094 Berdah S. 245 Berdondini E. 798 Bergdahl S. 808 Berger A. V45, V79 Berger C. 644 Berger J. 170, 171, 176, 283, 458, 1105 Berges R. 629 Berglund A. 808 Berman M. 719, 946 Bernabé J. 449, 900 Bernardini S. 426, 427, 429 Bernecker R. 22 Bernhard J-C. 87, 96, 170, 171, 176, 283, 763, 1105 Bertaccini A. 711 Bertini R. 173, 340, 467, 953 Bertolo R. 204, 219, 710, 875, V11 Bettendorf O. 465 Bettiga A. 146, 328, 331, 363, 443 Bettocchi C. 662 Betts C. 775 Indices Numbers refer to abstract numbers EAU Milan

432 Abstract authors Indices Beukers W. 54, 238 Beuvon F. 141 Beuzeboc P. 104 Beveridge S. 351 Bex A. 392, 394 Beyer B. 226, 359, 1023 Bhandari M. 19 Bhat A.L. 418, 421, 424 Bhat M. 418, 421, 424 Bhatt J.R. 38, 45, 1077 Bhatt R.I. 453 Bhayani S. 876 Bhide A. 672, 725 Bhindi B. 988 Bhojani N. 659 Bianchi C. 769 Bianchi G. 172, 264, 439, 817, 887 Bianchi L. 271, 711 Bianchi M. 140, 182, 187, 473, 686, 687, 714, 748, 806, 960 Bianco A. 147, 933 Bianco R. 622 Biancone L. 376 Biasoni D. 83, 388, 397, 398, 1055, 1057 Bielik R. 833 Bielsa O. 229 Bienko M. 19 Bigot P. 87, 170, 171, 176, 283, 778, 1105 Bilasy S.E. 33 Bilhim T. 628 Billingham L.J. 239 Binbay M. 660 Bini V. 137, 848 Birch B. 275 Birchall C. 623 Birder L. 65 Birkhäuser F.D. 193, 330, V44 Birtle A. 81 Bischoff S.C. 861 Bisconti A. 431, 1066, 1071 Bissler J.J. 981 Bitker M-O. 304 Bittard H. 426, 427, 429 Bivalacqua T.J. 324, 326, 327, 815 Bizzarri C.N. 711 Bjarnason G.A Bjartell A. 826, 856 Björnsson S Black P.C. 50 Bladou F Blaheta R. 825, 830 Blanchet P. 136 Blanco S. 692 Blasco M. 491 Blauwet M.B. 401, 739 Blazquez J 498 Blemings A. 406 Blessig T. 72 Blumenstengel K Blumenstock G Blutbacher P. 365 Blázquez C. 482, 757 Bocchi F Bocchi P Bocciardi A.M. 172, 264 Bochner B.H. 749 Bödecker H. 160 Bodnar M.B. 869 Boehm K. 226 Boerman O.C. 336, 980 Boers-Sonderen M.J. 336 Boissier R. 245 Bokhorst L.P. 5 Bolenz C. 286, 576, 1052 Bolle W.A.B.M. 680 Bollito E. 219, 710 Bolognesi A. 183 Bomanji J. 391 Bombelli S. 769 Bomers J. 582 Bonet A. 208 Bonillo Garcia M.A. 888 Bonkat G. 167, 618 Bonneau C. 430 Bono A. 708 Boorjian S.A. 75, 151, 924, 957 Boren J. 833 Borer J.S. 739 Borghesi M. 186, 258, 271, 290, 454, 711, 913 Borghi M. 587 Borgogno C. 438 Boronat Tormo F. 231, 543, 805 Boros M. 251 Borre M. 674, 683 Borrego J. 482 Bos D.L. 980 Bosch J.L.H.R. 648 Bose P. 3 Bosio A. 95, 376, 431, 864, 1066, 1071 Boss A. 874 Bosset P.O. 137, 716, 848 Bossi I Bostanci Y. 117, 163, 381 Boström M.M. 154 Boström P.J. 154 Botelho F. 210 Bott S. 351 Bottke D. 192 Bottone F. 560 Bouazza N. 141 Boudes M. 441 Boulos V. 37, 843 Bourdoumis A. 654, 963 Bouropoulos K. 548 Bouvier R. 180 Bovo G. 692, 769 Boxler S. 222, 227 Bozaci A.C.B. 643, 645 Bozzini G. 368, 540, 566, 567, 798 Bracarda S. 106 Brady J. V71 Braeckman J. 353 Braga A. 726 Brahmbhatt J. 841, V51, V52, V76 Braissant O. 618 Brakbi Y. 458 Branco A.W. V58 Branco F. 380 Brandtner A. 225 Brassetti A. 412 Brasso K. 273, 858 Braticevici B. 966 Bratti E. 319 Bratus D. 680 Braun A. 99, 108 Braun C. 844 Braun K. 856 Brausi M. 708 Brechenmacher T. 981 Brecheteau F. 283 Breda A. 137, 281, 372, 498, 660, 848, V49 Brenneis C. 671 Numbers refer to abstract numbers 432 Programme Book

433 Brewster S.F. 298, 1077 Briganti A. 182, 183, 184, 185, 187, 188, 467, 468, 471, 473, 474, 686, 687, 688, 694, 695, 697, 806, 911, 990 Bright E. 737 Brime Menendez R. 334 Brindle K. 833 Brisuda A. 276, 815 Broers E.M.P. 493 Brombin C. 473 Bronner C. 192 Brookman-May S. 286, 340 Brough R. V57 Brouzyine M. 112 Brown C. 879 Brown R. 161 Brown S.C. V66 Bruce J.Y. 100 Bruckner T. 344 Brunner J. 822 Bruno G. 579 Bruno R. 729 Brunocilla E. 271, 454, 711 Brureau L. 87 Bruyère F. 170, 171, 176, 261, 743 Bryan R. 51, 81, 239 Brössner C Bründl J. 225, 944 Bschleipfer T. 62, 897 Bubendorf L. 945 Bucci S. 614, 838 Buchholz N. 654, 963, 1067 Buchner A. 923 Buchner H. 286 Budak S. 111, 794 Budde K. 981 Budia A. 543 Budiharto T. 360 Budäus L. 226, 359, 1006, 1023 Buffardi A. 376, 431, 1066, 1071 Buffi N.M. 137, 186, 254, 848, 855 Bühring H. 899 Bui H. 676 Bujons A. 531, 532 Bul M. 5 Bullock A.J. 109, 110, 873 Bultitude M.F Buono R. 69, 328, 451, 651, 831, 832 Burgard B. 74 Burger M. 282, 286, 577 Burgess N.A. 658 Burgio G. 363 Burgos Revilla F.J 346, 379, 498, 501, 760 Burgu B. 527, 646, 647 Burgués J.B. 577 Burkhard F.C. 555, 1026 Burnett A.L. 327 Bus M.T.J. 594 Busetto G.M. 55, 591 Butea-Bocu M.C. 295 Buttyan R. 50 Buvat J. 123 Byun S.S. 519, 1003 Byun Y.J. 512 C Cabello R. V75 Cabral J. 380 Cabrejos Perotti K. 422 Cabrera P.M. 1030, V5, V7, V8, V9 Caceres F. 1034, V5, V7, V8, V9 Cadeddu J. 552 Cadieux P 162, 505 Caffaratti J. 531, 532 Cahill D. 298 Cai T. 166, 459, 508, 509, 619, 697 Caisey S. 449 Cäkir O.O. 126, 407 Calabresi P. 302 Calatrava Ledrado L. 334 Calsson S. 858 Camacho J. A. 639 Cammann H. 859 Campain N. 516 Camparo P. 287 Campeau L. 443, 447 Campeggi A. 716 Campion L. 472 Campistol J.M. 491, 496 Campos R.S.M. 399 Campos Pinheiro L. 628 Canals D. 146 Cancrini F. 412 Canes D. V44 Cansino R. 760 Canu T. 832 Capitanio U. 173, 289, 467, 473, 575, 601, 686, 695, 714, 953 Capizzi E. 711 Capogrosso P. 953 Capol J.C. 635 Capon G. 96 Cappa M. 517 Cappallo-Obermann H. 27 Caraglia M. 828 Carap A. 34 Carbone A. 517, 914 Carbone L. V53 Carchedi M.T. 431, 864, 1066, 1071 Cardeñosa O. 206 Cardone G. 583 Cardoso L.E.M. 413 Cardozo L. 740 Caremel R. 244, 785 Carenzi C. 173, 953 Carillo V. 184 Carini M. 93, 172, 259, 264, 411, 693, 817, 887, 1014 Carlsson M. 740 Carlsson S. 4, 808, 850 Carlsson S. 912, 916 Carmel M. 891 Carmignani G. 770, 817, 1014 Carmignani L. 368, 540, 566, 567, 798, 996 Carmona O. V6, V19, V38, V44 Carpentier X Carrasco A. 924 Carrato A. 229 Carrieri G. 864 Carrión Puig A. 383, 993 Carroll T. 935 Carter A.C. 367 Carter S. 990 Cartwright R. 672, 910 Carvalho F. 719 Carvalho-Barros S. 673 Casabe A.R Casanova Ramón-Borja J. 10, 1007 Casanova-Salas I. 10 Casellato S. 368, 540, 566, 567 Castane E.R. V71 Castañeda-Argáiz R. 383 Indices Numbers refer to abstract numbers EAU Milan

434 Abstract authors Indices Castellano D. 773 Castelli C. 852 Castelo D.J.S Castiglione F. 69, 140, 324, 326, 328, 443, 694, 714 Castillo J. 437 Castle E.P. 1031, 1032 Castro J. V19, V44 Castro R Castro Diaz D. 746, 888 Catanzaro M. 83, 388, 397, 398, 1055, 1057 Cathala N. 589, 1020 Cathcart J. 181, 190 Cathelineau X. 352, 589, 679, 883, 1020, 1040, V48, V64 Cattaneo G. 219 Cattarino S. 11 Catto J. 56, 81, 568 Cattoni E. 726 Cattoretti G. 769 Cavarretta I.T.R. 831, 832 Cayzergues L. 112 Cecchini M.G. 330, 942 Ceccini L. 229 Celhay O. 483 Celia A. 259, 459 Cellai I. 411 Celma A. 6, 682 Centi J. 458 Cerantola Y. 926 Ceresa C. 374, 377, 495 Ceresoli F. 173 Ceriotti F. 855 Ceruti C. 431, 1066, 1071 Cervero Jiménez M. 730 Cespedes M. 229 Cestari A. 137, 254, 848, 855 Cha E.K. 575, 601, 697, 813 Cha W.H Chabannes E. 426, 427, 429 Chadwick E. 351 Chae J.Y. 955, 994 Champy C. 283 Chan Y.H. 758 Chancellor M. 308 Chandra A. V62 Chang A. 16 Chang P. 882 Chang P-L. 148 Chang R. 211 Chang S-J Chang S.R. 723 Chang W.Y.H. 684 Chantada V. 232, 760 Chapman A. 434 Chapple C.R. 109, 110, 401, 403, 741, 744, 873, 910, 1087 Charles T. 731 Charman S. 218, 353, 585 Charry P. V75 Chartier-Kastler E. 304, 308, 734, 743 Chatterton J Chauhan S. 299, 1013, V10 Chautard D. 778 Chauveau P. 999 Chawla A.K. 970 Che L. 840 Chebil G. 750 Chemaly A. 547 Chen B. 27, 28, 36, 837 Chen C.H. 234 Chen D. 981 Chen F. 877 Chen H.S. 162 Chen J. 932 Chen K-K. 515, 684, 723, 735, 738, 784, 1088 Chen Q.H. 247 Chen Q. 604, 605 Chen T.J. 515, 735 Chen W. 320 Chen Z. 604 Chen Z. 901 Cheng K.K. 239 Cheng L. 249 Chernobilsky V. 587 Chernogubova E.A. 857 Chernyaev V. 90 Chessa F. 454, 711 Chester J. 81 Cheung G Cheung S. 935 Chevallier D Cheville J. 75, 924, 957 Chiang H.S. 335 Chiang H.K. 315 Chiara A. 183 Chiba K. 33, 35, 842 Chibichyan M.B. 857 Chiche L. 500 Chin J Chindemi A. 264 Chiong E. 758 Chira I.D. 17 Chiriacò G. 838 Chiu A.W. 315 Chiu Y.C. 315 Cho D.S Cho D.Y. 209, 544 Cho H.J. 445, 611 Cho J.S. 213, 786 Cho J. 280 Cho K.S Cho M.C. 332 Cho N.H Cho S.Y. 332, 860 Cho W.Y. 209, 213 Cho Y.S. 409 Chodacki A. 101 Chodez M. 564 Choe M.S. 986 Choi D. 490 Choi H.Y. 266, 280, 297, 786 Choi J.Y. 253 Choi J.W. 116 Choi S.H. 253 Choi W.S. 860 Choi Y.S. 445, 611 Choi Y.D. 177, 269, 810, 1012 Chong T.W. 200 Choo M-S Choo S.H. 266, 280, 297, 538 Choong S. 314 Choueiri T.K Choussos D. 894 Chow K. 316 Chowriappa A. 19, 20 Christ T. 902, 905 Christensen I.J. 273 Christensen J. 858 Christian S. 731 Christiansen M. 858 Christie A. 114 Christine B.S. V71 Christofides A. 42 Numbers refer to abstract numbers 434 Programme Book

435 Christopher N. 129 Chromecki T. 340, 347 Chryssolouris G. 25 Chua M. 437, 1043 Chuck N. 874 Chughtai B. 638, 724, 1004 Chun F.K. 272, 473, 474, 686, 752, 802, 813, 929, 990, 1015 Chun J. 688, 911 Chung A.S. 634 Chung B.H. 269, 810 Chung H.J. 515, 735, 738, 1088 Chung H.C. 997 Chung J.M. 691 Chung J.Y. 727 Chung J.S Chung M.K. 632, 691, 759 Chung S.K. 253, 428 Chung W.S. 512 Chunwoo L. 649 Cid J. 491 Cindolo L. 91, 408, 412, 592, 1093, 1094 Ciofu C. 896 Cisneros R. V19, V44 Cisneros Ledo J. 556, 1036 Citeri M. 301, 305 Citgez S 529 Ciudin A. 34, 313, 378, 436, 595, 993 Ciuffreda M. 86 Clarke A.H. 539 Claro J.F.A. 525 Clavijo R. V38 Clayman R. V44 Clayman R. 822 Cleeland C. 99 Climent M. 106 Clozel T. 156 Cocci A. V69 Coelho A. 65 Coelho R. 299, 1013, V10 Cohen J. 283 Colciago G. 146, 328 Colecchia M. 388, 397, 398, 1057 Coleman R. 99 Colette S. 708 Colin P. 237, 575, 576, 601 Collado Serra A. 10, 1007 Collins E. 634 Collins J Colls P. 283 Coloby P. 136 Colombel M. 180, 705 Colombo F. V56 Colombo R. 363, 687, 697, 748, 918 Comeglio P. 411 Comet D. 681 Comperat E. 237, 283, 393, 483 Compion G. 782 Comploj E. 61, 78, 573, 575, 601, 701, 752, 754, 815, 929 Compérat E. 287 Conca M.A. 543 Conde Giles A. V33 Conde-Sanchez J.M. 804, 917 Conejero Sugrañes J. 888 Congregado-Ruiz B. 804, 917 Connolly S.S. 952 Constantin V. 34 Conteduca G. 770 Corbell C. 308 Corbishley C. 389 Corcoran N.M 53, 145, 704, 849 Corcos J. 244, 785, 891 Córdoba Martínez L.A. 346 Cordonnier T. 50 Corman J. 103 Cormier L. 283 Corn P.G. 100 Cornel E.B. 700 Cornu J-N.L. 726, 896, 1004 Cornud F. 141 Corona G. 411 Corral J.M. 34 Correia de Almeida Pinto R.M. 669 Correia-Pinto J. 968 Corti S. 687 Cosciani Cunico S. 172, 499, 592, 887 Cosentino M. 532, 760 Cosentino M. 368 Coss C.C. 102 Costa L. 895 Costa P. 112 Costa W.S. 29, 30, 413, 903 Costa W.H. 399, 557 Costantini E. 729 Costantini M. V23, V46 Costantino L.C. 412 Costello A.J 53, 145, 704, 849 Cotterill N. 737 Couapel J-P. 176 Counsell N. 58 Cózar J.M. 232, 362, 498 Cozzarini C. 182, 183, 184, 185, 187, 687, 694, 806 Cozzupoli P. V53 Crabb S. 58, 811 Craven L. 558 Crawford E.D. 678 Creagh T.C. 15 Crepel M. 170, 171 Crespi A. 692 Crespo L Crestani A Crevels A.J. 870 Cristinelli L. 499 Cristofani L.M. 650 Crivellaro S. 259, 864, 880 Crivelli J.J 156, 701, 752, 929 Cromwell D. 658 Crook T.J. 740 Crouzet S. 180, V77 Cruz C.D. 65, 673 Cruz F. 65, 210, 627, 669, 673, 898 Cruz-Nuricumbo E. 973 Cuadros T. 768 Cuervo Calvo J. V42 Cui Y.C 839 Culty T. 778 Cunha I.W. 399 Curto T. 211 Cussenot O. 366, 576, 896 D Da Pozza L.F. 173, 1096 Daamen W.F. 870, 872 Dababneh H. 271 Daher Abdi Z. 458 Dahlem R. 425, 866, 929, 1002 Dal Moro F Dalal N Dalbagni G. 697, 749 Dalmasso E. 376, 431, 1066, 1071 Dalpiaz O. 575 Dalton J.T. 102 Indices Numbers refer to abstract numbers EAU Milan

436 Abstract authors Indices Dalton S.O. 858 Damaj B. 123 Damiano R. 289, 687, 918 Damião R. 99 Dammert F. 195 Damms-Machado A. 861 D'Ancona F.C.H. 493 Daneshmand S. 815, 822 Daneshvar K. 344 Dansranjavin T. 27, 31, 947 Danuser H. 554 Danısoglu M. 652 Darweesh I. 91, 552 Dasgupta P. 14, 477, 709, 835, 1031, 1032, 1033, V14 Daum L. 243, 248, 791 Davceva O. 203 David S. 679 Davidov M Davidson S.R.H. 588 Davis M.J 135 Dawood T. 416 Day J.R De Andrade R. V6, V19, V38, V44 De Angelis P. 174 De Arriba Alonso M. V60 De Berardinis E. 55, 591 De Blok W. 291 De Bono J.S. 97, 105 De Braud F. 83 De Bruin D.M. 594 De Castro J. 485 De Castro Abreu A.L. 220, 265, 361, V45, V79 De Cobelli O. 340 De Concilio B. 838 De Fourmestraux A. V15 De Gorski A. 721 De Gracia A. 281 De Koekkoek P. 217 De Kort L.M.O. 648 De Korte C.L. 995 De La Motte Rouge T. 104 De La Peña E. 482, 757 De La Peña Barthel J.J 556, 1036 De La Rosa C. 103 De La Rosa F. 232, 362, 773 De La Rosette J. 521, 594 De La Taille A. 137, 261, 677, 716, 753, 848, 851, V15 De La Torre P. 137, 848 De Lacy Costello B. 506 De Lange F. 582 De Marzo A.M 943 De Meerleer G. 191 De Meuron L. 330 De Midina S.G.D. 432 De Nola R. 662 De Nunzio C. 340, 408, 411, 412, 672, 725, 798, 990, 1004, 1014, 1094 De Placido S. 396 De Reijke T.M. 594, 700 De Ridder D. 252, 441, 513, 999 De Ruiter M.C. 889 De Souza D.B. 29, 30, 903 De Souza P. 97 De Stefani S. 817 De Tayrac R. 112 De Torres I. 768 De Velasco G. 773 De Velasco M De Wall H. 212 De Win G. 14 De Winter P. 51 De Zaragoza I. 362 Deantoni C. 184, 185 Dearnaley D. 108 Debiais-Delpech C Decaestecker K. 191 Dechet C. 61 Deckmann K. 62 Deger S. 89, 461 Deiana G. 173 Deja A. 365 Dekhnich A. 169 Del Boca C Del Cañizo-Lopez J.F. 606 Del Duca M. 579 Del Gaudio C. 147, 933 Del Maschio A. 832 Del Nero A. 596 Del Vescovo R. 580 Del Zingaro M. 729 Delage F. 283 Delbro D. 664 D'Elia C. 166, 459, 509, 619 Della Mora L. 454 Dell'Oglio P. 289, 687, 918 Delmas V. 930 Delor M. 596 Delorenzi M. 942 Delpero J.R Deminière C. 763 Demir R. 117, 381 Demirdag C. 479 Dempster N.J. 374, 377, 495 Denes F.T. 650 Denstedt J.D. 162, 505, 1067 Dente D. 259 Denys P. 304 Denzinger S. 282, 286 Deprest J. 252 Deriglazova P. 893 Deroose C.M 360 Derosa G. 828 Desai J. V40 Desai M. 220, V6, V45, V79 Desar I.M.E. 336 Descamps P. 679 Descazeaud A. 283, 458 Descotes J.L. 563, 564 Deshpande A Dessyn J.F. 427 Destefanis P. 95, 431, 864, 1066, 1071 Deuker J. 31 Devon S-L. 256 Devoogdt N Dharmaraja A. V45 Di Antonio M. 823 Di Cristofano C. 93 Di Domenico A. 174 Di Filippo M. 302 Di Girolamo V. 467, 695 Di Lorenzo G. 396 Di Mauro U. V67 Di Muzio N.G. 182, 183, 184, 185, 187, 687, 694, 806 Di Napoli M.A. 525 Di Santo V. 259 Di Serio C. 185, 473 Di Stasi S.M. 697, 698 Di Stefano C. 579 Di Stefano V. 769 Di Trapani D. 918 Numbers refer to abstract numbers 436 Programme Book

