11/21/2009. Erlotinib in KRAS Mt patients. Bevacizumab in Squamous patients

Transcription

1 Decision-Making in Non-Small Cell Lung Cancer (NSCLC): Moving from Empiric to Personalized & Molecular-based Therapy David R. Gandara, MD University of California Davis Cancer Center Disclosures Research Grants: Abbott, BMS/ImClone, Genentech, Lilly, Merck, Novartis, Pfizer Consultant: Amgen, AstraZeneca, Biodesix, Boehringer-Ingelheim, BMS/ImClone, GlaxoSmithKline, Genentech, Lilly, Merck, Novartis, Pfizer, Sanofi-Aventis Board of Directors: Response Genetics Non-Profits: ASCO, IASLC, ESMO, NCI, Addario Foundation Selection of Therapy for NSCLC Patients: Empiric versus Molecular-Based Empiric: current standard, takes into consideration patient characteristics and physician experience Molecular-Based: based on tumor molecular profile or host genetic makeup

2 65 y/o male Smoker Squamous KRAS Mt Low ERCC1 High RRM1 Hypothesis: Personalizing Therapy for Cancer Patients Will Improve Overall Care Patients with the same Diagnosis &Clinical Features (Stage IV Non-small Cell Lung Cancer) 39 y/o female Never-Smoker Adenoca EGFR Mt High ERCC1 Low RRM1 Personalizing Patient Therapy in NSCLC Patients with Stage IV NSCLC Erlotinib in KRAS Mt patients Bevacizumab in Squamous patients Alternate therapy predicted predicted non-responders & toxic responders Standard therapy for Patients predicted to benefit & those not Predisposed to Toxicity Hypothesis : Personalized Treatment Planning based on the molecular profile of the tumor and/or the host (patient) will improve patient outcomes Selection Factors for Individualizing Therapy of NSCLC Grouped Patient Outcomes by Histology Pemetrexed/Cisplatin* Non-Squamous 11.8 mos Predicted Individual Patient Outcomes Now we are translating these findings into the treatment selection paradigm for earlier stage NSCLC as well Squamous 9.4 mos *Scagliotti & Gandara: JCO, 2008 Chemotherapy Anti-EGFR Therapy Anti-Angiogenic Angiogenic Therapy? from Gandara & Scagliotti: Clin Lung Cancer,

3 NSCLC Themes at ASCO & WCLC 2009: Decision-Making for Personalizing & Molecular- based Therapy Histology-based Therapy Predictive Biomarkers Maintenance Therapy Hypothesis: Treatment of NSCLC should be Histology-Based Observation: Pemetrexed efficacy in Adenocarcinoma & Large Cell Subsets of NSCLC JMDB: Pemetrexed-Cisplatin vs Gemctiabine- Cisplatin in 1 st line therapy of Advanced NSCLC JMEI: Pemetrexed vs Docetaxel in 2 nd line therapy of Advanced NSCLC JMEN: Pemetrexed vs as Maintenance Therapy of NSCLC FDA restricted use of Pemetrexed to Non-Squamous Histology JMDB: Pemetrexed/Cisplatin vs Gemcitabine/Cisplatin in 1 st Line Therapy of Advanced NSCLC Randomization Factors Stage Performance status Gender Histologic vs cytologic diagnosis History of brain metastases R Cisplatin 75 mg/m 2 day 1 plus Pemetrexed 500 mg/m 2 day 1 Each cycle repeated q3 weeks up to 6 cycles Cisplatin 75 mg/m 2 day 1 plus Gemcitabine 1250 mg/m 2 days 1 & 8 Vitamin B 12, folate, and dexamethasone given in both arms Scagliotti & Gandara. J Clin Oncol 2008;26: JMDB Trial: Cisplatin-Pemextexed (Cis-Pem) vs Cisplatin-Gemcitabine (Cis-Gem) in Adv NSCLC No difference in overall PFS or Survival between study arms Cis-Pem improves Survival in Non-Squamous (SCCA) (HR 1, p=05) Cis-Pem is inferior in SCCA (HR 1.23, p=5) Scagliotti & Gandara. J Clin Oncol 2008;26:

4 JMEI: Pemetrexed Less Effective in Squamous Histology Patients JMEN: Maintenance Pemetrexed vs : Survival by Histology Non-squamous (n = 481) Squamous (n = 182) HR = 0 (95% CI: 6-8); P = 02 HR = 7 (95% CI: 9 3); P = 78 Percent Surviving Pts Randomized to Pemetrexed (8.3 mos) Squamous: Median = 6.2 Nonsquamous: Median = 9.2 HR*=8 P=01 Percent Surviving Pts Randomized to Docetaxel (7.9 mos) Squamous: Median = 7.4 Non-squamous: Median = 8.2 Survival Probability 1 mos Pemetrexed 15.5 mos 1 mos Pemetrexed 9.9 mos Overall Survival (months) Overall Survival (months) Pemetrexed is less effective in Squamous histology patients P Peterson et al. WCLC 2007 Belani