437 Di Trapani E. 173, 695, 714, 953 Diaa M. 528 Diaconescu D. 966 Diaconu M.G. 34, 313, 436, 595, 993 Dias E. 968 Dias J. 895 Dias V.M.N Díaz F.J. 482, 757 Diaz M. 876 Diaz R.R Díaz González R. 773, 1073 Diazzi D. 271 Dick C.P.C. 902, 905, 989 Dickinson I.K. 49, 1075, 1076, 1081 Dickinson C.L. 584, 585 Dickman K.G. 234 Diekmann F. 491, 496 Dietel A. V17 Dietsche T. 945 Díez Nicolás V. 379, 501 Diez Sicilia L. 773 Digesu A. 672, 725 Digiorgio L. 882 Dignat-George F. 245 Dillenburg W. 696 Dillon B.E. 114 Din R. 19 Ding Q. 9 Dinis P. 627, 669, 1079 Ditonno P. 662 Dixon C. 631 Djajadiningrat R.S. 387, 389, 390, 392, 394 Djatisoesanto W. 908 Djinovic R. V56 Dmochowski R. 402 Do M. V17 Doble A. 142 Dobrowolska-Glazar B. 597 Dobrowolski Z. 597 Dockree S Doehn C. 461 Doerfler A. 283, 500 Dogan C. 89, 529 Dogan H.S. 642, 643, 645 Doglioni C. 467, 473 Dogliotti L. 108 Doizi S. 430 Dombrovsky V.I. 787 Dominguez Esteban M. 773 Domínguez-Escrig J. 10, 1007 Don-Doncow N. 826 Donahue T.F. 749 Donat S.M. 749 Donel E. 189 Donnaint A. 283 Donon L. 96, 763 Donovan J. 81, 135 Donskov F Doo S.W. 325 Dorado M Dorkin T. 781 Dormeus S. 415 Dornbusch J. 984 Dorrepaal C. 739 Douat P.H. V58 Douglas J. 58, 811, 1051 Doumerc N. 261 Drăgoescu O.D. 577 Drake M.J. 161, 506, 737, 1004, 1089 Drake T. 811 Drewa T.D. 869 Dridi M. 520 Drogendijk T Droller M. 577 Droupy S. 112, 261, 681 Duarte M. 628 Duarte R. 650 Dubey S. 56 Dubrowinskaja N. 198 Duchin K. 402 Duclos-Morlaes B. 681 Dudziec E. 56 Dufour R. 218 Duivenvoorden W. 939 Dukic I. 44 Dulak J. 597 Dumas J.P 458 Dumitrache D.M. 17 Dumont Martinez R. 10, 1007 Duong K. V62 Durand M. 352, 1059 Durand X. 283 Dusik S. 709, V14 Dwarkasing R.S. 217 Dyrskjot L. 238 E Eardley I. 502, 617 Eastham J.A. 715 Eberli D. 246, 799, 868, 874 Ebra G. 299, 689, 1013 Edamatsu H. 33 Edelstein M. 169 Eden C. 351 Edwards J. 902, 905, 989 Effenberger K. 802 Efstathiou J.A. 822 Egawa S. 98 Egerdie B. 108 Egevad L. 287 Eggener S. 138 Eggers H. 348 Eggesbø H.B. 221 Eggink A.J. 870 Egrot C. 366 Ehlert M. 119 Ehrbar M. 868 Ehrenstein V. 675 Eichelberg E Eimer C. 251 Eisa M. 640 Eisenberg M.S. 957 Ekrutt J. 867 El Fayoumy H. 511 El Hajj A.E. V15 El Yazami Adli O. 244, 785, 891 El-Bendary M.A. 214 El-Bilsha M.A. 934 El-Gamasy A. 214 El-Ghoneimy M.N. 536 El-Halwagy S. 928, 1028 El-Hefnawy A.S. 934 Eladl M. 836 Elaidi R. 104 Elbendary L. 416 Elder J.S. 526, 534 Eldred-Evans D. 16 Elemento O. 156 Elhage O. 835 Eliwa A.M. 416 Elkassaby A. 793 Elleberg Petersen S. 683 Ellinger J 286 Elmissery M. 537 Elnahas A.R Indices Numbers refer to abstract numbers EAU Milan

438 Abstract authors Indices Elsaesser J. 703 Elsalmy S. 537 Elsayed D. 836 Elsayed E.R. 416 Elsherif E. 792 Eltahawy E.A. 793 Eltze E. 465 Emberton M. 138, 181, 218, 267, 353, 584, 585, 717 Eminaga O. 465 Enatsu N. 33, 35, 842 Encabo G. 682 Endo M. 252 Engel O. 866 Engeler D.S. 310 Engelmann U.H. 624, 890 Engilbertsson H. 750, 1029 Ennas M. 817 Enokida H. 52, 772 Eory L. 766 Epstein J. 287 Erbersdobler A. 195, 393 Erdil T. 163 Erdmann K. 984 Erdogan M.S. 89 Erickson A.M. 274 Erkan A. 615 Erozenci A. 529 Ervandian M. 683 Escaf S. 277 Escobar Z. 826 Escudier B. 87, 1105 Escórcio De Almeida F.A. 380 Esperto F. 412 Espiridião P. 895 Esposito A. 832 Esser M. 364 Essig M. 458 Esteban M. 746 Esteban Fuertes M. 888 Esuvaranathan K. 758 Eto M. 941, 982 Evangelista L. 357 Evans A. 988 Evans J.D. 453 Even A. 304 Eylert M.F. 230 Eyraud R. 256, 257, 816, V2, V22, V27 F Faber D.J. 594 Fabregat Prous J. V63 Fagan A. 355 Faggioni L Fahlenkamp D. 461 Fahmy B.M. 641 Faison T. 474, 929 Faivre D'Arcier B. 483 Fajkovic H. 474, 576, 752 Falke J. 153, 700 Fall M. 664 Fallowfield L. 99 Fan Y-H. 784 Fanizza C.F. 408, 1093, 1094 Fankhauser C.D. 635, 637 Fantechi R. 264 Farag F. 995 Fardoun T. 87, 852, 1105 Farè E. 83, 388, 397, 398, 1055, 1057 Faried A. 293 Farin E Farina E. 714 Fariña L. 40, 760 Farmakis A. 548 Fasoli L. 855 Fasolis G. 864 Fassi-Fehri H. 999 Fatton B. 743 Favaretto R.L. 557 Favro M Fayyazi A. 143, 373 Featherstone J. 3 Feber A. 51, 58 Feciche B. 340 Feitz W.F.J. 870, 872, 995 Feldmann H.J. 192 Felix-Patrício B. 29 Feng T. 36, 837 Fenn N. 3 Fenoglio D. 770 Feola A. 252 Fera C. 448 Ferakis N. 548 Fernandes K. 988 Fernandes L. 628 Fernandez E. 379 Fernandez J. 229 Fernandez M. 40 Fernandez Barranco L. 113 Fernandez-Gomez J.M. 277 Fernandez-Pello Montes S. V42 Fernando A. 593 Fernando R. 725 Fernando Y. 123 Fernández G. V19, V38, V44 Fernández J.M. 702 Fernández Fernández A. 501 Fernández Ibieta M. 422 Fernández Lucas C. 730 Fernández-Serra A. 10 Ferrandino M. 967 Ferrarese P. 319 Ferrari N. 439 Ferraz L. 895 Ferrera F. 770 Ferretti L. 96 Ferriero M.C. 480, 881, 1038, V23, V46 Ferrière J-M. 96, 763 Ferzauli A.H. 845 Fes Ascanio E.A. 113 Feyaerts A. 415 Fhima M. 679 Fiala R. 680 Fiard G. 563, 564 Ficarra V. 78, 172, 186, 254, 258, 264, 290, 340, 887, 913 Fielding J. 777 Figueiredo A.J.C. 13, 375, 1079, 1082 Figurin K. 90 Filaci G. 770 Filipski K. 62 Finch W.G. 658 Fine S.W. 715 Finelli A. 270, 588, 886, 988 Finocchio N. 714, 918 Finol M.G. V36 Fiorentino M. 271, 711 Fiori C. 172, 204, 219, 264, 459, 630, 710, 875, 887, V11 Fiorino C. 183, 184 Fiorito C. 130 Fisch M. 425, 752, 802, 866, 1002 Fischer J.W. 155 Fischer K Numbers refer to abstract numbers 438 Programme Book

439 Fiter Gómez L. 730 Fitzsimmons W. 739 Fizazi K. 97, 104, 108 Flaig T.W. 105 Flam T. 141 Flamand V. V28 Flechon A. 104 Fleischmann A Fleshner N.E. 270, 588, 988 Flugel R. 402 Fode M. 122 Foditsch E.E. 884 Fontana D. 95, 376, 431, 864, 1066, 1071 Fontas E Fonteyne V. 191 Fop F. 431, 1066 Forastiere E. 881, V23, V46 Forde J.C. 15 Fornara P. 91, 263, 382, 461, 949, 1046, V1, V50 Foroudi F.F 85 Fossa S. 106 Fossati N. 140, 467, 651, 695 Fossion L.M.C.L Fowler L. 137, 848 Fowler S. 298 Fradet Y. 97, 276, 577 Fraga A. 380 Franceschelli A. V56 Franco A. 313, 436, 595, 746, 993 Franco E. V41, V63 Franco M. 622 Frank D. 123 Frank I. 75, 924 Franken J. 441 Frånlund M. 4 Franzem M Frea B. 95, 259, 376, 431, 864, 880, 1066, 1071 Freeman A. 51, 58, 218, 267, 584, 585, 717 Freitas A.R. 895 Freixa R. 208 Freschi M. 137, 187, 331, 467, 473, 694 Fresno F. 277 Freudenberger T. 155 Frey F.J. 555 Friedersdorff F. 859 Friedman A.A. 534 Friedrich-Freksa M Friis S. 858 Fritsche H-M. 225, 282, 286, 573, 575, 576, 601, 815, 822, 1067 Froghi S. 14 Fröhlich O. 897 Frohme C. 728 Fröhner M Fromont G. 483, 1040 Frumenzio E. 258, 290, 913 Fry C.H. 314 Frydenberg M. 946 Fryer L. 823 Fu D.J. 840 Fuellhase C. 443 Fuessel S. 984 Fujii T. 199 Fujii Y. 311 Fujii Y. 76, 240, 470, 572, 578, 586, 756, 819, 950, 979, V21, V61 Fujimoto H. 98 Fujimoto K. 456 Fujimoto N. 676 Fujimura T. 333 Fujioka T. 77 Fujisawa M. 33, 35, 487, 663, 842, 862, 940, 983, 1047 Fujishima N Fujita M. 199 Fujita T. 613 Fujiwara T. 492 Fujiyama N Fukuhara H. 834 Fukuhara H. 333 Fukui I. 572 Fukumoto K. 199 Fukushima H. 819 Füllhase C. 67, 68, 447, 847, 906, 909 Fumey J. 500 Funahashi Y. 779 Funyu T. 613 Furriel A. 30, 413, 903 Furriel F. 13, 375, 1079, 1082 Furukawa J. 862 Furusawa M. 603 Furuya Y. 938 Fusco F. 172, 396, 560 Futterer J.F 138, 582 Fuzzi G. 855 G Gaboardi F. 817 Gacci M. 259, 411, 412, 693, 817, 1014 Gadda G.M. 583 Gaetani L. 302 Gaffney E. 355 Gaire R.K. 849 Gaisa N. 871 Gajda M. 56, 194, 774 Gakis G. 364, 812, 822, 861, 1022, 1049, 1054, V59 Galante Romo I. 334 Galasso A. 861 Galeano Álvarez C. 379, 501 Galiano M. 352, 589, 679, 883, 1020, V48, V64 Gallagher F.A. 142, 224 Galland S. 822 Gallego Matey A. 805 Galli E 439 Gallina A. 140, 183, 187, 289, 467, 473, 695, 714, 918, 953 Gallo C.B.M. 413 Gallo Rolania F.J. V60 Gallucci M. 480, 881, 1038, V23, V46 Galustian C. 835 Gamal O.Z. 420 Gamal W. 528 Gameel T.A. 214 Gan C Gan M. 258, 290, 913 Gandaglia G. 69, 289, 694, 714 Gandee L. 168 Ganzer R. 225, 944, V17 Garaffa G. 129 Garat J.M. 531, 532 García C. 498 García G. 543 Garcia L. 639 Garcia S. 245 Garcia Barreras S. 730 García-Cruz E. 125, 206, 383 García Diez F. V60 Indices Numbers refer to abstract numbers EAU Milan

440 Abstract authors Indices Garcia Garcia N. 730 García González L. 125 García Gómez B. 125, 773 Garcia Montes F. 113 Garcia-Baquero Garcia De Paredes R. V33 Garcia-Cruz E. 208, 489, 595, 993 Garcia-Larrosa A. 595, 993 Garcia-Mediero J.M. V5 García-Olaverri Rodríguez J. 498 Garcia-Rojo D. 229 Garcia-Sanchez C. 804, 917 Garcia-Segui A. 524 García-Tello A. 1030, 1034, V7, V8, V9 Garcia-Vargas J. 101 Gardella B. 894 Gardikis S. 423 Garofalo M. 454, 711 Garrou D. 219, V11 Garza R. V19, V38, V44 Gascoyne-Binzi D. 502, 617 Gasser T. 167, 618 Gattenloehner S. 712, 947 Gausa L. 281, 372, V49 Gaya J.M. 281, 284, 352, 362, 372, 485, 883 Gazquez C. 236 Gazzaniga P. 55 Geavlete B.F. 522, 570, V37 Geavlete P.A. 522, 542, 570, V37 Gebauer K. 198 Gebhardt T. V31 Gederaas O.A. 152 Geiges G. 371 Gelabert A. 229 Gelet A. 180 Gentile B.C. 486 Gentile G. V56 Gentile V. 11, 11, 55, 591 Gentilucci A. 11 Georgas E. 251 George A. 552 George D.J. 100 Georgescu D.A. 570 Georgiopoulos I. 25, V4 Geraerts I Germann C. 554 Gerritsen W. 106 Gertner M.R. 588 Gerullis H.G. 251 Getzenberg R.H. 102, 1048 Geutjes P.J. 870, 872 Gevaert T. 441, 513 Gevher F. 479, 529 Gey S. 930 Gezer M. 479 Ghani K.R. 20, 119, 158, 260, 369, 497, 526, 534, 625, 657, 659, 885, 915, 1070, V14, V25 Ghavamian R Ghei M. 736 Ghoneim M Ghoneim T. V28 Ghorbel J. 520 Ghosh N. 541 Ghozzi S. 520 Giancane S. 172 Giannakopoulos S. 423 Giannantoni A. 147, 300, 302, 303, 670 Giannatempo P. 83, 388, 397, 398, 1055, 1057 Giannella R. 592 Gianni A. 83, 1055, 1057 Giatromanolaki A. 423 Giedelman C. 299, 352, 1013, V6, V10 Gierth M.S. 225, 282, 286 Giese A 68 Gigliobianco G. 110 Gil Diez De Medina S. 430 Gilfrich C. 461 Gill I.S. 138, 220, 265, 361, 835, V6, V45, V79 Gilloteau I. 476 Gimbernat H. V9 Gimel P. 170, 171, 176 Giovannone R. 591 Giraudo L. 245 Giron A.M. 650 Giulianelli R. 486, 580 Giuliano F. 304, 449, 900 Giusiano S. 245 Giusti G. 459 Gjertsson I. 664 Gjorgjievska K. 203 Glass J. 658 Globe D. 308 Gnanapragasam V.J. 142, 224 Goad J.R. 539 Goddard J. 42 Godet J Goebell P.J. 1102, 1106 Goh A. V79 Goi Y. 446 Golbeck S. 347 Goldman H. V3 Goldstein I. 123 Golz R. 192 Gomelsky A. 732 Gomes G.H.A Gomez A. 993 Gomez V. 379 Gómez Del Cañizo C. 501 Gómez-De-Regil L. 973 Gómez Dos Santos V. 501 Gómez Gómez G. 385 Gómez-Ferrer A. 10, 1007 Gómez Rivas J. 556, 1036 Gomez Sancha F. 634 Gómez-Veiga F. 99, 498 Gomha M.A. 668 Gomis A. 379 Gomis Couto A. 501 Goncharova R.I. 278 Gonella A. 95, 864 Gontero P. 130, 468, 471, 686, 688, 697, 708, 752, 815, 911, 929 Gonzalez C. 277 Gonzalez N Gonzalez R.R. 638 Gonzalez Huergo J.F. 229 Gonzalez Rodriguez I. V42 Gonzalez-Torres S. 312 González C. V75 Good D.W. 922 Goodfellow A.I. 477 Goodman, Jr. O.B. 105 Goonewardene S. 296 Gopalan V. 672 Gorbunova I Gordon E.M. 846 Gordon S.A 846 Goren A. 476 Gorgal Rodrigues De Carvalho T. 627 Numbers refer to abstract numbers 440 Programme Book

441 Górnicka B. 279 Gorny D. 900 Gosalbez Garcia D. 34, 378, 595, 993 Gossmann M. 250 Gotoh M. 288, 404, 747, 779 Gotoh S. 819 Gotohda N. 92 Götze L Gouveia Oliveira A. 628 Govorov A. 186, 350 Goyal A. 654, 963 Gözen A.S. 23 Gozzi C Graafland N.M. 387, 392 Gradilone A. 55 Graefen M. 137, 139, 293, 294, 359, 474, 685, 802, 848, 920, 1015, 1018, 1023 Graeser R. 824 Graham J. V57 Graham J. 523 Graham T.R. 453 Granata D. 486 Grande S. 219, 710, V11 Grange P. 16, 879 Granger B. 734 Grasso A.A.C. 692 Grasso M. 692 Grasso M Gratzke C. 68, 443, 447, 629, 847, 906, 907 Gravis G. 104, 1053 Graw M. 844 Gray R. V78 Greco F. 91, 263, 382, 461, 949, V1, V50 Green D.A. 276 Green W. 516 Greene P. 598 Greenwell T.J. 775, 776 Gregori A. 817 Gregorini F. 70 Gregório B.M. 29, 30, 413, 903 Grenabo A.L.A. 2 Grenabo L. 740 Grenier N. 87, 1105 Gres P. 283 Griffin T. 97 Grimm M-O. 56, 194, 774 Grimm T. 923 Grinyov A. 169 Grise P. 743 Gritti A. 259 Grobholz R. 133 Grollman A.P. 234 Groskopf J.C Gross A.J. 636 Gross O. 637 Gross-Weege M Grosse J. 250, 448, 871 Grossman H.B. 577 Grossmann N. 635, 637 Grotenhuis A. 697 Grubb R. 138 Gruellich C. 341 Gruenwald I. 131 Gschwend J.E. 189, 386, 565, 809, 1011 Gsponer J.R. 945 Gu X. 901 Guaglianone S. 480, 881, 1038, V23, V46 Guate J.L. 229 Guazzoni G. 137, 139, 186, 254, 289, 467, 473, 583, 695, 848, 855, 918 Gubbiotti M. 300, 302, 303, 670 Gudeloglu A. 841, V51, V52, V76 Gudima I.A. 845 Gudjónsson S. 750, 1029 Guerrer C. 301, 305 Guichard G. 426, 427, 429 Guillot A. 104 Guimaraes G.C. 399, 557 Guimerá M. 34 Guirao Piñera M.J. 422 Gulamhusein A. 777 Guleryuz K. 500 Gülpınar Ö. 646, 647 Gündogdu C. 417 Gunnemann A. 897 Guohua Z. 320 Gupta A. 752 Gupta N.S. 709, V14 Guru K. 14, 19, 20, 1031, 1032 Gurung P.M.S. 51, 58 Gust K.M. 50 Gutierrez C. 746 Gutierrez P. 498 Gutin A. 719 Gutiérrez Gutiérrez P.F. 385 Guttilla A. 357, 1017 Gutue C.S. 17 H Ha H.K. 551, 691, V47 Ha J.Y. 986 Ha S.B. 860 Ha U.S. 445 Haab E Haab F. 726, 743, 896, 999, 1004 Haag-Molkenteller C. 741, 744 Haber G-P. 255, 256, 257, 816, V2, V22, V27 Haberkorn U. 227 Habuchi T. 197, 610, 720, 1100, 1104 Häcker A. 321, 322, 1052 Hadaschik B. 138, 222, 227 Hadfield J. 935 Haefner T. V17 Haendler L. 912, 916 Haese A. 137, 139, 186, 294, 848, 919, 1018 Haferkamp A. 286, 825, 830 Haga K. 121 Hager M. 884 Hai M.A. 638 Haider A. 207 Haider M.A. 588 Haillot O. 999 Haineala B.C. 384 Hainsworth J.D. 97 Hakenberg O.W. 195, 393, 1067 Hakim L. V71 Hakim L. 252, 326, 468 Hakimi Z Hakozaki A. 442 Halac M. 479 Halbert G.L. 902, 905, 989 Hall E. 81 Hall J. 623 Hallas N. 775 Hallscheidt P. 341, 344 Ham W.S. 177, 1012 Hamacher J. 890 Indices Numbers refer to abstract numbers EAU Milan

442 Abstract authors Indices Hamamoto S. 311 Hamberg H. 287 Hamdy F.C. 135 Hamid R. 775, 776 Hammad F. 609 Hammdy A. 528 Hammerer P.G. 207 Hammers H.J. 100 Hamoen E.H.J. 12 Han D.H. 538 Han D.J. 490 Han H.H. 519 Han J-Y. 632 Han J.H. 786 Han M 719 Han Y.F. 36 Hancock M.L. 102 Hanitzsch H. 707 Hanna N. 820, 927, 956, 960 Hannan J. 326, 327 Hannon Y.A. 146 Hansen J. 686, 920, 1015 Hansen S. 683 Hanson D. 631 Hanzawa T. 121 Hara I. 767, 821 Harada K. 985 Haraz A. 928 Harding C. 781 Harewood L.M. 849 Hariu K. 228 Harke N. V18 Harraz A.M. 1028, 1069 Harrison D.J. 766 Hart A.R. 762 Harza M. 384 Hasan T. 781 Hascicek M. 642 Hasegawa M. 959 Hasegawa S. 818 Hasegawa T. 337 Hashimoto Y. 79, 82, 197, 463, 602, 613, 720 Hashimoto Y Hashitani H. 66 Hasigov A.V. 419 Hasner F. 707 Hassan H. 37, 843 Hassett J. 20 Hassouna M. 307 Hasunuma N Hatakeyama S. 79, 82, 197, 463, 602, 613, 720, 1042, 1104 Hatton A. 846 Hatzichristodoulou G. 565, 809 Hatzichristou D. 733 Hatzinger M. 46 Haubold K Haunschild J. 671 Hauser J. 356 Haustermans K. 182, 360, 806 Hautmann R. 151 Havrenak E. 600 Hawaux E. 800 Hawkins R.E Hayakawa N. 242 Hayashi K. 578 Hayashi M. 450 Hayashi N Hayashi T Hayashi T. 50 Hayashi Y. 442 Hayes M. 811, 1051 Haymann J-P. 438 Hayn M.H. 1031, 1032 Healy S. 434 Heck M. 809 Hedi R. 520 Hedlund P. 67, 68, 69, 146, 324, 326, 327, 328, 329, 331, 443, 447, 651, 831, 832 Heesakkers J.P. 63, 995 Hefermehl L.J. 246, 635, 637 Hegarty P Hegele A. 728, 1099 Heidegger I. 7, 644, 803, 829 Heidenreich A. 106, 452, 674, 801 Heijmink S.W.T.P. 217 Heimann D. 358 Heinrich D. 101 Heinrich E. 24, 1019 Heinz-Peer G. 345 Heinzelbecker J Heinzelmann J. 774 Heinzer H. 107, 359, 685, 920, 1006, 1018, 1023 Helfand T. 126, 407 Hellawell G. 268 Helle S.I. 101 Hellsten R. 826 Helou E. V26, V29, V32, V65, V73 Hemal A.K. 1031, 1032 Henderson R Hendricken C. 725 Hendriks J.C.M. 755 Heng D.Y.C Henneges C Hennenberg M. 906, 907, 909 Hennenlotter J. 198, 364, 365, 899, 1022, 1049, 1054, V59 Hennus P.M.L. 648 Henry N. 896 Hensel J. 942 Heo N.J. 860 Herkommer K. 189, 565, 809, 1011 Herman M. 474 Hermann E. 286 Hermann G.H. 577 Hermanns T. 635, 637 Hermans T.J.N Hernandez R.K. 675 Hernandez-Fernandez C. 606, 607 Hernández C. 498 Hernández V. 482, 757 Herr H.W. 749 Herrmann T.R.W. 91, 575, 601, 636, 656, V74 Herschorn S. 739, 740, 744 Hersey K.M. 988 Hertle L. 461 Herwig R Heschel I. 250, 870, 871 Hess J. 559 Hetet J-F. 87, 283, 1105 Heus I. 912 Heusch G. 251 Hevia Palacios V. 346, 501 Heyman S. 202 Heß J. 155 Hickson I. 824 Hidaka H. 52, 772 Hieda K. 462 Hiess M Higashi Y. 572, 819 Hillyer S. 256, 257, 876, V2, V3 Hindley R.G. 585 Hinke A. 192 Numbers refer to abstract numbers 442 Programme Book

443 Hinkelammert R. 465 Hinkelbein W. 182, 192, 806 Hintz F. 559 Hirakawa K. 931 Hirao Y. 456 Hirobe M. 337 Hirohashi Y. 767 Hirose M. 311 Hirose Y. 311 Hirshman S. 448 Hisano M. 525 Hitier S. 106 Hitoshi N. 60 Hlasny E. 588 Hobbs C.P. 38, 45, 1077 Hocaoglu Y. 906 Hochreiter W. 160 Hoda R. 1009, 1046 Hodge P.N Hoehn A.K. 393 Hoenderop J.G. 63 Hoenjet E. 648 Hofer C Hoffmann U. 365 Hofmann R. 338, 728, 1099 Höfner T. 286 Høgset A. 153 Hohenfellner M. 222, 227, 286, 341, 344 Hohneder A. 365, 1049 Hoinoiu B. 884 Holder D.D. 284, 485 Hollenbeck B.K Hollywood D. 355 Holm-Larsen T. 405, 406 Holmäng S. 569, 571, 701, 751, 752, 754, 929 Holmberg E. 2 Holmberg M. 683 Homma Y. 64, 67, 333, 764, 1048 Honeck P. 964 Hong B. 80, 196, 478, 490 Hong J.H. 80, 196, 469, 478, 771, 807, 1097 Hong M.K.H 849 Hong S-H. 445, 611 Hong S.J. 177, 269, 810 Hong S.K Hong S. 410, 478 Hong Y.K. 165 Hongo F Honma I. 121 Hoogenkamp H.R. 872 Hopmans S. 939 Hora M. 575 Horenblas S. 387, 389, 390, 392, 394 Horgan P.G. 902, 905, 989 Horiguchi A. 574, 827 Horn L.C. 393 Horn T. 809 Horninger W. 7, 61, 644, 803 Horsburgh B. 590, 1016 Hortova K. 32 Hoshi A. 21 Hoshino K. 242 Hoskin P. 58 Hosseini-Aliabad A. 751, 1035 Hou Y.C. 247 Houlgatte A. 139, 283, 853 Hounsome L.S. 230 Hovens C.M. 53, 145, 704, 849 Høyer M. 683 Hoznek A. 438, 549, 716, V15 Hrbacek J. 822 Hrouda D. 600 Hruby G.W. 284, 485 Hruby S. 22, 660 Hsieh C-H Hsieh J.T. 168 Hsu C.Y. 468, 688, 911 Hu J.H. 247 Hu K. 28, 36, 837 Hu L. 605 Hu X. 859 Huang C.Y. 234 Huang C-H. 205 Huang C-N. 205 Huang E.Y-H. 738, 1088 Huang H.H. 200 Huang J. 193 Huang S-P. 205 Huang J.S. 684, 784 Huang Y.H. 515 Huang Y.R. 28, 36, 837 Huber A. 133 Huber J. 341, 344 Hubert J. 136, 170, 171, 176 Hübner A Hubner M. 926 Hübner W. 575, 601 Hueber P.A. 638 Hughes P. 477 Hughes S. 477 Hugosson J. 2, 4, 808 Huguet Pérez J. 378, 489, 494 Huh K.O Huland H. 293, 295, 802, 1018, 1023 Hulsbergen-Van De Kaa C. 287 Humanes-Sanchez B. 606, 607 Humphries E. 719 Hunju L. 649 Hupertan V. 576 Huppertz N. 448 Hurault De Ligny B. 500 Hurtz H.J Husein M. 528 Hussain M. 100 Hutterer G.C. 347 Hwang E.C. 464 Hwang I. 464 Hwang J.H. 165 Hwang J.W. 786 Hwang T-K. 445, 611 I Iacoboaie C. 522 Iacovelli N.A. 183, 185 Ibanez-Tallon I. 62 Ibishev H.S. 845 Iborra Juan I. 10, 1007 Ibrahim E. 836 Ide H. 242, 818 Idesako T. 52 Idzenga T. 995 Ifu G. 746, 888 Igawa Y. 64, 67 Iglesias Rutishauser K. 926 Ignacio C. V44 Ihrig A. 341 Iinuma T. 8 Iizuka J. 821 Ikawa K. 504 Ikeda K. 504 Ikeda K. 462 Ikezawa E. 821 Ilbey Y.O. 553 Indices Numbers refer to abstract numbers EAU Milan

444 Abstract authors Indices Ilyas R. 316 Imai A. 79, 82, 463 Imamura M. 523 Imamura M. 66 Imanishi K. 602 Imbimbo C. 396, 560, 622, V55 Imkamp F. 656, V74 Immenroth M. 16 Impedovo S. 662 Inferrera A. V1 Ingelmo-Torres M. 236, 237 Ingels A. 761, 975 Inoue K. 834 Inoue S. 462, 666 Inoue T. 610, 1100, 1104 Inoue T Intilla O. V67 Ioannides E-I. 733 Ip De Coruña I. 362 Ip De Vall D'Hebron I. 362 Iqbal M. 661, 967 Irani J. 136, 483, 697, 1040 Irjala H. 154 Irving S.O. 658 Irwin B. V6 Isbarn H. 226, 802, 866, 1006, 1023 Isebaert S. 360 Iselin C.E. 356, 721 Ishida H. 603 Ishii C. 240 Ishii K. 978 Ishii T Ishika J. 819 Ishikawa H. V68 Ishikawa N. 492 Ishimura F Ishioka J-I. 76, 240, 470, 572, 578, 586, 756 Ishioka K. 818 Ishizaki J. 931 Ismail F Isoyama T. 339, 925, 951 Itarte E. 768 Ito A. 21 Ito K. 8 Ito K. 57, 144, 574, 827, 976, 977 Ito M. 699 Ito Y. 242 Itoh K. 98 Itoh Y. 311 Itoh Y. 311 Ivanenko O. 507 Ivanovski O. 203 Iversen P. 273, 674, 858 Iwamoto H. 339, 925, 951 Iwamoto Y. 978 Iwamura M. 21 Iwasaki K. 77 Izawa J Izquierdo Reyes L. 237 Iztueta I. 6, 682 J Jacobs C.D Jacquemet B. 426 Jado J.C. 606, 607 Jaeger W. 50 Jahnson S. 481, 751, 751 Jakobsen H. 122 Jalal A. 23 Jalkanen S. 154 James N. 51, 239 Jameson C. 51, 267 Janetschek G. 22, 884 Jang H.J. 266, 280, 297, 538 Jang S.H Jang W.S. 464 Janitzky V. 461 Janssen D.A.W. 63 Janssen M. 338, 348, 703, V31 Jarvelin M-R. 910 Javed S. 351 Javor D. 345 Jecu M. 570 Jefferies E.R. 230 Jeffrey K. 468 Jenks J. 775, 776 Jenster G.W. 824 Jeon H.G. 266, 280, 297 Jeon S.S. 266, 280, 297 Jeon S.H. 612 Jeong B.C. 266, 280, 297 Jeong C.W Jeong H. 860 Jeong I.G. 478, 490, 771, 807, 1097 Jeong J.W Jeong S.J Jeong U.S. 266, 280, 297, 538 Jeong W. 260, 369, 657, 709, 885, V14, V25 Jeschke S. 22 Jeung J.S. 551 Jewett M.A.S. 588 Ji Y. S. 116, 349 Jiang B. 149, 604, 605 Jiang H.W. 9 Jiao Y. 901 Jichlinski P. 926 Jiménez Cidre M.A. 379, 746, 888 Jimenez Mateos-Cáceres P. 334 Jiménez Alcaíde E. 125, 1073 Jiménez Calvo J. 888 Jin J. 308 Jin Y. 36, 837 Jinga V. 17, 966 Jintetsu J.S. 215 Jinzaki M. 818 Jo Y. 199 Jocham D. 461, 577 Johansson M. 826 Johansson S.L. 571 Johnson M. 81 Jones A. 47, 48 Jones E. 81 Jones L.A Jones R. 81 Jones S. 400 Jones T.H. 211 Jong T.P.V.M. 648 Jong Jin O. 165 Joniau S. 182, 188, 360, 468, 471, 686, 688, 697, 806, 911, 1000 Jonsson M Joo K.J. 409 Josephson D. 1031, 1032 Joung J.Y. 410, 478, 1001, 1097 Jozkowicz A. 597 Juang H-H. 148 Junaid I. 654 Jünemann K.P. 188, 358 Jung H. 974 Jung H.C. 116, 349 Jung H.R. 986 Jung H.J. 535 Jung J.H. 997 Jung J-L. 170, 171, 176 Jung K. 859 Numbers refer to abstract numbers 444 Programme Book

445 Jung S. 612 Jung S.I. 464 Jung T.Y. 519 Jüngel E. 830 Junker K. 56, 194, 338, 774 Jutzi S. 656 K Kabbinavar F.F. 193 Kachrilas S. 654, 963 Kaczmarek B. 876, V24 Kader A.K. 1031, 1032 Kadoyama K Kaestner L. 545 Kaifu M. 199 Kaiser C. 539 Kajioka S. 450 Kajiwara M. 462, 666 Kakies C. 393 Kalaitzi M. 733 Kalaitzis C. 423 Kälble T. 192, 461 Kallidonis P. 25, 91, V4 Kalpinskiy A.S. V43 Kamata S. 572, 819 Kamel G. 547 Kamimura N. 602, 1042 Kamoi K. 215, 414 Kamota S. 931 Kampouri K. 423 Kamradt J. 74, 828, V31 Kanao K. 242, 715, 818 Kanda H. 978 Kandimalla R. 54 Kaneda T. 931 Kaneko G. 959 Kanematsu A. 66 Kanemitsu N. 215 Kang J. 901 Kang S.M. 124, 691 Kang S.H. V47 Kang T.W. 464, 997 Kanno Y. 931 Kanomata N. 199 Kanthabalan A. 717 Kanzaki S. 931 Kaouk J. 20, 91, 255, 256, 257, 552, 816, 876, V2, V3, V22, V27, V30 Kaplan S. 740 Kapoor R Kaps H. 306 Karakiewicz P. 78, 140, 178, 233, 276, 474, 573, 576, 701, 752, 754, 814, 820, 929, 956, 1024 Karatas A. 381 Karim O. 475, V78 Karl A. 577, 923 Karmakar D. 541 Karnes J.R. 187, 188, 471, 686, 688, 694, 697, 911 Karsenty G. 245 Karup C. 678 Kasivisvanathan V 138, 218 Kasraie J. 846 Kassouf W. 573, 576, 813 Kastner C. 142 Kasyan G.R. 115 Kata S. 434, 599 Katano H. 931 Kataoka T. 33 Kato H. 938 Kato M. 978 Kato M. 288 Kato Y. 77 Katsuhiro F. 60 Kaushal D. 633 Kaushik D. 957 Kawaguchi M. V68 Kawakami S. 76 Kawamura S. 720 Kawan F. 382, V50 Kawanishi S. 132 Kawanishi Y. 132 Kawano Y. 941, 982 Kawano Y. 228 Kawauchi A. 215, 414, 552 Kay T. 477 Kaya C. 117 Kayali M. 615 Kayanuma K. V68 Kazuhiro K. 60 Kazuhiro S. 8 Kedia G.T. 904 Keegan K.A. 822 Keil C Keller H. 790, 795, V70 Kelly J. 51, 58 Ken-Ichi M.K. 444 Kenjiro K. 60 Kent M. 754, 814, 815 Keppenne V.M. 780 Kergoat M. 449 Kern J. 829 Kesavadas T. 19, 20 Kesavan N. 758 Kessler T.M. 70, 665 Keten T. 615 Khairy Salem H. 511 Khalifeh A. 255, V2, V3, V22, V27, V30 Khalil S. 416 Khan F. 49, 1075, 1081 Khan F. 783 Khan M.S. 14, 1031, 1033 Khan S.A. 19, 1031, 1032 Khan M.S. 477 Khatami A. 808 Khaw K.T. 762 Khazaeli D Kheoh T. 97, 105 Khiari R. 520 Khouni H. 520 Khullar V. 308, 672, 725, 741, 910 Kibel A.S. 1031, 1032 Kieft J.H. 648 Kihara K. 76, 240, 470, 572, 578, 586, 756, 819, 950, 979, V21, V61 Kijima T. 578, 979 Kikkawa K. 767 Kikuchi E. 242, 813, 818, 959 Kilani T. 520 Kilicarslan H. 652 Kim A. 410, 490, 533 Kim B.S. 253, 428 Kim B.W. 253, 428 Kim B.H. 986 Kim C.H. 974 Kim C-S. 80, 196, 466, 469, 478, 771, 807, 1097 Kim C.I. 535, 986 Kim D. 533 Kim D.S. 612, 691 Kim D.Y. 519 Kim H.Y. 213 Kim H.J. 488 Kim H.T. 253, 428 Indices Numbers refer to abstract numbers EAU Milan

446 Abstract authors Indices Kim J.H. 325 Kim J.W. 955, 994 Kim J. 177 Kim J. 469, 1005, 1010 Kim J.W. 955, 994 Kim J.J. 280 Kim K.H. 974 Kim K.B Kim K.H. 349, 986 Kim K.K. 213 Kim K.S. 533 Kim K.H. 269, 771, 810, 1012 Kim K.T. 974 Kim K.H Kim M.K. 488 Kim S.W. 445, 611 Kim S.D. 691 Kim S.J. 460 Kim S.U. 325 Kim S.P. 75, 924 Kim S. 551 Kim S.W. 332 Kim S. V47 Kim S.J. 445, 611 Kim S. 435 Kim S.Y. 213 Kim S.I. 460, 519 Kim S.O. 464 Kim T.B. 974 Kim T.H. 253, 428 Kim T.S. 551, 691, V47 Kim W. 490 Kim Y.J. 997 Kimuli M.N. 549 Kimura T. 492 Kimura T. 98 Kimura Y Kin S. 199 Kinder R.B. 783 King K. 51 Kingsmore D. 374, 377, 495 Kingswood J.C. 981 Kinoshita H. 21 Kinsella J. V62 Kira S. 71 Kirby A.C. 910 Kirkham A.P. 218, 267, 391, 585, 717 Kirkwood L. 157 Kirschner-Hermanns R. 448 Kitahara S. 819 Kitamura H. 337, 603 Klatte T. 575, 601, 991 Klaver M Klein J. 356 Klein J. 23 Kleinclauss F. 283, 426, 427, 429 Klimov A.V. 954 Klingler H-C. 345, 991 Klink J. 256 Klocker H. 7, 803, 829 Kloke H.W. 493 Klorek T Klosterhalfen B. 251 Klotz D. 221 Klotz L. 138 Klotz T. 461 Kluth L.A. 78, 151, 156, 276, 473, 474, 573, 701, 724, 752, 754, 813, 814, 815, 929, 1004 Kneitz B. 936 Knipper S. 636 Knoll T. 660, 964, 1067 Knox J.J Ko M. 767 Ko W.J. 519 Ko Y.H. 116, 349 Kobayashi H. 242, 818 Kobayashi J. V68 Kobayashi K. 462, 666 Kobayashi M. 446 Kobayashi S. 240, 756 Kobayashi T. 311 Kobayashi T. 92 Kocaturk H. 417 Kockelbergh R.C. 81, 455 Kocot A. 282, 863 Kodama Y. 767, 821 Koehler C. 321 Koellermann J. 393 Koen M. 644 Koga F. 76, 240, 470, 572, 578, 586, 756, 819, 950, 979, V21, V61 Kogan M.I. 212, 419, 787, 797, 845, 857 Kogevinas M. 229 Koh L.T. 318, 343 Kohjimoto Y. 767 Köhler A. 348 Kohri K. 311 Koie T. 79, 82, 197, 463, 602, 613, 720, 1042 Koike H. 938 Koizumi S. 71 Koji O. 60 Kok E.T. 135 Kolesnyk M. 159, 892 Kollberg P. 750 Kölle S. 844, 847 Kollias S. 70 Kollmannsberger C.K Komai Y. 92 Komohara Y. 982 Komyakov B.K. 562 Kondo T. 821 Kong D. 604 Koni A. 642 König F. 371 Konstantinidis C. 6, 682 Konstantinidou E. 733 Koo B. 142 Kopp R. 552 Kopper B. 461 Korahanis N. 171 Kosaka T. 818 Köse O. 111, 794 Kotov S.V. 796 Kotov V. 94 Koumi T. 925 Kouriefs C. 879 Koutlidis N. 283 Kovylina M. 350 Kowalczyk A. 145, 849 Kowalczyk T.K. 869 Kowey P. 739 Kowlaczyk A. 53 Kozakowska M. 597 Kozlov R. 169 Krahn T Kramer G. 345 Kranzbühler B. 637 Krasny S.A. 278 Krasteva-Christ G. 62 Kraus S. 722 Krause A. 461 Krebs M. 936 Krege S. 559 Numbers refer to abstract numbers 446 Programme Book

447 Kretschmer I. 155 Kristiansen G. 287, 393 Kristmundsson T Kroeger N. 193, 1107 Kron M. 189, 1011 Kruck S. 306, 629, 656, 1062, V71 Kruglikov V. 159, 892 Ktech N. V36, V39 Ku J.Y. 691 Kübler H. 809 Kubo T. 676 Kubota Y Kucharczyk W. 588 Kuczyk M.A. 198, 241, 329, 338, 348, 656, 904, V74 Kuderinov S. 893 Kudo S. 602 Kudou S. 84 Kuehhas F.E. 345, 1067 Kueppers F. 108 Kufer R. 151 Kufner M. 549 Kühs U. 364, 1049 Kukk L. 680 Kulchavenya E. 620 Kulkarni G. 270 Kulkarni P Kumagai J. 824 Kumagai L.Y. 557 Kumano M.K. 487 Kumar R. 876, 885, V14, V24, V25 Kumar P.V.S. 47, 48 Kumar V. 418, 421, 424 Kume H. 333, 764 Kummer W. 62 Kumsar Ş. 111, 794 Künstle G. 671 Kun Suk K. 649 Kundt G. 195 Kuntz N.J. 653, 661, 967 Kunz A. V18 Kuo H-C. 742, 1090 Kuppevelt T.H. 870 Kurita Y. 998 Kuroda K. 574, 827 Kuroiwa K. 765 Kurosch M. 825 Kurtz F. 386 Kuru T.H. 222, 227 Kurz M. 70 Kusama H. 446 Kusuma M. 400 Kusumoto H. 767 Kutta N. 461 Kwiatkowski M. 133 Kwon C.H. 409 Kwon D.D. 464, 519 Kwon E. 151 Kwon G.Y. 280 Kwon J.B. 253, 428 Kwon S.Y. 253, 428 Kwon T.G. 253, 428 Kyosuke K. 713 Kypta R. 941 Kyriazis I. 25, V4 Kyung Hyun M. 649 L La Croce G. 140, 187, 328, 363, 748 La Macchia M. 183, 184 Labanaris A.P. 690, V20, V34 Lacarriere E. 283 Lacombe M. 472 Lacoste J. 472 Ladurner Rennau M. 7, 803 Lagabrielle S Laguna-Pes M.P. 13, 594 Lahdensuo K. 274 Lahme S. 143, 373, 461, 962 Lahoz Garcia C. 312 Lai M.K. 840 Laird A. 298, 766 Lam T. 370, 523 Lam W. 389, 593 Lamanna E. 579 Lamche M Lammens M.M.Y. 870 Lammers R.J.M. 700, 755 Lanchbury J. 719 Lanciotti M. 693 Landkammer Y. 22 Landman J. 598 Lane J.A. 135 Lang C. 72, 514 Lang H. 170, 176 Lang J.M. 171 Langenhuijsen J.F. 336, 493 Langley S. 351 Laniado M. 475, V78 Lanoe M. 458 Lanwehr D. 293 Lanz M. 623 Lapini A. 93, 592, 887 Larcher A. 137, 254, 583, 848, 855 Largo R. 637, 868 Larré S. 283, 483, 697, 778, 1004 Larson T. 631 Lasaponara F. 376 Lau M.W. 395, 400 Laudano M.A. 724 Lavigueur-Blouin H. 175, 179, 233, 262, 718, 927, 960, 1024 Lavilledieu S. 283 Lavrinenko A. 893 Lawrence E.M. 142, 224 Lawrentschuk N. 270 Laydner H. 255, V2, V3, V22, V27 Laymon M. 928, 1028 Lazaro A.R. 200 Lazaro-Fernandez A. 606, 607 Lazarus J.M. 545 Lazzeri M. 137, 139, 254, 583, 729, 848, 855 Le Coguic G. 472 Le Corvoisier P. 137, 848 Le Moulec S. 104 Lebacle C. 283 Lebdai S. 87, 1105 Lebid L. 159, 892 Lebret T. 681, 930 Lechevallier E. 245 Ledo Cepero M.J. V33 Ledyaev D. 354 Lee B. 257 Lee B.K Lee C.J. 860 Lee C.H. 691 Lee D. 114 Lee D.H. 269, 512 Lee D.K. 435 Lee H.J. 325 Lee H.L. 435 Lee H.M. 266, 280, 297 Lee H.S Lee H.Y Lee J.H. 435 Lee J.K Indices Numbers refer to abstract numbers EAU Milan

448 Abstract authors Indices Lee J-L Lee J.N. 253, 428 Lee J.W. 317, 1072 Lee J.Y. 445, 611 Lee J.Y. 810, 1012 Lee J.Z. 691 Lee K.H Lee K.B. 460 Lee K.S. 266, 280, 297, 538 Lee L.S. 921 Lee M.Y. 317 Lee R.K 78, 276, 638, 724, 1004 Lee S.C. 974, 1003 Lee S.E Lee S.K. 213 Lee S.M Lee S.H. 786 Lee S.H. 269 Lee S.J. 612 Lee S.L. 318, 343 Lee S-W. 538 Lee S-Y. 100 Lee W.K. 213 Lee Y-C. 205 Lee Y.G. 213, 786 Lee Y.S. 213 Leenders W.P.J. 336 Lees M. 476 Legal S. 283 Legman P. 141 Legoux C. 283 Lehmann J. 74 Leibar Tamayo A. 125 Leibovich B.C. 957 Leichtle U Leidenberger P Leitenberger A. 461 Lemack G.E. 722 Lenaghan D.R. 539 Lenherr O. 143 Lenkiewicz E. 945 Leon Zamorano J.J. 334 Leonardi R. 561 Leong H.S Leonhäuser D. 448, 871 Leroy X. 237 Lerut E. 360 Leslie S. 220, 265, 361, V45, V79 Leto A. 914 Leva Vallejo M. 888 Levine E. 558 Lewis D. 833 Lewis D. 161 Lewis H. 53 Lewis J Lewis R. 81 Lewith G. 275 Leydon G. 275 Leyh-Bannurah S-R. 359, 1023 Li F. 33, 35 Li H. 119 Li H. 162, 249, 505 Li J. 105 Li J.M. 932 Li N. 50 Li W. 901 Li Marzi V. V69 Liao C.H. 335, 742, 1090 Liao Y. 149, 948 Liatsikos E. 25, 91, 660, 1067, V4, V17 Liberati E. 698 Liberman D. 638 Libertino J. 854 Liebhardt M Liedberg F. 750, 751 Liede A. 675 Liedl B. 844, 847, 897 Liguori G. 614, 838, V55 Lilja H. 4, 850, 856, 858, 1039 Lillaz B. 95 Lim B.J. 410, 490, 533 Lim G.S Lim J.H. 478 Lim L.Y. 623 Lim S.K. 810 Lima E.A.R. 968 Limani K. 800 Lin A.T.L. 515, 684, 735, 738, 1088 Lin C.D Lin C-C. 515, 735, 738, 784, 1088 Lin H.H. 723 Lin J-P. 738, 1088 Lin M.I. 723 Lin W.A. 723 Lin W.C.P. 684 Lin X. 9 Lindblom G. 481 Lindholm C. 664 Lindner U. 588 Ling T.L. 784 Lipczyński W. 597 Lipkin M.E. 653, 661, 967 Lipowska-Bhalla G Liske P. 143, 373, 962, 1067 Lissiani A. 817 Lista F. 524, V5 Lista G. 137, 254, 583, 848, 855 Litman H. 722 Littleton R. 659 Litzensberger A. 195 Liu C.C. 205 Liu F. 9 Liu F. 149, 948 Liu J.H. 932 Liu M. 149 Liu S.P. 335 Liu X. 326, 327 Liu X. 604, 605 Liu Y. 320 Liu Y.P. 840 Lizée D. 726, 896 Ljungberg B 751 Lledo-Garcia E. 498, 606, 607 Llorens De Knecht E. 531, V41, V63 Llorens Martinez F.J. 888 Llorente C. 482, 757 Lloyd T. 367 Lluel P. 440 Lo F. 935 Loch T. 461 Lodde M. 61 Loeser A. 863 Logadottir Y. 664 Logothetis C.J. 97 Lohse C.M. 957 Lokeshwar B. 937 Lokman U. 274 Lokshin K Lombardi A. 828 Lombardo R. 412 Long D. 948, 961, 1061 Long J.A. 87, 256, 257, 563, 564, 816, 1105, V2 Long R.M. V17 Longo F. 596 Longo N. 172, 396, 560 Numbers refer to abstract numbers 448 Programme Book

449 Lopater J. 930 Lopes A. 399, 557 Lopes T. 210 López B. 482 Lopez J.M. 532 Lopez L. V26, V29, V32, V65, V73 Lopez-Beltran A. 287, 393 Lopez Carmona F. 312 López-Costea M.A. V41, V63 López Cubillana P. 385 López-Fando Lavalle L. 346, 888 Lopez Farre A. 334 López González P. A. 385 López-Guerrero J.A. 10 López-Hellin J. 768 López-Pacios M.A. 768 López Sánchez D. 556, 1036 Loran O.B. 796 Lorente Garcia D. 682, 768 Lorenz A Losa A. 583 Lossnitzer A Lotan Y. 78, 276, 474, 576, 701, 752, 754, 813, 814, 815, 929 Lotfi A. 511 Loutochin O. 244, 785, 891 Lozano F. 232 Lozano J.J. 236, 237 Lozano M. 491 Lu S-H. 315 Lubbad L. 609 Luben R. 762 Lucarelli G. 662, V49 Lucas C. 387 Lucatello B. 95 Luccarelli G.L. 372 Lucci Chiarissi M. V11 Luciani L.G. 459, 509 Lucianò R. 187, 331, 694 Lück A Lücke K Lucky M. 400 Lüdecke G.C. 371, 707 Ludt F. 728 Ludwig T.A Lughezzani G. 137, 254, 388, 398, 848, 855 Luiz M. V58 Łukasik D. 279 Lumen N. 191 Lunardi P. 283 Lunelli L. 352, V64 Luque M.P. 206, 208, 313, 436 Lusch A. 598, V33 Lusuardi L. 22, 815, 884 Lv Y.Q. 28 Lynch C. 590 Lynch M. 879 Lynch T.H. 355 Lynn N.N.K 846 M Maaroufi J. 520 Maccagnano C. 363, 748 Maccario M. 95 Macdiarmid S. 741 Macek P. 352, 883, V48, V64 Machado N.C. 30 Macintyre G. 53, 145, 849 Mackenzie M.J Mackenzie R. 799 Maclean D. 100 Maclennan S. 523 MacNeil S. 109, 110, 873 Madaan S. 49, 1075 Madero R. 702 Madersbacher S. 992 Madurga Patuel B. 888, V33 Maegbaek M.L. 675 Maekawa S. 764 Maeta K. 33 Maffezzini M. 864 Magalon G. 245 Magalon J. 245 Maggi M. 211, 411 Magri V. 160 Magyar C.E. 193 Mahendran R. 758 Mahfouz W. 537, 891 Mahmalji W. 49 Maini C.L. 480 Mainwaring P. 97 Makanjuola J.K 16, 879, 1076 Makar A. 296 Makarevic J. 825, 830 Malats N. 229, 238, 697 Malavaud B. 136 Malet J.M. 229 Mallofre C. 237 Malmsten U.G.H. 120 Malmstrom P. 238, 697 Malone-Lee J. 736 Malossini G. 459, 509, 619 Maltry N. 941 Mamoulakis C. 521, 523 Mandal S. 541 Mändar R. 216 Mandhani A Manea I. 384 Maneschi E. 411 Manferrari F. 454, 711 Manfredi M. 219, 710, V11 Mangano A Mangera A. 910 Mangiapia F. 560, 622 Mangiarotti B. 596 Manjunath A. V57 Manka L. 133 Mannweiler S. 347 Mano R. 697, 815 Maraj B.H. 736 Maramhy H. 836 Marcelli F. V28 Marchesi J.R. 161 Marchioro G. 686, 688, 864, 911 Marconi L.S.O. 13, 375, 1079, 1082 Marcén Letosa R. 501 Marechal J-M. 180 Marenghi C. 368 Margaritis Guler S.S. 384 Margolis D. 138 Margulis V. 78, 576, 813 Mari M. 864 Mariani C Mariani L. 83, 1055 Mariani S. 517 Marien A. 220 Marignol L. 355 Marks L. 138 Maroof A. 836 Marsaud A Marschner N. 1102, 1106 Marshall J. 868 Marszałek A.M. 869 Martel J. 482 Martha J. 211 Martin N. 401, 739 Indices Numbers refer to abstract numbers EAU Milan

450 Abstract authors Indices Martin X. 170, 171, 180, 705 Martin-Morales A. 211 Martínez Castaño I. 422 Martínez Peralta H.L. 385 Martínez-Piñeiro J.A. 702 Martínez-Piñeiro L. 702, 851 Martínez-Salamanca J.I. 576, 813, 1004 Martini T. 592 Martins Silva C. 669 Martinschek A. 24, 1019 Martorana G. 172, 264, 271, 454, 693, 711, 887 Maruccia S. 540, 566, 567, 798 Maruschke M. 195 Maruyama K. 446 Maruyama S. 931 Marx G. 99 Marzocco M. V69 Masago T. 339, 925, 951 Masala A. 592 Masaru K. 60 Masashi K. 713 Maschino A. 850 Mascle L. 352 Masedu F. 698 Masieri L. 93, 259, 693 Masius R. 54 Mason M. 106 Masood J. 654, 963 Masoud A. 668 Massard C. 104 Massie C. 935 Masson-Lecomte A. 261, 283, 753 Massoner P. 829 Masuda H. 76, 240, 470, 572, 578, 586, 756, 819, 950, V21, V61 Masumori N. 337, 404, 603, 747 Mateo E. 1030, 1034, V5, V7 Mateos A. 229 Mateu L. 595 Mathieu R. 852 Matikainen M Matloob R. 140, 173, 467, 953 Matsubara A. 462, 666 Matsuda H. 931 Matsuda T. 21 Matsukawa Y. 288, 779 Matsumoto K. 242, 818 Matsumoto M. 663 Matsumoto R. 998 Matsumoto R. 931 Matsumoto T. 676 Matsumura N. 767 Matsuo K. 288 Matsuo T. 150 Matsuoka Y. 76, 240, 470, 572, 578, 586, 756, 819, 950, V21, V61 Matsushita K. 33, 35, 842 Mattei A. 554 Matthes K. V12 Matthes S. 194 Matveev B. 90 Matveev V.B. 88, 90, 954 Maulà V. 147 Maurer S. 243, 248, 791 Maurer T. 809 Maurin C. 87 Mavilla L. 486 Maxwell P. 935 May M. 282, 286, 340 Mazerolles C. 483 Mazzoli S. 166, 508, 509, 619 Mazzon G. 838 Mazzotti G. 579 McCartan N. 585 McCluskey S.A. 588 McCormack G. 296 McDougall E.M. 598 McGovern M. V62 McGregor R. 963 McKiernan J.M. 284, 485 McLeod N. V57, V66 McNeill S.A. 298, 922 McNicholas T. 137, 848 McVary T. 126, 407 Meacci F. 508 Meaney J.F. 355 Mearini L. 933 Medeiros Jr J.L. 29 Medica M. 264, 887 Medina R. 232, 362 Medina-Lopez R.A. 804, 917 Medina-Polo J. 773, 1073 Meehan R.R. 766 Meeks J.J. 749 Mege-Lechevallier F. 180 Mehedint D. 882 Mehik A. 160 Mehner J. 890 Mehnert U. 70 Meidahl Petersen P. 683 Meiers I. 353 Meinhardt M. 984 Meinhardt W. 392, 394 Meister B. 322, 323 Méjean A. 170, 171, 176 Melamed J. 138 Melchior-Becker A. 155 Mele F. 219, 710, V11 Meliani E. 508 Mencarini M. V69 Mengual L. 236, 237 Menigoz A. 441 Menon M. 20, 119, 158, 260, 369, 497, 526, 534, 625, 657, 659, 709, 885, 915, 1031, 1070, V14, V24, V25 Menon S. 935 Mentine N Mercier F. 104 Merigot De Treigny O. 87 Mermerkaya M. 527, 646 Merseburger A.S. 198, 282, 329, 575, 601 Meseguer A. 768 Meskawi M. 175, 178, 233, 262, 718, 820, 927, 956, 1024 Mestre C. 378 Metcalfe C. 135 Meuleman E.J. 211 Meyer D. 310 Meyer S.E Miah S. 44 Mian C. 61 Micali S. 439 Micco M. 823 Michaelson D. 100 Michel M.S. 321, 322, 323 Michels L. 70 Michiels J.F Michio N. 59 Michl U.H.G. 293, 295, 1006, 1018, 1023 Mickisch G.H. 680 Miernik A Miersch J. 907 Numbers refer to abstract numbers 450 Programme Book

451 Mihalache A. 542 Miki T. 8, 215, 414, 1056 Milani A. 83 Miljak M. 906 Millan F. V35 Miller D. 32 Miller F. 629, 861, 1022, V59 Miller K. 108, 192, 678, 853, 859 Miller O. 894 Mills I. 935 Milner V. 296 Milsom I. 120, 739 Mimata H. 444 Min G.E. 435 Minagawa S. 228 Minami K. 931 Minami T. 98, 1108 Minami T Minervini A. 93, 172, 259, 264, 340, 592, 887 Minhas S. 129, 391 Minich A. 958 Minnillo B. V12 Miocinovic R. 816 Mirabile G. 486 Mirciulescu V. 542, V37 Mirone V. 264, 289, 340, 396, 560, 622, 714, 887, 1014, V55 Mirtti T.K. 154, 274 Mirylenka L.V. 285, 958 Mirzazadeh M. 558 Mischinger J Mishriki S. 370 Mistretta F.A. 69, 254, 328, 583 Mitchell T.J. 823 Mitra A. 815 Mitsunari K. 150 Mitsuru S. 610 Mitsuzuka K. 720 Mitusov V. 419, 787, 797 Miura M Miyaji Y. 199 Miyajima A. 21, 242, 818, 959 Miyajima N. 931 Miyake H. 33, 35, 487, 663, 842, 862, 940, 983, 1047 Miyamoto K. 462 Miyamoto T. 71 Miyata Y. 150 Miyazaki Y. 242, 818 Miyazaki Y. 699, 1091 Miyazawa Y. 938 Miñana B. 232, 362 Mmdouh A. 528 Mochizuki T. 931 Mochizuki T. 71 Modlin C. V3 Mofferdin A. 439 Mohammed A.A. 455 Mohammed N. 382, V50 Mohanad M. 966 Mohee A. 502, 617 Mohrhardt S. 364 Moiseenko T. 350 Mojena-Sanchez M. 606, 607 Molander U. 120 Moldoveanu C. 570 Molimard B. 283 Molina A. 97, 105 Molina R Molisso G. V67 Moll J.M. 824 Moltzahn F. 688 Mombelli G. 996 Mombet A. 589, 1020 Momma T. 242, 818 Momokazu G. 713 Monagas Arteaga S. V60 Mondaini N. 166, 509, 619 Mondino P. 174 Mongiat-Artus P. 87 Monish A. V6 Monrós Lliso J.L. 10, 1007 Monsalve C. 496 Montanari E. 596 Montes De Oca L. 108, 587 Montesino M. 702 Montiel R. V36, V39 Montironi R. 287 Montorsi F. 78, 173, 575, 576, 601, 693 Moon D.G. 955, 994 Moon K.H. 116, 349 Moon S.H. 538 Moore C. 138, 218, 267, 275 Morales M. 437, 1043 Moran D.C. 355 Moran S. 100 Moran Pascual E.J. 543 Mordasini L. 665 Moreira C. 168 Morelli A. 411, 579 Moreno Alarcón C. 385, 422 Moreno Jimenez J. 312 Morgenthaler N.G Morgia G. 864 Mori H. 132 Mori K. 79, 82, 197, 1042 Morikawa H. 228 Morikawa N. 504 Morimoto S. 572, 819 Moriya T. 199 Morizane S. 339, 925, 951 Morlacco A. 880 Morlacco A. 259 Morote J. 6, 108, 682, 768 Morra I. 875, V11 Morris S. V62 Mortezavi A. 799, 868 Mortimer P. 100 Mosaheb N. 127 Mosbah A. 928, 1028, 1038 Moschini M. 146, 331, 363, 748, 953 Moseley H. 599 Mosquera J. 229 Moss S. 2 Mostafa M. 836 Mostafa S. 836 Mostafid H. 230 Mota A. 375, 1079 Mota P.K. 525 Motiwala H. 475, V78 Motoshima T. 982 Mottet N. 136, 170 Mottrie A. 254, 1031, 1032 Mottrie A. 186, 258, 290, 913 Mourey E. 171, 176 Mouri G. 931 Moursy E. 528 Moussa A. 537 Mueller-Allisaat B. 321 Muftuoglu S. 643 Muguruma H. 132 Mühr M. 194 Mulders P.F.A. 97, 105, 336, 980 Mulhall J. 123 Mulla M. 16 Indices Numbers refer to abstract numbers EAU Milan

452 Abstract authors Indices Müller A. 635, 637 Muller B.G. 594 Müller G. 167, 618 Müller L. 1102, 1106 Müller S.C. 286 Müller Arteaga C. 888 Mullins J. 876 Multescu R.D. 570, V37 Mundhenk J. 364, 1022, 1049, 1054, V59 Muneer A. 129, 391 Munegato S. 174 Mungan N.A. 128 Muntañola P. 229 Murakami R. 613 Muramaki M. 862 Murat P. 823 Murby B. 395 Murez T. 283 Murphy D.G. 946 Mursi K. 536 Murta C.B. 525 Muselaers C.H.J. 336, 980 Musitelli S Musquera Felip M. 378, 383, 489, 491, 494, 496, 498, 639 Muthen N. 890 Mynderse L. 631 Mytilekas K-V. 733 N Na R. 9, 901 Nabebina T.I. 278 Naber K. 166 Nabi G. 599 Naboka Y.L. 845 Nagae G. 764 Nagahama K. 572, 819 Nagai A. 199 Nagata Y. 764 Nagele U. 91, 549, 656, 1062, V74 Naito S. 450, 765 Naitoh Y. 215, 414 Nakagawa K. 21, 242, 818, 959 Nakagawa M. 52, 772 Nakagawa T. 98 Nakagomi H. 71 Nakaigawa N Nakajima H. 121 Nakajima Y. 818 Nakamoto M. 361, V45, V79 Nakamura K. 504 Nakamura T Nakamura Y. 77 Nakanishi Y. 240 Nakano Y.N. 487 Nakashima T. 132 Nalagatla K 969 Nam J.K. 759 Nanda J. 766 Naoto S. 713 Napodano G. V67 Napoli R. 838 Nappi R.E. 894 Naranov S.V. 797 Narayanan R. V12 Nardo C. 741, 744 Nardoni S. 486 Narita S. 610, 720, 1100, 1104 Narumi S. 613 Nasopoulou P. 548 Naspro R. 173 Nassif L.T. V58 Nasu Y. 503 Nativ O. 202 Nativ O. 202 Naumann C.M. 358 Nawfal G. 547 Naya Y. 215, 1056 Nayar R.C N'Dow J. 523 Neal D. 135, 823, 833, 935 Necchi A. 83, 388, 397, 398, 1055, 1057 Negoro H. 66 Negrini S. 770 Negrão R. 210 Neidle S. 823 Neisius A. 653, 661, 967 Nekeman D. 239 Nelson A.W. 142 Nelson W.G 943 Nemade H. 510 Nemoto R. 223 Nepple K. 1031, 1032 Nesi G. 166, 411 Nesius D. 461 Nestler S. 342 Netsch C. 636 Neuzillet Y. 87, 283, 930 Newling D. 706 N Fukuda M. 602 Nguyen-Nielsen M. 675 Ni K. 837 Nichele S. V58 Nicita G. V69 Nicolai M. 173 Nicolai N. 83, 388, 397, 398, 1055, 1057 Nicolau C. 313, 436 Nicolazzo C. 55 Nicosia V. 368 Nieboer D. 139 Niedworok C. 155 Niehrs C. 941 Nieuwenhuijzen J. 706 Nigawara T. 463 Nigro F. 319 Niimi A. 333 Niimi K. 311 Nikitin O.D. 507 Nikolov I.G. 203 Nilsson J. 677 Nini A. 69, 140, 473, 687, 694, 918 Nir D. 353 Nishikawa G. 504 Nishikawa N 66 Nishimatsu H. 333 Nishimura S-I. 197 Nishizawa O. 404, 747 Nishizawa S. 767 Nison L. 575 Nita G. 542, V37 Nitkin D.M. 621 Nitta T. 121 Nitti V. 401, 739, 744 Nitzke T Nockher A Noguchi M.N. 444 Noh C.H. 727 Noldus J. 718 Nolley R. 761, 975 Noma T. 442 Nomiya A. 333 Nomiya M. 446 Nomura T. V68 Nonis A. 185, 473 Numbers refer to abstract numbers 452 Programme Book

453 Nonomura K. 931 Nonomura N. 943 Nørgaard J.P. 405, 406 Noris Chiorda B. 184 Noro A. 572, 819 North S. 97, 1107 Notoya T Novara G. 78, 172, 258, 264, 290, 340, 573, 575, 576, 813, 814, 815, 913, 990 Nowell C.J. 849 Nozawa M. 98, 1108 Ntanios F. 740 Nuhn P. 286 Nukui A. 492 Numakura K. 610, 1100, 1104 Numao N. 76, 240, 470, 572, 578, 586, 756, 819, 950, V21, V61 Nunes P.T.C. 13, 375 Nyberg T. 912, 916 Nyek Ntep N. 439 Nyushko K.M. V43 O Oakley N. V57, V66 Obara W. 77 Obata J. 242, 818 Obek C. 479 Ober P. 962 Obermueller N. 608 O'Brien C. 3 O'Brien T. 298, 477, 568, 1033 Ochelenko V.A. 562 Ochiai A. 215 Ockrim J.L. 775, 776 Oddens J. 708 Oderda M. V26, V29, V32, V65, V73 Odeyemi I Odone-Filho V. 650 O'Donnell M. 766 O'Donovan J. 865 Oelke M. 782, 1095 Ogawa O. 66, 1085 Ogawa S. 764 Oger S. 449, 900 Ogura K. 699, 1091 Oh C.Y. 786 Oh C.K. 551 Oh J.H. V47 Oh J.K. 974 Oh K.J. 464 Oh M.M. 955, 994 Oh T.H. 519 Ohara S. 462, 666 Ohba K. 150 Ohira S. 199 Ohlmann C-H. 74, 703, V31 Ohlstein E.H. 440 Ohnmacht S. 823 Ohyama C. 79, 82, 197, 463, 602, 613, 720, 1042, 1104 Ojea A. 702 Okada A. 311 Okada K. 33, 35, 842 Okada S. 228 Okamoto A. 79, 82, 463, 1042 Okamoto T. 602, 1042 Okhunov Z. V33 Okihara K. 8 Okinami T. 66 Okuno T. 572, 819 Okuno Y Okuno Y. 764 Okyar G. 417, 616 Olagui G. 235 Olarte Barragán E.H. 385 Olbert P. 728, 1099 Olde Damink L.H. 870 Olesen T.K. 677 Olianas R. 867 Oliveira C. 968 Oliveira M. V72 Oliveira P.D. 898 Oliveira R.A.R. 399, 557 Oliveira R.M. 898 Olivier F. 679 Olivier Gómez C. 334 Ollandini G. 838 Olsson M. 912, 916 Omae K. 821 O'Mahony F.C. 766 Omar A. 475 Omar M.I. 523 Omer A. 384 Omorphos S. 391 Omran M. 416 Onal B. 529 Onder A.U. 529 Ono N. 503 Ono T. 931 Ooiwa Y. 228 Oosterwijk E. 153, 336, 872, 980 Oppenheimer F. 491, 496 Orange C. 902, 905, 989 Orczyk C. 500 Orimoto N. 442 Ornek T. 128 Orntoft T. 238 Osawa T. 931 Osborne J.D. 367 Osborne M. 935 Osman N. 109, 110 Osman Y.M. 928, 1028 Osman-Garcia I. 804, 917 Osmonov D.K. 188, 358 Ost P. 191 Osterberg E.C. 724 Osther P.J.S Oswald D. 644 Oswald J. 644 Otero Tejero I. 40, 1073 Oto A. 138 Otsuka A. 998 Otterlei M. 152 Otto T. 251 Otto W. 282, 286 Oudard S. 99, 104 Oudot A. 900 Oussama M. 520 Ouzaid I. 87 Ouzzane A. 576 Oya M. 242, 818, 959 Oyen R. 360 Oyen W.J.G. 336, 980 Özcan C. 527, 646 Ozdemir B. 645 Özdemir B. 942 Ozden E. 117, 163, 381 Ozen H. 106 Ozkaya F. 616 Ozmerdiven G. 652 Ozono S. 998 Öztürk E. 527, 646, 647 P Paborji M. 402 Pacheco-Figueiredo L. 210 Indices Numbers refer to abstract numbers EAU Milan

454 Abstract authors Indices Pacik D. 631 Padhani A.R. 268 Paez A Pages A. 705 Pagi H. 680 Pahernik S. 340, 341, 344 Pai A. 48 Paick J.S. 332, 860 Pak S. 533, 807, 1005, 1010 Pal P.O. 736 Pal S.K Palacios J-M Palagin I. 169 Palea S. 440 Palermo S. 61 Palleschi G. 517, 914 Palmer K.J. 299, 689, 1013, V10, V13 Palmer S. 138, 220 Palmer T. 910 Palmieri A. 396, 560, 622 Palmieri F. 579 Palminteri E. 798 Palou Redorta J. 137, 232, 281, 362, 372, 697, 702, 755, 760, 848, 1031, 1032, V72 Pan C.C. 287 Pandey A. 790, 795, V70 Pandit A. 3 Panebianco V. 11, 591 Pann R. 22 Pantel K. 107, 802 Pantuck A.J. 193 Panumatrassamee K. V2, V3 Paolini B Papadakis T. 62 Papalia R. 480, 881, 1038, V23, V46 Papandreou C. 106 Paparel P. 87, 1105 Papotti M. 219, 710 Parada R. 372 Paradowska-Dogan A. 27, 32 Pardo P. 498 Paredes D. 383, 491, 496 Parekattil S. 841, V51, V52, V76 Park B.H. 266, 297 Park C.H. 986 Park D.S. 165 Park H.J. 409 Park H.J. 124, 1092 Park J-S. 535 Park J.W Park J. 437 Park J. 1005, 1010 Park J.P. 488 Park K. 464 Park K. 332 Park M.G. 209, 544 Park N.C. 124, 1092 Park S. 80, 196, 466, 469, 807 Park S. 410, 533, 649, 771, 1097 Park S.C. 317 Park S.J. 165 Park S.W. 632, 759 Park S.Y. 177 Park Y.K. 253, 428 Park Y.C. 97 Park Y.Y. 512, 612, 997 Parker C. 101 Parkinson R. 516 Parma P. 259, 459 Parmigiani A. 894 Parodi A. 770 Parr N. 395, 400 Pascal Z. V6 Paschos A. 939 Pasini B. 95 Pasquale G. 376 Passaretti G. 271, 711 Passariello R. 591 Passoni N.M. 140, 187, 289, 474, 687, 701, 714, 752, 918, 929 Pasticier G. 96, 283, 763 Pastore A.L. 517, 914 Patani L.G. 655 Patard J.J. 87, 170, 171, 176, 283, 1105 Patel A. 568, 1033 Patel T. 841 Patel V. 18, 299, 689, 1013, V10, V13 Patil M. V45 Patil P.A. 546, 550, 655 Patni L.G 546, 550 Patrick D. 99 Patschan O. 750, 1029 Pattaras J.G. 1031, 1032 Paulus P. 608 Pavan N. 614, 838, V55 Pavlik I. 108 Peabody J.O. 20, 158, 369, 497, 526, 534, 625, 657, 659, 709, 915, 1031, 1032, 1070, V14 Pearce I. 44 Pearson J. 157 Pecoraro S. 561 Pedersen J. 145, 849, 946 Pedretti N Peehl D.M. 761, 975 Peeker R. 120, 664 Pelegrí J. 532 Pelger R.C.M. 889 Pellegrini F. 412 Pellicer Cabo M Pellucchi F. 363, 748, 953 Peltier A. 800 Pena E. V39 Pena-Outeiriño J.M. 804, 917 Penna F.J. 526, 534 Perabo F. 674 Peraldo F. 130 Percy A. 882, V12 Perego R. 769 Perepanova T. 169 Pérez E. 757 Perez M. 40 Perez-Lanzac De Lorca A. 598, V33 Pérez-Reggeti J.I. V41, V63 Peri Cusi L. 378, 383, 489, 491, 494, 496, 595, 639, 888, 993 Perletti G. 160 Pernetti R. 579 Perrouin-Verbe M.A. 304 Perry A. 355 Perry M. 389, 593 Persad R.A. 230 Persson B-E. 677, 678 Persu C. 542 Pertusa Peña C. 498 Perucchini L Peschechera R. 459 Pesonen J. 910 Peters G. 72, 514 Peters I. 198 Peters J.S. 849 Peters M. 954 Petkov T. 971 Numbers refer to abstract numbers 454 Programme Book

455 Petkova K. 971 Petkova N. 899 Petracca A. 55 Petrozza V. 517, 914 Petrusevska G. 203 Peyrat L. 896 Peyromaure M. 141 Peyronnet B. 283 Peña E. V36 Peña J.A. V72 Pfister C. 170, 171, 176, 283, 483 Pfister D. 452, 801 Philpott-Howard J. 510, 1076 Phull J.S. 367 Phung D. 674 Phé V. 304, 734 Picard A. 705 Pichler M. 347 Pichler R. 644 Pichon T Pickard R.S. 623, 781, 865 Picozzi S. 368, 540, 566, 567 Piechaud P-T. V26, V29, V32, V65, V73 Pietropaolo A. 729 Pignot G. 170, 171, 176, 235, 283 Pillot P. 426, 427, 429 Pini G. 382, V50 Pinon C. 778 Pinthus J. 939 Pinto P. 138 Pinto R. 627, 673 Pinto S.J. 441 Pinzi N. 887 Pinzón Navarrete C.P. 385 Piper C. 452, 801 Piqueras M. 34, 639 Pirozzi L.P. 408, 1093, 1094 Pisano F. 130, 697 Pisanti F. 486, 580 Pisco J. 628 Pisipati S. 783 Pistolesi D Pittoni G.M Piva L. 83, 388, 397, 398, 1055, 1057 Pizzocaro G. 83, 1055 Placer J. 6, 682 Plainard X. 458 Planas J. 6, 682 Plaza Viguer B. 231, 805 Plekhanova O. 23 Ploumidis A. 916 Ploussard G. 87 Poggio M. 219, V11 Pokrywczyńska M. 869 Poletajew K. 43 Poletajew S. 43, 279 Polo Rodrigo A. 231, 805 Polson A. V62 Poluyanchik A.V. 958 Polyakov S.L. 278 Polyakov V.A. V43 Ponce De Leon J. V49 Ponce Diaz-Reixa J. 498 Ponhold L. 345 Ponholzer A. 992, 1021 Pons Viver J. 556 Pontillo M. 855 Pontones Moreno J.L. 231 Pook D. 946 Poon B.Y. 749 Popert R. V62 Popken G. 461, 1025 Popov A.A. 115 Porena M. 147, 303, 670, 729, 933 Porpiglia F. 172, 204, 219, 264, 459, 630, 710, 875, 887, V11 Porreca A. 259 Porres D. 452, 801 Porru D. 894 Porst H. 211 Porter J. 254 Portillo Martin J.A. 702 Potenzoni M Poth S. V16, V20, V34 Potiron E. 472 Poulakis V. 1031, 1032 Poulakou-Rebelakou E. 41 Poulias I. 548 Power N Powles T. 58, 81 Poyet C. 637 Pozzi R. 700 Prapotnich D. 589, 679, 1020 Prats J. 229 Pravorov A.V. 285 Preda A. 384 Preira J. 628 Preminger G. 653, 661, 967 Prera A. 229 Presicce F. 412 Priest A.N. 224 Prieto L. 746 Primus G Priola K. 841, V51, V52, V76 Proietti S. 300, 302, 303, 670 Protzel C. 393 Pruthi R.S. 1031, 1032 Pu Y.S. 234 Puccini F. 672, 725 Pucheril D. 659 Pueche P. 138 Pultrone C. 454 Pummer K. 347 Punab M. 216 Punwani S. 138, 717 Pushkar D.Y. 115, 186, 350 Putter H. 889 Pycha A. 61, 78, 276, 573, 592, 601, 701, 752, 754, 813, 815, 929 Q Qayyum T. 902, 989 Qazi H. V17 Qi D. 320 Qi J. 901 Qian Y. 99 Qteishat A. 879 Quarta M Quicios C. V75 Quintens H. 283 R Radavoi D. 966 Radwan M.H. 420 Radziszewski P. 43, 401, 741 Raffaelli C Rafiq A. 62 Raggi D. 83, 388, 397, 398, 1055, 1057 Ragni F. 204 Raheem A.A. 129 Raileanu A. 127 Rais-Bahrami S. 91, 552 Raita C. 790, 795 Raja A. 952 Indices Numbers refer to abstract numbers EAU Milan

456 Abstract authors Indices Rajan P. 910 Ralph D. 129 Ramadan A.R. 420 Raman J.D. 78, 573, 576, 813 Ramani V.A.C. 86 Rambeaud J.J. 283, 563, 564 Ramirez Backhaus M Ramirez-Martin D. 606, 607 Ramon De Fata F. 524, 760, 1030, V9 Ramos M. 380 Ramos-Montoya A. 823, 833, 935 Ramírez-Backhaus M. 10 Ramón Y Cajal S. 768 Ranasinghe A.M. 453 Rancoita P. 185 Randazzo M. 133 Rankin S. 477 Rannikko A. 274 Rao A.R. 20, 475, 879, V78 Rao G. 882 Raspollini M.R. 93 Rassweiler J. 13, 23, 461, 521 Rassweiler M.C. 321, 322, 323 Rastrelli G. 411 Ratan H.L Ratcliffe N.M. 506 Rathenborg P. 674 Rathkopf D. 97 Ratti D. 567, 996 Raugei A. 93 Ravery V. 87 Ravi P. 915 Ravic M. 700 Rawandale A.V. 546, 550, 655 Ray E.R. 577 Raynal G. 432 Raza S.J.R. 19 Raßler J. 461 Real F.X. 229 Realfonso T. V67 Rebmann U. 192, 461 Recker F. 133, 272 Regge D. 219, 710 Regier M. 359 Rehman S. 20 Rehn S. 195 Reichert M. 867 Reid J. 719 Reid S.V. 777 Reis-Santos J.M Reiss P. 866, 1002 Reiter M. 825 Rekik M. 440 Rempelakos A. 41 Remzi M. 575, 576, 601, 813 Renard O. 96 Renninger M. 812 Renter A. 137, 848 Rentsch C.A. 945 Rentzos L. 25 Resende A.O. 898 Reukers D.F.M. 12 Reuter V.E. 715 Revuelta I. 491, 496 Rey D. V26, V29, V32, V65, V73 Reyes Ríos P.Y. 422 Rha K.H. 91, 177, 269, 810, 1031, 1032 Rha S.Y Rhew H.Y. V47 Ribal Caparrós M.J. 232, 236, 362, 378, 489, 494 Ribeiro S. 380 Ricci C. 540, 567 Richard F. 734 Richardson A. 275 Richstone L. 91, 552, 1031, 1032 Richter H. 722 Ricós Torrent J.V. 10, 1007 Riddick A.C.P. 766 Ridout A.J. 267, 275 Riechardt S. 425, 866, 1002 Riedmiller H. 282, 286, 863, 936 Rieken M. 167, 618 Riera Canals L. 498 Riethdorf S. 107 Rigatti P. 173, 183, 184, 185, 187, 188, 473, 695, 748, 953 Rigaud J. 87, 170, 171, 176 Righi D. 376 Rijo Cedano E. 631 Rim J.S. 317 Rimington P Rinaldi A. 614 Rini B.I Rink M. 78, 276, 802, 813, 814, 815, 822, 1015 Rio Tinto H. 628 Rioja C. 760 Rioux-Leclercq N. 87, 1105 Ripoli A. 914 Risbridger G.P. 946 Rischmann P. 261, 283 Riss J. 193 Ritter M. 24, 321, 322, 323, 1019 Ritter R. 365 Rivas Del Fresno M. 229, V42 Riveros M. V36, V39 Rizkala E. 256, 552, V22, V27 Rizzato L. 305 Rizzi S. 271 Rizzo M. 614, 838 Robain G. 304 Robert G. 96, 763 Robertson A. 434 Robertson W.G. 314 Robine E. 87 Robinson A. V62 Robinson B.D. 151, 156, 276 Robinson D. 782 Robinson M Robinson S. 475 Rocca G.C. 454, 711 Rocchini L. 363, 748 Rocco B. 186, 259, 340, 919, V10 Rocco F. 172, 887 Rochester M.A. 762 Rode J. 549, V15 Røder M.A. 273 Rodrigues P. 968 Rodriguez C. V38 Rodríguez J. 702 Rodríguez M. V75 Rodríguez Antolín A. 125, 498 Rodriguez De Vera J.M. 229 Rodriguez Escobar F. 888 Rodriguez Faba O. 281, 372, V49 Rodríguez-Patrón Rodríguez R. 346, 379 Rodriguez Sierra P. 334 Rodriguez Villamil L. V42 Rodriguez-Malatesta R. V41, V63 Roehrborn C. 1095, 1096 Roelofs L.A.J. 870 Roethke M. 222 Rogel Berto R. 231, 805 Numbers refer to abstract numbers 456 Programme Book

457 Rogenhofer N. 27 Rogers B. 400 Rogers C. 260, 497, 709, 876, 885, V14, V24, V25 Roghmann F. 175, 178, 233, 262, 718, 820, 927, 956, 960, 1024 Roigas J. 286 Rojas-Cruz C. V71 Rolevich A.I. 278, 285, 958 Rom M. 991 Romagnoli D. 271, 711 Roman S. 109, 110 Romanenko O. 159 Romano G. 880 Romero D. 941 Romero I. 1034, V8 Romero M.R. 408, 1093, 1094 Romero Otero J. 125 Romics I Romics M Roobol M. 1, 5, 139, 850, 912 Rooney S.J. 453 Roos F.C. 338 Roosen A. 907 Rosales A. V72 Rosario D. 568 Roscigno M. 173, 340, 575, 601, 953 Roseiro A. 375 Rosen R.C. 211 Rosenkrantz A. 138 Roser F. 306 Rosety Rodriguez J. V33 Roskams T. 513 Rossi M.S. 271 Rossi De Vermandois J.A. 300, 302, 303, 670 Rossi Neto R. 559 Rosso M. 817 Roth B. 330 Roth W. 344 Röthlisberger S. 555 Rothman N. 229 Rothwell D.G Rottenberg G. V62 Roudot Thoraval F. 716 Rouffilange J. 87, 96 Rouget C. 440 Rouprêt M. 78, 87, 170, 171, 176, 237, 261, 283, 304, 483, 575, 576, 601, 734, 752, 1105 Rouquette A. 235 Rouse P. 16 Roushias S. 623 Rousseau A. 458 Rousseau C. 472 Rousseau T.G.M. 472 Rouviere O. 180 Roux J.W. 137, 848 Rovereto B. 172, 264, 887, 894 Rovers M.M. 12 Rovner E. 308 Rozet F. 352, 483, 576, 589, 679, 883, 1020, V48, V64 Rübben H. 155, 559 Rübe C. 192 Rubio-Briones J. 10, 1007 Rud E. 221 Rudolph R. 348 Rufle A. 945 Ruiz C. 945 Ruiz Cerda J.L. 231, 805 Ruiz Jiménez J.I. 422 Rummel C. 665 Rupprecht K. 608 Russo A. 289, 443, 467, 953 Russo F Russo F. 219, 710 Rutigliano M. 662 Rutman M. 638 Rutz B. 906, 907 Ryan A. 145, 946 Ryan C.J. 97, 100 Ryang S.H. 997 Rydén L Rynja S.P. 648 S Saad F. 207 Saad F. 99 Saad I.R. 536 Saad T.W. 530 Saad Z. 391 Saar M. 74, 761, 975, 1031, 1032 Saaristo L Saavedra J. V6 Sabaa E. 836 Sabatier F. 245 Sabharwal K.V. 418, 421, 424 Sabir E.F. 569 Sacristan R. 277 Sagara Y. 150 Sagawa K. 446 Sahdev V. 47 Sahu M. 585 Saito K. 76, 240, 470, 572, 578, 586, 756, 819, 950, V21, V61 Saito M. 1100, 1104 Saito N. 92 Saitoh H. 613 Sakaeda T Sakai H. 150 Sakai I. 983 Sakai Y. 92, 572, 819 Sakalis V. 389 Sakellariou C-A. 835 Sakihara S. 463 Sakuma Y. 492 Sakuta T. 931 Sala A. 868 Sala E. 142, 224 Saladini G. 357 Salcedo M. 768 Salciccia S. 11 Saldaña L.J. 532 Salem A. 536 Salem H.K. 640 Salem N Salinas Casado J. 746, 888 Salman M. 867 Salom Fuster J.V. 805 Salome F. 170, 171, 176 Salomon G. 226, 295, 359, 1006, 1018, 1023 Salomon L. 136, 170, 171, 176, 283, 716, 753, V15 Salonia A. 140, 187, 289, 467, 473, 695, 918 Saltirov I. 971 Saltzstein D.R Salvador R. 313, 436, 496 Salvatore S. 726 Salvi M. 93, 411, 1014 Salvini E. 729 Salvioni R. 83, 388, 397, 398, 1055, 1057 Indices Numbers refer to abstract numbers EAU Milan

458 Abstract authors Indices Samarasekera D. 255, V3, V30 Samavedi S. 299, 689, 1013, V10, V13 Samir T Sammon J.D. 119, 158, 260, 369, 497, 526, 534, 625, 657, 659, 915, 1070 Sampaio F.J.B. 29, 30, 413, 903 San José Manso L. 334 Sanada M. 764 Sanchez L. V36, V39 Sanchez- Carbayo M. 277 Sánchez-Chapado M. 524, 1034 Sanchez Escudero E. 383 Sanchez-Escudero A. 491, 496 Sanchez-Martín F. V35 Sanchez-Salas R.E. 352, 589, 679, 686, 688, 883, 911, 1020, V48, V64 Sandmann M. 226 Sandner P. 900, 909 Sandoe J. 502, 617 Sandrini S. 499 Sang Don L. 632 Sang Hoon S. 649 Sangar V. 395, 400 Sanguedolce F. 268, 660 Sanjmyatav J. 194 Sanjurjo S. 780 Sano H. 931 Sansalone S. 561 Sanseverino R. V67 Santana T.B.M. 399, 557 Santarsieri M Santi R. 411 Santillana J.M. V35, V72 Santinelli F. V44 Santià S. 376, 431, 1066, 1071 Santos J. 975 Sanz Mayayo E. 346 Sapre N 53, 85, 145, 704, 849 Saraceni G. 454 Saran R.K. 418, 421, 424 Sarchielli P. 302 Sarica K Sarikaya S. 117, 163, 381 Sarkis P 547 Sarró E. 768 Sasaki E. 442 Sasaki T. 978 Sassa N. 288 Sato A. 764 Sato A. 57, 144, 574, 827, 976, 977 Sato F.S. 444 Sato N. 603, 767 Sato S. 931 Sato T. 931 Sato Y. 199 Sato Y. 121 Sato Y. 361 Sato Y. 764 Satoh S. 610, 1100, 1104 Saussez T. 432 Sava D. 194 Savastano S. 319 Savoie P-H Sawazaki H. 699, 1091 Sayedahmed K.A.M. 867 Sazawa A. 931 Sağlam H.S. 111, 794 Scardino P. 715, 854 Scarpa R. 521 Scattoni V. 137, 289, 695, 918 Schäfer G. 7, 803 Schäfer L. 707 Schagdarsurengin U. 31, 947 Schalken J.A. 63, 851 Scharpf M. 899 Schatloff O. 299, 689, 1013, V10, V13 Schätz T. 22 Scher H.I. 97, 105 Scherer R. 198 Scherr D.S. 78, 156, 276, 474, 573, 701, 752, 754, 813, 814, 815, 929, 1031, 1032 Scherrer A. 930 Schettini M. 486 Schiavina R. 172, 264, 271, 454, 693, 711, 887, 1014 Schiefelbein F. V18 Schiffmann J. 226 Schilling D. 964, 1022, V59 Schips L. 91, 340, 408, 412, 592, 1093, 1094 Schlemmer H-P. 222 Schlenck B. 644 Schleutker J Schlomm T. 107, 293, 802, 920, 1006, 1018 Schmid H-P. 310 Schmid M. 474 Schmid S Schmidbauer J.S. 577 Schmidt J. 828 Schmidt M. 707 Schmidt M. 68 Schneider S. 944 Schober R.R Schoen G. V18 Schoenthaler M Schoffelmeer C. 291, 292 Schönthaler M. 629 Schorsch M. 27, 31 Schrader A. J. 241, 338, 348 Schrader M. 338, 348 Schramek P. 474, 1021 Schriefer P. 866 Schröder F.H. 1, 5, 680 Schubert M. 936 Schull A. 141 Schulwitz H Schulz E Schulze M. 521 Schulze-Forster K. 859 Schumacher C. 330 Schumacher S. 338 Schumann A. 382, V50 Schuppe H-C. 27, 32 Schurch B. 70 Schütte A. V16, V20, V34 Schütz B. 62 Schwaab T. 882 Schwaiger B. 866 Schwantes U. 448 Schwarz R. 293 Schwentner C. 364, 365, 899, 1022, 1049, 1054, V59 Schykowski T. 653 Sciarra A. 11 Sciuto R. 480 Scoffone C. 521 Scott H. 935 Scremin E. 319 Sebastia M.C. 496 Sebastianelli A. 411, 1014 Sèbe P. 896 Numbers refer to abstract numbers 458 Programme Book

459 Secin F. 589, 679, 1020 Sedelaar J.P. 582 Sedigh O. 376 Segersten U. 238 Segoloni G.P. 376 Seguchi K. 574, 827 Seibel R. 867 Seibold J. V54 Seidel C. 241, 348 Seidenader J. 222 Seifarth V. 250, 871 Seiler D 133, 272 Seiler R. 330 Seisen T. 483, 576, 716 Seitz C. 78, 474, 813, 1021, 1067 Seiwerts C. 359 Sejima T. 339, 925, 951 Seki H. 931 Seki N. 52, 772 Seki T. 931 Sekine Y. 938 Seklehner S. 724 Seligson D.B. 193 Selim M. 792 Selli C Selvaggi F.P. 662 Semjonow A. 139, 192, 465, 853, 859 Sengel C. 564 Sengeløv L. 106, 683 Sengiku A. 699, 1091 Seni G. 112 Seo H.K Seo I.Y. 317 Seo S.I. 266, 280, 297 Serati M. 726 Serbo Y. 893 Serikoff A. 743 Seringe E. 261 Serni S. 93, 172, 259, 264, 693, 887 Serra C. 229 Serrallach M. V41 Serrano A. 760 Serretta V. 697 Serth J. 198 Sester M. 703 Sester U. 703 Sevcenco S. 345 Sgrò E. V53 Shaaban A. 928, 1028 Shah P.J.R. 775, 776 Shah N.C. 921 Shah V. 367 Shahab N. 450 Shaker H. 511 Shamsuddin A. 600 Shan Y.X. 839 Shangichev A.V. 419, 797 Shaplygin L.V. 581 Shariat S.F. 78, 151, 156, 276, 340, 473, 474, 573, 575, 576, 601, 697, 701, 752, 754, 813, 814, 815, 929, 1015, 1032 Sharif M. 20 Sharma D. 16, 389 Shaw G.L. 833 Sheehan S. 510 Sheikh N. 103 Shen P. 558 Shestani T. 486 Shevelev A. 169 Shi G.H Shi Y. 20 Shi Y.F. 932 Shibata T. 931 Shibuya H. 578 Shiga Y. 228 Shigemura K. 663, 940 Shillito S.H. 395 Shim B.S. 512 Shim M. 80, 196, 466, 469, 1005, 1010 Shimamura T. 764 Shimbori M. 228 Shimizu N Shimizu S. 199 Shin T-Y. 177, 810 Shin Y.S. 488 Shinbo H. 998 Shinde S. 65 Shingo Y. 59 Shinno Y. 931 Shinohara N. 931 Shiota M. 765 Shiraishi T. 978 Shiraishi T Shiraishi Y. 764 Shirakawa T. 663, 940 Shiranov K.A. 845 Shirokorad V.I. 954 Shirotake S. 242, 818 Shkalova L. 354 Shoji K. 462 Shoji S. 220, 265, 361, V45, V79 Shoots I. 138 Shore N. 97, 99, 626, 678 Short S. 58 Shuin T. 834 Shukla D. 935 Shun C.T. 234 Sibaev A. 447 Sibony M. 366 Sicuro O. V53 Siddiqui E. 401 Siddons H. 704 Sidoni A. 933 Sieber P. 108 Siegmann A. 192 Siemer S. 74, 338, 1031, V31 Siena G. 93, 817 Siesto G. 726 Sievert K-D. 243, 248, 306, 629, 741, 744, 791, V54, V71 Sighinolfi G.P. 439 Sighinolfi M.C. 439 Signoretti S. 193 Silva C.M. 673, 898 Silva J. 627 Silva P.C. 30, 903 Silva P.C.G.P. 903 Silvani M. 561 Silverman D. 229 Silvestri L. 914 Sim M.Y. 200 Simaioforidis V. 872 Simeone C. 172, 259, 264, 499, 887 Simmons L.A.M. 353 Simmons R. 777 Simmons W. 653 Simon A. 329 Simon R. 138 Simonato A. 340, 770, 817, 1014 Simone G. 480, 881, 1038, V23, V46 Simpfendoerfer T. 222 Sims R. 103 Simón C. V75 Simões M. 29 Indices Numbers refer to abstract numbers EAU Milan

460 Abstract authors Indices Sinescu I. 384 Singh R. 937 Singla M. 418, 421, 424 Sinos P. 548 Sio M.C Siracusano S. 614 Sirls L. 722 Sivaraman A. 299, 1013, V10 Sizonov V.V. 419 Sjoberg D. 754, 814, 815 Sjoberg D. 749, 808, 813, 856 Skolarikos A. 521 Skorucak J. 799 Skowron O. 563 Skradski V. 7, 803 Skrobot S.S. 372 Skvortsov I.Y. 88, 90 Slesarevskaya M.N. 667 Sloan S. 367 Sloff M. 872 Slovak M. 403 Smal M.P. 278 Small E.J. 97 Smith M.R. 97, 99, 108, 674 Smith N. 653 Smith R.A.G. 835 Smith R. 18 Smolski M.J. V57, V66 Snow-Lisy D. 816 Soares F.A. 399 Sobiesiak M. 899 Sodano M. 499 Soebadi D. 252, 908 Soh J. 414 Sohn D.W Sokol R Sokolov A. 667 Sola I. 482 Solanki R. V40 Soler R. 909 Soliman M.G. 214, 420 Solokhina A. 167 Soloviev D. 833 Solovov V.A. 581 Solsona Narbón E. 10, 702, 1007 Somani B. 370, 434, 599 Sommerlad M. 811 Son H. 860 Son J.H Soncin R Song C. 80, 196, 466, 469, 807, 1005, 1010 Song G. 410, 490 Song J.M. 997 Song P.H. 116, 349 Song S.H. 332, 533, 807 Song W. 266, 280, 297, 538 Song Y. 765 Song Y.S. 325 Sønksen J. 122 Sonmezay E. 553 Sonmezoglu K. 479 Sonnenberg J.E. 329 Sonnino S. 146 Sood A. 369, 709, V14 Sooriakumaran P. 912, 916 Sørensen H.T. 675 Soria F. 130 Sorongon M Sorsaburu S Sosnowski R. 990 Sotelo Noguera R. V6, V19, V38, V44 Soto Poveda A.M. 231 Soto Villalva J. V33 Soukup V. 697 Soulié M. 87, 176, 283, 483, 1105 Sountoulides P. 408 Soustelle L. 261 Southgate J. 157 Souza M.J.L. 399 Sow Y. 731 Soygür T. 527, 646, 647 Spahn M. 468, 471, 686, 688, 911, 936 Spaliviero M. 749 Spaltro Ambrosini A. 61 Spangenberg M. 160 Sperandio V. 168 Sphan M. 697 Spiess A. 27, 31 Spilotros M. 662 Spinelli M. 301, 305 Spinillo A. 894 Springer C. 91, 263, 461, 949, V1 Srinivas S Srinivasan V Sriprasad S. 49, 1075, 1081 Srougi M. 650 Stagni S. 83, 388, 397, 398, 1055, 1057 Stakhovsky E. 94 Stakhovskyi O. 94 Staley S. 497 Stanescu F.A. 522, 570 Stanic V Staudacher K. 101 Stavropoulos M. 548 Stefan B. 384 Steffens S. 241, 338, 348 Stegemann A.P. 19, 20, 1031, 1032 Steger K.S. 27, 31, 32, 947 Stein B. 241 Stein K. 981 Stein R. 255, 256, 257, 552, 816, V2, V22 Steineck G. 916 Steiner E. 7 Steiner M.S. 102 Steiner U. 192 Stenzl A. 198, 243, 306, 364, 365, 577, 629, 812, 822, 861, 899, 964, 1022, 1049, 1054, 1062, V54, V59, V71 Stepanova N. 159, 892 Stephan C. 139, 195, 853, 859 Sternal M. 194 Sterner O. 826 Steuber T. 107, 186, 295, 685, 1006, 1018 Stevens D. 267 Stewart F. 523 Stewart G.D. 766, 922 Stewart Iv J. 558 Steyerberg E.W. 139, 217, 850 Stief C.G. 68, 286, 340, 447, 629, 844, 847, 906, 907, 909, 923 Stifelman M. 876 Stillebroer A.B. 336 Stock K. 386 Stöckle M. 74, 192, 338, 703, 774, 828, 1031, 1032, V31 Stoeckigt C. 347 Stoehrer M. 656 Stojakovic T. 347 Stolzenburg J.U. 91, 922, V4, V17 Stone S. 719 Numbers refer to abstract numbers 460 Programme Book

461 Stopak B.L. 327 Storr M. 447 Stow B. 782 Strada G. 769 Stranne J. 120, 808 Strasak A. 644 Straub M. 386, 1067 Strick K. 448, 871 Stringara S. 770 Strittmatter F. 906, 907 Stroelin P. 107 Strohmaier W. 461 Stöhrer M. 636 Stölting M.N.L. 246 Störkel S. 192 Stroy O.O. 507 Struss W. 866 Stubendorff B. 56 Stubinski R. 540 Stucki P. 554 Studer U.E. 330, 555, 1026 Stuiver M.M. 387 Stumm L Stunell H. 952 Stunitz L. V58 Sturch P. V62 Suardi N. 182, 184, 186, 188, 289, 467, 694, 695, 714, 918 Subira D. V44 Subirá J. 232 Sudiana I.K. 908 Süer E. 527, 646 Sugano S. 764 Sugimoto M. 228 Sugimoto M. 503 Sugimura Y. 978 Sugino Y. 66, 1085 Sugishita K. 931 Sugiyama N. 79, 82, 463, 602 Suh Y.S. 266, 280, 297, 538 Suhotnik R. 202 Sukhorukova M. 169 Sukhotnik I. 202 Sukonko O.G. 285, 958 Sukumar S. 119, 158, 260, 369, 497, 526, 534, 625, 657, 659, 915, 1070 Sullivan A. 296 Sullivan J.F. 15 Sulser T. 246, 635, 637 Sultan M. 792 Sumino Y.S. 444 Sumitomo M. 504, 715 Summers D. 475 Sun J. 901 Sun M. 140, 175, 178, 179, 262, 474, 687, 718, 820, 927, 960, 1015 Sun Y. 91, 484 Sundi D. 815 Sung H.H. 280, 538 Sung L.H. 727 Suttmann H. 105, 703 Suzuki E. 333 Suzuki K. 938 Suzuki M. 333 Suzuki S. V68 Suzuki T. 998 Suzuki T. 59 Suzuki Y. 79, 82, 463, 602 Svatek R.S. 754, 815 Svejstrup J. 683 Syed J. 20 Sykes J. 287 Sylvester R. 697, 708 Symons M. 296 Szarvas T. 155, 345 Szendroi A. 774 T Taari K. 274 Tabatabaei S. 634 Tabernero Gómez A. 556, 1036 Taguchi K. 311 Taha D-E. 934 Taimen P. 154 Takada N. 931 Takada S. 998 Takagi T. 821 Takahashi R. 450 Takahashi S. 404, 747 Takahashi S. 603 Takahashi S Takahashi T. 699, 1091 Takai S. 288, 779 Takamoto A. 503 Takashi F. 713 Takata R. 77 Takeda M. 71, 84, 404, 747 Takenaka A. 339, 925, 951 Takeshita H. 950 Tamarelle B. 705 Tammela T.L. 108, 1039 Tamura Y. 603 Tan M.H Tan P.H. 200 Tan W. 51, 58 Tanabe K. 603, 821 Tanagho Y. 876 Tanaka H. 240, 470, 586 Tanaka K. 663, 940 Tanaka N. 456 Tanaka N. 242, 818 Tanaka T. 337, 603 Tanase M. 712 Tanda H. 121 Taneja S. 138 Tang S.Y.W. 142 Tannuri U. 650 Taño F. 229 Tao S. 901 Tao W. 839 Tardito S. 770 Tarrel R. 75 Tasaki S. 574, 827 Tasca A. 319 Tasci A.I. 553 Tatagiba M. 306 Tateishi U Tatemichi S. 446 Tatokoro M. 979 Tatsugami K. 765 Tawfik A.M. 214, 420 Tawfik T.I. 214 Taylor B. 395 Taylor J.M. 749 Taylor R.A. 946 Te A.E. 638 Teelab A.A. 416 Teertstra H.J. 217, 394 Teichman J.M.H Teishima J. 462, 666 Tejedor-Jorge A. 606, 607 Tejido Sánchez A. 773 Tekgul S. 642, 643, 645 Téllez Martínez Fornés M. 730 Tenholte D. 890 Indices Numbers refer to abstract numbers EAU Milan

462 Abstract authors Indices Tennstedt P. 293, 294, 685, 920, 1023 Teo L. 781 Ter Haar R. 706 Terachi T. 21 Terrier N. 563, 564 Terris B. 235 Terrone C. 174, 264, 864, 887 Terui K. 463 Tewari A. 474 Tezval H. 198 Thaler C. 27 Thalgott M. 809 Thalmann G.N. 330, 665, 822, 942, 1026, 1044 Thanigasalam R. 112, 171 Thapa P. 75, 924 Theaker J Theil G Thiagamoorthy G. 910 Thibault F.J.P. 112 Thike A.A. 200 Thiruchelvam N. 990, 1004 Thiry S. 415 Thistlethwaite F Thomas A.Z. 15 Thomas B. 921 Thomas H. 3 Thomas J.S. 47 Thompson C. 741, 744 Thompson H. 75, 151 Thompson P.M. 510, 1076 Thompson R.H. 924, 957 Thomsen F.B. 273 Thong A. 761, 975 Thorpe A. 781 Thuret R. 283 Thüroff J.W. 50, 338, 461 Tian L. 901 Tian Y. 249 Tian Z. 175, 178, 262, 718, 927, 960, 1024 Tiemann A. 286 Tikkinen K.A.O. 910 Tilki D. 286 Tillier C. 291 Tillou X 500 Timberg G. 216 Timilshina N. 270 Timsit M-O. 283 Tiscione D. 459 Titze U. 465 Tjønneland A. 858 Tligui M. 432 Tobe M. 121 Tobisawa Y. 79, 82, 197, 602, 1042 Tobu S.T. 444 Todenhöfer T. 364, 365, 812, 822, 899, 1022, 1049, 1054 Togashi M. 931 Toi A. 270, 988 Toivanen R. 946 Tok A.T. 624 Tokas T. 23 Tokgoz H. 128 Tokui N. 602 Tokunori Y. 713 Tolba R.H. 448, 871 Tollefson M.K. 924 Tomada I. 210 Tomada N. 210 Tombal B. 99, 182, 415, 674, 677, 686, 688, 806, 911 Tomida R. 132 Tominaga M. 71 Tominaga T Tomiyama Y. 446 Tomlinson G.A. 886 Tonghini M Tonooka A. 337 Tonyali S. 645 Torella M. 726 Torelli T. 83, 388, 397, 398, 1055, 1057 Torigoe T. 767 Torsello B. 769 Tosco L. 880 Touijer K.A. 188 Touloupidis S. 423 Townes C.L. 623 Toyonori T. 713 Tozawa K. 311 Trachtenberg J. 270, 588, 988 Tran M. 935 Traverso P. 770 Traxer O. 430, 432, 438, 1067 Treiyer A. V31 Tremblay T. 402 Tremp M. 246 Trenti E. 61 Tretter R. 782 Treurniet K. 287 Trifard F. 171 Trilla E. 768 Trinchieri A Trinh Q-D. 78, 158, 179, 233, 369, 497, 534, 573, 625, 657, 659, 754, 876, 915, 956, 1070 Trock B.J Trojan L. 24, 286, 1019 Trombetta C. 614, 838, V55 Trottier G. 270, 988 Trottmann M. 844, 847 Trunk M Truss M. 340 Tsai Y.C. 26 Tsaur I. 825, 830 Tsiamis C. 41 Tsivian M. 661, 967 Tsuchiya N. 197, 610, 720, 1100, 1104 Tsui K-H. 148 Tsuji H Tsujii T. 572, 819 Tsukamoto T. 337, 603 Tu L.M. 785 Tubaro A. 411, 412, 672, 725, 782, 990, 1014 Tuccio A. 93 Tugcu V. 552, 553 Tuncel A. 615 Turkbey B. 138 Turkeri L. 708 Turner E.L. 135 Turney B Tutolo M. 467, 473, 695, 714, 806, 918 Tutrone Jr. R.F. 626 Tworkiewicz J.T. 869 Tyritzis S Tytgat J. 441 U Uchida K. 121 Uchida T. 265, 361 Uckert S. 127, 329, 331, 904 Ueda T Numbers refer to abstract numbers 462 Programme Book

463 Uemura H. 98, 1108 Uemura M. 943 Ueno M. 242 Ukimura O. 138, 220, 265, 361, 835, V45, V79 Umari P. 838 Umeda K. 228 Unda M. 702 Underwood M.A. 902, 905, 989 Unrein A. 774 Unteregger G. 828 Upadhaya R. 418, 421, 424 Urbach D.R. 886 Urbschat A. 608 Usami M. 311 Uvin P. 252, 441 V Vaegler M. 243, 248, 791 Vaessen C. 170, 171, 176, 261 Vagnoni V. 693, 711 Vaishamayan U.N Valenti M. 698 Valentini M.A. 517 Valeri A. 283 Valerio M. 584, 926 Vallee J-P. 356 Vallier C Valotto C Valta M.P. 761, 975 Van Aarle S Van Ahlen H. 127 Van Bruwaene S. 468 Van Cleynenbreugel B Van Den Bergh L. 360 Van Den Bergh R.C.N. 292 Van Den Bos C.W.L. 889 Van Der Aa F. 252, 324, 326, 327, 1004 Van Der Eeckt K. 697 Van Der Jagt M.F.P. 493 Van Der Keur K.A. 238 Van Der Kwast T. 50, 287, 588, 850, 988 Van Der Meulen E. 677, 678 Van Der Meulen J.H.P. 138, 181, 190, 218, 585, 658 Van Der Poel H.G. 186, 217, 291, 292, 392, 394, 686, 688, 911 Van Erps T. 801 Van Ginkel T. 706 Van Herpen C.M.L. 336 Van Kampen M Van Kerrebroeck P.E.V Van Kuppevelt T.H. 872 Van Leenders G.J.L.H. 217, 850 Van Leeuwen T.G. 594 Van Lin N.J.T. 582 Van Moorselaar R.J.A. 706 Van Muilekom E. 291 Van Poppel H. 14, 97, 108, 182, 188, 360, 806, 1000 Van Praet C. 191 Van Rhijn B.W.G. 50, 394, 697 Van Soest R. 217, 824 Van Velthoven R. 800 Van Weerden W.M. 824 Van Werkhoven E. 392 Vandaele P. V28 Vaos G. 423 Varca V. 817 Vardi Y. 131 Varga G. 631 Varkarakis J. 697 Vasarainen H. 274 Vasdev N. 781 Vashchula V.I. 621 Vasilyev A. 350 Vattovani V. 459 Vaucher L. 926 Vaughan E.D. 854 Vaughan K. 506 Vavallo A. 662 Veeratterapillay R. 781 Veliev E.I. 796 Veltri A. 95 Venetsanos F. 548 Veneziano D. V1, V53 Vennekens R. 441 Vera M. 378 Veran J. 245 Vergho D.C. 863 Vergnolles M. 96 Vergunst H. 582, 700 Verhagen P.C.M.S. 680 Verhasselt-Crinquette M. 237 Verhoest G. 87, 283 Verkerk A.M. 680 Verma R.K. 665 Vermeij M. 54 Verne J. 230 Verplaetse R. 441 Verri C. 698 Verze P. 172, 396, 560, 622, 660, V55 Vianello A. 147, 933 Vicens Vicens T. 113 Vicentini F.C. 525 Vickers A.J. 813, 850, 856 Vieillefond A. 235 Vieweg M. 32 Viganò P. 769 Vignozzi L. 411 Vigués F. V41, V63 Viktrup L Vila A. 639 Vilardell J. 768 Vilaseca Cabo A. 489, 494 Vilaça J. 968 Viliukha A.I. 621 Villa L. 451, 651, 695, 714 Villacampa Aubá F. 773 Villalobos-Gollas M. 973 Villari D. V69 Villavicencio H. 281, 372, 531, 532, V35, V49, V72 Villers A. 138, 220, V28 Vilà M. 768 Vincendeau S. 139, 852, 853 Vincent A.D. 387 Vincenti G. 486 Viney Z. 477 Vint R. 370, 969 Visakorpi T Viset T. 152 Vit V. 631 Vitruk Y. 94 Vittori G. 93, 259, 592 Vjaters E. 680 Voce S. 579 Voets T. 441 Vogt M. 1102, 1106 Voilenko O. 94 Volkmer G. 151 Volkova M.I. 88, 90, 954 Volpe A. 172, 174, 264, 887 Vom Dorp F. 155, 559 Indices Numbers refer to abstract numbers EAU Milan

464 Abstract authors Indices Von Schönfeldt V. 27 Von Verschuer U Voorham H.C. 889 Voorham-Van der Zalm P.J. 889 Vordos D. 716, 753, V15 Vorobyev N.V. V43 Vörös J. 799 Votanopoulos K. 558 Vozdvozhenskiy M.O. 581 Vukalovich P. 94 Vuruskan H. 652 W Wada Y. 982 Wadhwa K. 142 Wagenlehner F.M.E. 160, 619, 712, 897, 947 Wagenpfeil S. 809 Wagner A. 882, V12 Wagner C. V16, V20, V34 Wagner L. 112 Wahlfors T Waidelich R. 907 Walcher U. 549, 656 Wald A Waldert M.J. 991 Waldkirch E.S. 904 Waliszewski P. 712, 947 Walker M. 941 Walker V.C. 902, 905, 989 Wallen E.M Walleser S. 775 Walley A. 910 Walther S. 907 Walton K. 623 Walton T. 576 Waltregny D. 780 Walz J. 186, 1053 Wang C-J. 205 Wang C.X. 247, 972 Wang H. 27, 28, 36, 837 Wang H.Z. 840 Wang J.W. 839 Wang K. 162, 249, 505 Wang L. 91, 814 Wang W. 510 Wang W.L. 840 Wang X. 149, 948, 961, 1061 Wang X.Q. 247 Wang X.K. 840 Wang Y.B. 972 Wang Y. 103 Wang Y.X. 28, 36, 837 Warlé M.C. 493 Warren A. 142, 224, 935 Wasiutyński A. 279 Watanabe H. 228 Watanabe Y. 138 Watkin N. 389 Watkins J Watts S.D. 275 Waxman J. 941 Weber M. 739 Wegener G. 241, 338, 348 Wehrberger C. 992 Weibl P. 345 Weidner W. 27, 31, 32, 160, 707, 712, 897, 947 Weigand K. 382, V50 Weihe E. 62 Wein A. 854 Weir S. 585 Weirich G. 809 Weiss C. 322, 1052 Weissbach L. 822 Weissbach L. 272 Weisstanner C. 665 Weizer A.Z. 78, 573, 1031 Welbourn W. 719 Wendt-Nordahl G. 964 Wenzel O Wenzel P. 293 Werbrouck P. 674 Wernli L. 618 Wese F. 415 West C. 58 Westfall T.D. 440 Wetterauer U. 461, 629 Wetterwald A. 330, 942 Wettstein M.S. 635, 637 Weyne E. 688 Wezel F. 157 Wharton I.P Whelan L. 740 Wicker A. 22 Wickmann U. 774 Wiechno P. 101 Wiegel T. 182, 192, 806 Wieland U.W. 624 Wieland W.F. 225, 282, 286, 944 Wiest R. 665 Wiklund N.P Wiklund P. 912, 916, 1031, 1032 Wilczek E. 279 Wildhagen M. 217, 680 Wilding G. 20 Wilhelm K. 56 Willder J.M. 902, 905, 989 Wille S. 624, 890 Williams J.P. 161, 506 Willich N. 192 Wilson S.K. V71 Wilson T.H. 1031, 1032, 1095 Winkler A. 344 Winkler E. 341 Winkler M. 353 Wirth G.J. 721 Wirth M. 108, 192, 984, 1058 Withington J. 658 Witjes J.A. 12, 153, 577, 697, 700, 755 Witjes W.P.J. 755 Witt J.H. 690, V16, V20, V34 Witzsch U. 696 Wolff M. 62 Wolf-Johnston A. 65 Wöllner J. 70 Wolters M. 656 Wong A. 758 Wong A. 281 Wong D Wong K.A Wong L.M. 270 Wong S. 108 Woo H.H. 634, 638 Wood C. 576 Wood I.R.G. 38, 45, 1077 Wood L Woods M. 1031, 1032 Wooten A. 704 Wrobel B.M. 89 Wu C.T. 335 Wu F.C.W. 211 Wu G. 149, 948, 961, 1061 Wu T. 249 Wu W-J. 205 Wu W. 320 Numbers refer to abstract numbers 464 Programme Book

465 Wu Y.N. 335 Wu Y. 948, 961, 1061 Wunderlich H. 194 Wüthrich P.Y Wyler S. 167, 618 X Xambre L. 895 Xiao C. 320 Xiao R. 948, 961, 1061 Xiao-Dong J. 555 Xie D. 724 Xie W Xie X-J. 114 Xu C. 484 Xu H. 149 Xu J. 9, 901 Xu N. 972 Xue B.X. 839 Xue Y. 149, 948, 961, 1061 Xylinas E. 78, 87, 151, 156, 276, 474, 573, 576, 701, 752, 754, 813, 814, 815, 929, 1105 Y Yacoub M. 763 Yadav A Yae K. 60 Yagisawa T. 492 Yakar D. 582 Yakupoglu Y.K. 117, 163, 381 Yakushiji H. 199 Yamada A. 98 Yamada Y. 504 Yamaguchi K. 33, 35, 842 Yamaguchi O. 446 Yamamichi F. 663, 940 Yamamoto H. 79, 82, 463, 602, 1042 Yamamoto H. 132 Yamamoto R. 228 Yamamoto T. 779 Yamamoto Y Yamanaka M. 132 Yamasaki T. 52, 772 Yamashita T. 931 Yan Y.J. 932 Yang C-W. 784 Yang D.Y. 213 Yang H. 27, 36, 837 Yang J. 149, 961, 1061 Yang L. 162, 505 Yang S.C. 177 Yang S.S-D Yang W. J. 325 Yao A. 339, 925, 951 Yao M Yao Q.Y 839 Yap S.A. 886 Yapanoglu T. 616 Yassin A. 207 Yassin D.J. 207 Yasuhito F. 713 Yasui T. 311 Yasushi Y. 713 Yates D. 576 Yates-Bell A.J 1076 Yatsyna O. 94 Ye D.W Ye Z. 108 Yegnasubramanian S. 943 Yeh H-C. 205 Yeo J.K. 209, 544 Yildiz M. 615 Yilmaz A.F. 163 Yin C.J. 878 Yiou R. 753 Yokomizo A. 765 Yokoyama H. 228 Yokoyama M. 470, 578, 586, 756 Yokoyama T. 199 Yones S. 792 Yonese J. 572, 819 Yoneyama T. 79, 82, 197, 463, 602, 613, 720, 1042 Yoneyama T. 79, 82, 197, 602, 1042 Yoo C. 213, 786 Yoo D. 80, 196, 466, 469 Yoo E.S. 253, 428 Yoo G.H. 435 Yoo T.K. 519 Yoon C.Y. 955, 994 Yoon H. 512 Yoon J. 551, V47 Yoon J.H. 691, 771 Yoon S.J. 974 Yoshida K. 821 Yoshida K. 764 Yoshida M. 404, 747 Yoshida S. 442 Yoshida S. 240, 470, 578, 586, 756, 979 Yoshida T. 676 Yoshihide H. 59 Yoshihisa M. 713 Yoshimura K. 98, 1108 Yoshimura K. 66, 1085 Yoshimura N.Y. 444 Yoshino H. 52, 772 Yoshino Y. 288, 779 Yoshioka K. 228 You D. 478, 771, 807, 1097 Young J.G. 316 Young S.R. 761 Young S.T. 91 Youssef S. 966 Yu H. 193 Yu H.S. 464 Yu J.H. 727 Yuan Y. 948, 961, 1061 Yuasa T Yue X. 249 Yuge K. 959 Yuh B Yun J.H. 325 Yutaka T. 931 Yutkin V Z Zacharakis E. 129 Zacharias M. 286 Zacharis A. 984 Zacharowski K. 608 Zagaynova E. 354 Zahran M.H. 934, 1069 Zaidi S.Z. 530 Zakouji H. 84 Zaman F. 654, 963 Zambudio Carmona G. 422 Zampa V Zang W. 250 Zani D. 592 Zanni G. 694, 748 Zanollo L. 301, 305 Zantl N. 565 Zappala M.S. 854 Zaramella S. 259 Zastrow S. 340, 984 Indices Numbers refer to abstract numbers EAU Milan

466 Abstract authors Indices Zattoni F. 357 Zattoni F. 357, 887, 1017 Zát'ura F. 353 Zeeck K. 882 Zeegers M.P.A. 239 Zegna L. 174 Zehnder P. 330 Zeier M. 341 Zellweger T. 945 Zeman F. 944 Zembutsu H. 77 Zennami K. 504 Zepeda S Zequi S.C. 399, 557 Zerbetto F. 183, 184, 185 Zerbib M. 78, 87, 141, 151, 170, 235, 276, 283, 573, 701, 754, 814 Zettl H. 195 Zeybek D. 643 Zhang G. 149, 948, 961, 1061 Zhang H.F. 972 Zhang H.L Zhang H. 9 Zhang L. 9 Zhang T. 36 Zhang Z. 484 Zhao C. 488 Zhao H. 761, 975 Zhao Z. 320 Zharkikh A.V. 667 Zheng S. 901 Zhong P. 653 Zhong W. 320 Zhou J. 741, 744 Zhou Y. 99 Zhu J.Z 839 Zhu X. 5 Zhuang D. 156 Zidan E.M. 934 Zigeuner R. 340, 347, 575, 576, 601, 813 Zimmermann M. 635, 637 Zimmermann R.P. 884 Zimmermanns V. 373, 962 Zimmern P. 114, 168, 722, 732 Zimpfer A. 195 Zini L. 170, 171, 176 Zinke J. V34 Zipeto M.A. 769 Zitzmann M. 207 Ziypak T. 417, 616 Zlobec I Zlotta A.R. 270, 588 Zobel B.B. 580 Zorn K.C. 638 Zou W. 605 Zou X. 149, 948, 961, 1061 Zouari M. 520 Zraik I. 448 Zucchi A. 561, 729, 933 Zugor V. 690, V16 Zuiverloon T.C.M. 238 Zuluaga Gomez A. 312 Zumbé J. 629 Zuo L. 311 Zwarthoff E.C. 54, 238 Zygmunt P. 651 Numbers refer to abstract numbers 466 Programme Book

467 Abstract sorted by Topic Adrenals 25, 26, 461, 462, 463, V31, V53, V61 BPH Basic research 250, 411, 451, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 910, 995 Evaluation 72, 407, 412, 519, 633, 988, 989, 990, 991, 992, 993, 994, 996, 997, 998, 1087 Intervention therapy 516, 520, 521, 522, 523, 524, 525, 627, 628, 629, 630, 631, 632, 634, 635, 636, 637, 638, 1096 Medical therapy 68, 404, 408, 409, 410, 514, 515, 517, 518, 626, 742, 909, 1085, 1086, 1088, 1089, 1090, 1091, 1092, 1093, 1094, 1095 Female urology Basic research 109, 110, 243, 244, 245, 252, 672, 723, 725, 889, 890, 891 Diagnosis 673, 722, 735, 888 Treatment 111, 112, 113, 114, 115, 116, 119, 246, 666, 667, 724, 726, 727, 728, 729, 730, 731, 732, 733, 734, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 893, 894, 895, 896, 897, 898, V28, V75 History of urology 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 1073, 1074, 1075, 1076, 1077, 1078, 1079, 1080, 1081, 1082, 1083, 1084 Infectious diseases 158, 159, 160, 161, 162, 163, 165, 166, 167, 168, 169, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 644, 663, 891 Infertility 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, V52 Kidney transplantation Basic research 491, 602, 603, 604, 605, 606, 607, 608, 609 Clinical 117, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 489, 490, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 610, 611, 612, 613, V3, V49, V50 Male incontinence 999, 1000, 1001, 1002, 1003, 1004, 1005, 1006, 1007, 1008, 1009, 1010 Neuro-urology Basic research 62, 63, 64, 65, 66, 67, 69, 70, 71, 251, 253 Diagnosis and treatment 300, 301, 302, 303, 304, 305, 306, 307, 308, 310, 401, 402, 403, 405, 406, 665, V32, V51, V65, V73 Non-neurogenic voiding dysfunction Basic research 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 664, 671 Diagnosis and treatment 668, 669, 670, 736, 737, 738, 739, 740, 741, 743, 744, 746, 747 Paediatrics 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 639, 640, 641, 642, 643, 645, 646, 647, 648, 649, 650 Penis/testis Penile disorders (excluding urethra) 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399 Testis tumours 400, 1051, 1052, 1053, 1054, 1055, 1056, 1057, 1058, 1059, 1060 Prostate cancer Cell biology 935, 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 1043 Novel biomarkers 1039, 1040, 1041, 1042, 1044, 1045, 1046, 1047, 1048, 1049, 1050 Basic research: Novel therapies 191, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835 Imaging and new techniques 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 361, 582, 587, 588, 589, 696, 861, V14, V17, V77, V79 Management of metastatic disease 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 188, 674, 676, 677, 678, 679, 680, 681, 682, Management of non-metastatic disease: Active surveillance 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275 Management of non-metastatic disease: Focal therapy 192, 578, 579, 580, 581, 583, 584, 585, 586, 675 Management of non-metastatic disease: Radical non surgical treatment 181, 182, 183, 184, 185, 190, 683, 684, 806, 807 Management of non-metastatic disease: Radical surgical treatment 180, 186, 187, 189, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 685, 686, 687, 688, 689, Indices Numbers refer to abstract numbers EAU Milan

468 Abstract sorted by Topic Indices 690, 691, 692, 693, 694, 695, 799, 800, 801, 802, 803, 804, 805, 808, 809, 810, 911, 912, 913, 914, 915, 916, 917, 918, 919, 920, 921, 922, 1011, 1012, 1013, 1014, 1015, 1016, 1017, 1018, 1019, 1020, 1021, 1022, 1023, 1024, V10, V11, V13, V15, V16, V7 Pathology and biopsies 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, V62 PSA and related markers 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860 Screening/diagnosis: Diagnosis 3, 133, 135, 136, 137, 138, 139, 140, 141, 142, 143, 474 Screening/diagnosis: Screening 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12, 721 Staging 360, 465, 466, 467, 468, 469, 470, 471, 472, 473, 475, 476 Renal tumours Basic research 193, 194, 195, 196, 197, 198, 199, 200, 202, 203, 204, 339, 343, 761, 762, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 884, 975, 976, 977, 978, 979, 980, 981, 982, 983, 984, 985, 986, V2 Diagnosis 336, 337, 338, 340, 341, 342, 344, 345, 346, 347, 348, 349, 763 Medical treatment 1097, 1098, 1099, 1100, 1101, 1102, 1103, 1104, 1105, 1106, 1107, 1108 Non surgical treatment 95, 174, 175 Surgical treatment: Non organ sparing 452, 453, 454, 455, 456, 458, 459, 460, 948, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, V4, V41, V42, V44, V5, V63 Surgical treatment: Organ sparing 452, 453, 454, 455, 456, 458, 459, 460, 948, 950, 951, 952, 953, 954, 955, 956, 957, 958, 959, 960, V4, V41, V42, V44, V5, V63, 883, 885, 886, 887, V1, V18, V19, V20, V21, V22, V23, V24, V25, V43, V45, V46, V47, V48, V78 Sexual dysfunction Basic research 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335 Diagnosis and treatment 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, V71 Stones ESWL 538, 539, 540, 541, 542, 543, 544, 652 Medical/research 311, 312, 313, 314, 315, 316, 317, 318, 321, 436, 437, 438, 439, 550, 651, 653, 655, 657, 661 Open and percutaneous 320, 322, 323, 545, 546, 547, 548, 549, 551, 654, 656, 658, 659, 962, 963, 964, 966, 967, 968, 969, 970, 971, 972, 973, 974, V35, V36, V39, V40 Upper tract benign disease 961, 1061, 1069, 1070, V34 Ureteroscopy 319, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 660, 1062, 1063, 1064, 1066, 1067, 1068, 1071, 1072, V37 Trauma 464, 562, 563, 564, 565, 662, 949, V66 Unclassified and miscellaneous research 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, V12, V30, V33, V38, V60, V67 Urethral strictures 247, 248, 787, 788, 790, 791, 792, 793, 794, 795, 796, 797, 798 Uro-genital reconstruction 249, 425, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 862, 863, 864, 865, 866, 867, 868, 869, 870, 871, 872, 873, 874, 1026, V54, V55, V56, V57, V68, V69, V70, V74, V76 Numbers refer to abstract numbers 468 Programme Book

469 Urothelial tumours Basic research 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157 Diagnosis 229, 230, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 282, 287, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 479, 572, 574, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 759 Management of infiltrative/advanced tumours: Non surgical management 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 Management of infiltrative/advanced tumours: Surgical management 24, 753, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 923, 924, 925, 926, 927, 928, 929, 930, 931, 932, 933, 934, 1025, 1027, 1028, 1029, 1030, 1031, 1032, 1033, 1034, 1035, 1036, 1037, 1038, V26, V27, V29, V58, V6, V64, V72, V8, V9 Management of superficial tumours 231, 487, 488, 566, 567, 568, 569, 570, 571, 575, 577, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 748, 749, 750, 751, 752, 754, 755, 756, 757, 758, 760, V59 Staging 276, 277, 278, 279, 280, 281, 283, 284, 285, 286, 477, 478, 480, 481, 482, 483, 484, 485, 486, 573, 576 Indices Numbers refer to abstract numbers EAU Milan

470 Sessions sorted by Topic Andrology 71, 82, 83, 95, 106, 107, 117, 118, 132, 133, 157, 158, 233, 256, 257, 271, 317, 325, 352, 408 Bladder cancer 59, 61, 63, 67, 70, 108, 121, 122, 136, 137, 149, 150, 165, 166, 177, 178, 196, 197, 215, 216, 264, 285, 286, 303, 304, 340, 354, 400, 406 BPH 202, 203, 221, 222, 235, 280, 281, 295, 296, 312, 313, 365, 400, 403, 404, 407, 415, 416 Functional urology 61, 65, 67, 68, 76, 87, 88, 95, 99, 100, 116, 138, 139, 143, 153, 154, 183, 184, 189, 190, 227, 228, 233, 234, 235, 243, 244, 245, 246, 251, 252, 261, 278, 279, 297, 298, 317, 322, 326, 334, 345, 347, 369, 370, 409, 410, 411, 418, 419 History 84, 112, 311 Renal tumours 63, 66, 68, 91, 92, 108, 109, 125, 126, 130, 131, 140, 141, 146, 159, 160, 161, 168, 169, 191, 192, 212, 217, 218, 249, 250, 255, 258, 259, 264, 276, 277, 289, 290, 293, 294, 314, 315, 317, 327, 337, 342, 372, 397, 398, 399 Robotic surgery 65, 93, 96, 146, 172, 173, 174, 254, 342, 356, 357, 368 Stones 60, 67, 102, 144, 145, 155, 156, 187, 188, 193, 206, 207, 225, 226, 233, 291, 292, 309, 310, 317, 329, 330, 350, 353, 371, 400 Trauma 208, 209, 317, 366 Urothelial tumours 85, 86, 89, 90, 143, 144, 210, 211, 239, 240, 247, 248, 258, 259, 267, 268, 317, 361 Indices Infections 95, 106, 123, 124, 200, 201, 219, 220, 260, 405, 414 Kidney transplantation 104, 105, 179, 180, 190, 191, 263, 317, 328 Paediatric urology 69, 76, 95, 171, 185, 186, 204, 205, 223, 224, 317, 360 Penis/testis 181, 182, 307, 308, 317, 339 Prostate cancer 53, 54, 55, 57, 60, 61, 63, 65, 67, 78, 95, 108, 114, 115, 119, 120, 127, 128, 129, 134, 135, 143, 147, 148, 151, 152, 164, 167, 175, 176, 194, 195, 200, 201, 213, 214, 229, 230, 233, 237, 238, 241, 242, 258, 259, 264, 265, 266, 269, 270, 272, 273, 283, 284, 287, 288, 301, 302, 305, 306, 317, 318, 319, 321, 323, 324, 348, 356, 357, 358, 359, 363, 364, 367, 401, 402, 412, 413, 417, 420, 421 Reconstructive urology 56, 61, 110, 111, 143, 208, 209, 274, 275, 282, 317 Numbers refer to page numbers 470 Programme Book

471 List of Speakers (not abstracts) A Abbou C-C., 70, 72, 80, 96 Abol-Enein H., 63, 303, 366 Abrahamsson P-A., 72, 75, 319 Abrams P., 183, 233, 334, 410 Ahallal Y., 70 Ahmed H.U., 213 Aho T., 407 Ahyai S., 111 Al-Hayek S., 93 Al Naimi A., 63 Al Nono I.H., 63 Albers P., 236, 258, 339 Alcaraz A., 97, 340, 400 Algaba F., 109, 335 Alici B.M., 110 Alivizatos G.J., 390 Andersson K-E., 138 Andrich D.E., 110, 111 Andriole G., 53, 404 Annerstedt C.M., 97, 254 Anson K.M., 365 Artibani W., 61, 68, 76, 96, 99, 254, 356 Atallah K., 70 Aulitzky W., 271, 352 Ayati M., 61 Azzouzi A.R., 417 B Babjuk M., 210, 354 Bach T., 102, 144 Bachmann A., 97, 280, 375, 390 Bader P., 262 Bahl A., 401 Barber N., 390 Bardan R.T., 379 Barret E., 191, 417 Bartoletti R., 106, 415 Basiri A., 61 Bassi P.F., 405 Bastian P., 136 Bauer R., 100, 297 Baumert H., 140, 329 Beerlage H.P., 113, 331 Bellmunt J., 57, 89, 421 Bergstrom R., 419 Bettocchi C., 106 Bex A., 108, 337 Birkhäuser F., 293 Birowo P., 71 Bjartell A., 258 Bjerklund Johansen T.E., 106, 260, 299, 365 Black P., 196 Bogaert G.A., 223, 360 Borkowski T.A., 114 Bossi A., 128, 318, 348 Boström P.J., 72, 121 Botto H., 416 Brausi M., 108, 143, 170, 285, 299, 406 Brawley O.W., 54 Breda A., 96, 163, 198, 353, 386 Brehmer M., 94, 377 Briganti A., 61, 317 Brown P., 53, 55 Bryan R., 136 Buchholz N.N-P., 102, 193, 353, 377 Bucuras V., 96, 291, 393 Budde K., 399 Buffi N.M., 383 Bulbul M., 63 Burchardt M., 97, 283, 381 Burger M., 165, 215, 406 Burgos Revilla F.J., 104, 263, 328 Burke D., 264 Burkhard F.C., 261, 317, 345 C Camignani L., 97 Campos Pinheiro L.M., 147 Capitan Manjon C.M., 373 Carbone A., 146 Carey B.M., 100, 175 Carl S., 390 Castro-Diaz D., 99 Cathelineau X., 338 Catto J.W.F., 165, 317, 343 Çek H.M., 219 Celia A., 212 Cervigni M., 405 Cestari A., 96, 159, 254 Chapple C.R., 56, 67, 234, 322, 410 Cheon J., 57 Chiti A., 167 Chkhotua A.B., 104, 217 Chlosta P., 233, 380 Chrisofos M., 123 Chung B.H., 57 Chung M.K., 57 Clarke N.W., 65, 108, 339, 402 Coelho Nunes P.T., 104 Compérat E., 335 Congregado Ruiz C.B., 194 Cornel E.B., 93 Costa C.S.R., 157 Costantini E., 326 Cowan N., 259 Cresswell J., 379 Crouzet S., 272 Cruz C.D., 189 Cruz F.R., 67, 76, 99, 370, 409, 418 Culig Z., 53, 108, 164, 299 Curigliano G., 412 Cuzick J., 53, 318 Cuzin B., 132 Cynk M., 407 D Dahlem R., 111 Damiano R., 405 Dasgupta P., 97, 356 De Gennaro M., 204 De Jong I.J., 127, 420 De La Morena Gallego J.M., 159 De La Rosette J.M.C.H., 97, 102, 327, 403 De La Taille A., 255, 393, 415 De Reijke T.M., 147, 420 De Ridder D.J.M.K., 65, 76, 99, 326 De Santis M., 114, 258, 413 Deger S., 110, 299 Del Popolo G., 261 Demirkesen O., 110 Desai M.R., 59, 144, 225 Di Stasi S.M., 406 Di Tonno P., 104 Dinis Oliveira P., 251 Dirix P., 63 Dixon P., 419 Djavan B., 61, 109, 167, 305, 348 Djinovic R.P., 110 Dohle G.R., 107 Dore B., 309 Doumerc N.D., 383 Drake M.J., 95, 245, 370, 385, 419 Indices Numbers refer to page numbers EAU Milan

472 List of Speakers (not abstracts) Indices Dreikorn K., 104 Drewa T.A., 274 Duran I., 398 Dybowski B.A., 183 E Eardley I., 236, 256, 325, 408 Eberli D., 138, 171 Eeles R.A., 53 Egawa S., 181 Eisenberger M., 412 El Halaby M.R., 63 Elliott R., 419 Elneil S., 333 Emami M., 61 Emberton M., 318, 404 Erdogru T., 97 Escudier B., 108 Esen T., 59, 93, 202 Everaert K., 262 F Fajkovic H., 93 Farag F., 100 Feitz W.F.J., 171, 317 Ferreira Coelho M.X., 99 Ficarra V., 415 Figueiredo A.J., 104, 263, 299, 311, 328 Finazzi Agro E., 405 Fisch M.M., 110, 369 Fitzpatrick J.M., 401 Fode M., 95, 233 Ford L., 54 Fournier G.H., 373 Frede T., 96 Fritsche H-M., 102 Fulgham P., 161 Furriel F., 93 Fusco F., 107 G Gaboardi F., 382 Gambaro G., 102 Gangi A., 57 Ganzer R., 151 Garmanova T.N., 94 Geavlete B., 400 Geavlete P.A., 99, 193, 300, 377 Giannantoni A., 227 Giessing M., 104, 198, 263 Gill I.S., 168, 255 Gillessen S., 397 Giuliano F., 71, 403 Giusti G., 96, 291, 386 Godoy G., 93 Goh A., 172 Gomez V., 105 Gomez Dos Santos V., 116 Gomez Sancha F., 388 Gómez Veiga F., 241 Gontero P., 89, 327 Gordon G., 55 Gözen A.S., 381 Grabe M., 69, 106, 123, 260 Graefen M., 172, 254, 301 Grasso M., 350 Gratzke C., 243, 343, 373, 388, 410 Graziottin A., 408 Greco F., 196 Gross A.J., 378 Gruenwald I., 117 Gschwend J.E., 347, 413 Guazzoni G., 96, 342 Guillonneau B., 380 Gutierrez J., 67 H Haab F., 76, 116, 410 Hachi K., 70 Haese A., 254, 272 Hakenberg O.W., 285, 324 Halaska M., 99 Hamdy F.C., 55, 143, 318, 321, 416 Hamid R., 100 Hammerer P., 367, 412 Han S.W., 57, 185 Hanus T., 251 Hariharan P., 59 Hashim H., 143, 245, 385 Hatzichristou D.G., 408 Hatzimouratidis K., 132 Hatzinger M., 112 Heesakkers J.P.F.A., 67, 99, 299 Heidenreich A., 265, 317, 402 Heinz-Peer G., 259 Hendricksen K., 94 Herrmann T.R.W., 372, 392 Hess B., 102 Heynemann H., 100 Hoebeke P., 111 Holmberg L., 53 Hong S.J., 57 Hood C., 413 Hosseini S.J., 61, 253 Hoznek A., 96, 387 Hruby S., 93 Huang J., 267 Hubert J., 342 Hudson T., 319 Hugosson J.E., 78, 318 I Illic D., 54 Irani J., 177 Iversen P., 318 J Jacqmin D., 57 Janetschek G., 68, 98, 317, 329 Jankevicius F., 249 Jannini E.A., 107 Jardin A., 84 Jenster G., 287 Jewett M., 168, 318 Joniau S.G., 274, 322 Joual A., 70 Joyce A.D., 338, 377 Junker K., 249 Jünemann K.P., 409, 418 K Kadioglu A., 107 Kahlmeter G., 260 Kalogeropoulos T., 382 Kaouk J.H., 172, 372 Karam G., 105, 179 Karsenty G., 409, 418 Keeley F., 102, 327, 377 Kekre N., 59 Kessler T.M., 100, 234 Key T., 54 Khauli R.B., 63 Kim C., 58 Kim D.K., 57 Kim S.D., 174 Kirby M., 77 Numbers refer to page numbers 472 Programme Book

473 Klatte T., 293 Kleinclauss F., 104 Klingler H-C., 68, 276 Knoll T., 96, 102, 145, 371, 387 Knowles M., 85 Kocjancic E., 326 Kok D.J., 102 Kopa Z., 82 Kristiansen G., 164 Kuczyk M., 168, 337, 397 Kuntz R.M., 365, 407 Kwon D.D., 57 L Lackgren G., 76, 185 Laguna M.P., 91, 97, 143 Lahme S., 102 Langsteger W., 167 Lapini A., 97, 393 Larré S., 59, 93 Lebret T., 70 Lepor H., 416 Leung H.Y., 287 Liatsikos E., 96, 151, 371, 380 Liedberg F., 267 Lilja H.G., 53 Ljungberg B., 161 Lledo García E., 104, 217 Llorente C., 69, 253 Loch T., 99, 161 Lopez Pereira P., 261 Lopez-Beltran A., 108 Lopez-Tello Garcia J.J., 208 Loriot Y., 70 Lumen N., 111 Lund L., 94 M Macek P., 134, 382 Machtens S., 358 Madersbacher S., 221, 334 Malavaud B., 97, 213, 340, 400 Malmström P-U., 149 Manzoni G.A., 171 Marberger M., 54, 68, 94, 235, 404 Martinez Bustamante L.G., 93 Martov A.G., 378 Martínez Piñeiro L., 299, 317, 366, 412 Matikainen M.P., 134 Mattelaer J., 112, 311 Matveev V., 215 McClinton S., 206 Medina López R., 264 Mejean A., 398 Merseburger A.S., 128, 233, 258 Messas A., 300 Messelink E.J., 262 Meuleman E.J.H., 107 Meyskens F., 54 Meyyappan R., 59 Michel M.S., 97, 170, 317 Micic S., 271 Mickisch G., 323 Miller K., 323, 421 Millán-Rodríguez F., 353 Milsom I., 410 Minasian L., 54 Minervini A., 381 Mirone V., 71, 94, 299, 404 Monagas Arteaga S.M., 95 Monastyrskaya K., 227 Moncada I., 110, 408 Mondaini N., 200 Monnet D., 106 Montironi R., 109 Montorsi F., 72, 143, 172, 343, 416 Morsy A., 63 Mottet N., 401 Mottrie A., 65, 93, 96, 172, 255, 265, 299, 342 Moudouni S.M., 63, 70 Msessa N., 63 Muir G., 389 Mulders P.F.A., 130, 168, 413 Müller S., 94 Mundy A.R., 76, 110 Muneer A., 256 Muschter R., 96, 378 Musquera Felip M., 179, 263 N Naber K.G., 106, 414 Nagele U., 379 Nicolai N., 307 Nijman J.M., 360 Nitti V.W., 153 Noon A., 239 Nouira Y., 63 Novara G., 295, 343, 416 Nyirády P.J., 91 N Dow J.M.O., 57, 69 O Oedekoven T., 95 Oehlschläger S., 102, 155 Oelke M., 202, 234, 411 Olsburgh J.D., 263 Osanto S., 337 Osman Y.M., 149 Osther P.J., 96, 102, 144, 299, 350, 387 Oudard S., 401 Özen H.A., 109 O Brien T.S., 143, 177 P Paez Borda A., 262 Palma P., 67, 417 Palminteri E., 62, 110 Palou J., 67, 94, 144, 354 Pansadoro V., 110, 331 Park D.S., 295 Parker C., 53, 55, 167, 413 Parnes H., 54 Parsons K.F., 94, 161, 317 Patard J.J., 125 Patel A., 59, 353 Patel N.S., 383 Peri Cusi L., 282 Perner S., 53 Peschers U., 76 Petri E., 99 Pfitzenmaier J., 97 Piaserico S., 105 Pickard R.S., 106, 219 Piechaud P.T., 97, 146, 356 Pignot G.A.N., 282 Porpiglia F., 97, 276, 329, 380 Porst H., 403 Porta C., 397 Porter J., 173 Powles T., 398 Pummer K., 323 Pushkar D., 345, 407 Indices Numbers refer to page numbers EAU Milan

474 List of Speakers (not abstracts) Indices R Rabah D., 63 Rabenalt R., 113, 382 Radziszewski P., 100, 233, 261 Ralph D., 106, 325 Ramirez Backhaus M., 237 Ramon J., 289 Rane A., 372 Rassweiler J., 67, 72, 96, 102, 170, 225, 299, 368, 417 Rehder P., 234, 297 Reich O., 56, 375 Reinhardt S., 95 Reis Santos J.M., 102 Reisman Y., 117 Reitz A., 153 Rengifo Abbad D., 125 Rennert G., 54 Ribal M.J., 97, 212, 381, 415 Rischmann P., 378 Rittenhouse H., 53 Rix G., 407 Rocco B., 283 Rodrigues de Lima E.A., 187 Rodriguez Faba O., 104 Roehrborn C.G., 312 Romdam T., 71 Roobol M.J., 78 Rosier P.F.W.M., 99 Rothwell P., 54 Rouprêt M., 144, 239, 361 Ruf C.G.A., 95 S Sa Y.L., 56 Saglam R., 97 Salomon G., 100 Salomon L., 263 Salonia A., 256 Salvioni R., 181 Sanadizadeh S.M., 61 Sanchez Salas R.E., 255, 301 Sanchez-Carbayo M., 121, 165 Sanguedolce F., 94 Santer F.R., 269 Sarica K., 102 Scattoni V., 241, 367 Schalken J.A., 53, 402 Schilling D.A., 170 Schips L., 172 Schlomm T., 172 Schmid H-P., 55, 194 Schmitz-Dräger B.J., 55 Schröder F.H., 53, 55, 59 Schulman C.C., 71 Schultheiss D., 84, 112 Schwentner C., 380 Schöffski P., 398 Schön G., 173 Scoffone C.M., 102, 144, 371, 392 Sedelaar J.P.M., 59, 93, 358 Seo S.I., 57 Seong D-H., 58 Serra A.L., 399 Shakeri S., 61 Shariat S.F., 70, 143, 247, 343, 361 Shenfeld O.Z., 110 Siener R., 102 Sievert K-D., 97, 111, 234, 278, 392, 419 Silay M.S., 95 Siracusano S., 100 Skolarikos A., 97, 102, 144, 170, 386 Smith R., 55 Sochaj M., 93 Soebadi D.M., 71 Sofikitis N., 71, 106 Solsona E., 303, 417 Sonksen J.O.R., 95, 256, 317 Sosnowski R., 247 Speakman M.J., 234, 312, 410 Spinelli M., 409, 418 Sridhar F., 59 Srivastava A., 59 Staehler M., 399 Stein R., 171 Stenzl A., 53, 55, 317, 347 Sternberg C.N., 402 Stief C., 325, 417 Stöckle M., 163 Stolzenburg J-U., 96, 363, 400 Straub M., 102 Studer U.E., 67, 73, 347 Subramaniam R., 171 Sugandi S., 71 Sulser T., 155 Sültmann H., 164 Sun Y-H., 318 Sung G.T., 57 Swiniarski P.P., 94 Sylvester R.J., 108, 343 T Tailly G.G., 378 Tammela T.L.J., 318 Tandogdu Z., 93, 106 Tasca A., 309 Tchanturaia Z., 68, 204 Teber D., 379 Tekgül S., 223, 360 Tenke P., 106, 414 Terrone C., 104 Thalmann G.N., 69, 255, 305 Theodorescu D., 85, 108 Thomas J.A., 373 Thompson A., 412 Thüroff J.W., 70, 234 Thüroff S.F.M., 358 Tikkinen K.A.O., 161 Tiselius H.G., 102, 206 Tomaskin R., 405 Tombal B., 54, 57, 108, 317, 397 Touijer K., 363 Traxer O., 56, 95, 143, 187, 350, 400 Trinchieri A., 102 Trombetta C., 99 Tubaro A., 87, 97 Tunc L., 96, 379 Turgut A., 259 Türkeri L.N., 95, 229 U Uvelius B., 87 V Vaessen C., 173 Vallancien G., 63 Van Cleynenbreugel B.S.E.P., 93, 381 Van Der Aa F.A., 369 Van Der Heijden A.G., 93 Van Der Kwast T., 108 Van Der Poel H.G., 80, 172, 343, 383, 417 Van Kerrebroeck P.E., 411 Van Koeveringe G., 189 Van Moorselaar R.J.A., 127, 348 Numbers refer to page numbers 474 Programme Book

475 Van Poppel H., 65, 94, 317, 324 Van Renterghem K.M.L., 221 Van Rhijn B., 210 Van Velthoven R.F., 98, 170, 174, 368 Vasquez J.L., 94 Vavassori I., 407 Villavicencio Mavrich H., 67 Villeirs G., 109 Visakorpi T., 164, 269 Volpe A., 59, 109, 163 Vuksanovic A., 191 W Wagenlehner F.M.E., 95, 106, 200, 260, 414 Wagg A., 76, 278 Waltregny D.A.O., 243 Walz J., 99, 175, 299 Watson R.W.G., 280 Weidner W.H.G., 82, 106, 352 Wein A.J., 411 Weiss J., 411 Wespes E., 107, 157 Wiegel T., 237, 420 Wijkstra H., 100 Wiklund P., 96, 163, 172, 254, 318, 368 Williams J.C., 102 Wilt T.J., 53 Wirth M., 59, 63, 75, 167, 233, 318 Witjes J.A., 165, 354, 406 Witt J.H., 384 Wolk A., 54 Woo H., 97 Wood D.N., 208 Wullt B., 414 Wyndaele J.J., 333 Indices X Xie L-P., 56 Z Zastrow S., 130 Zeng G-H., 56 Zhivov A., 110 Zigeuner R.E., 144, 289 Zlotta A.R., 307, 321 Zonnenberg B., 399 Numbers refer to page numbers EAU Milan

476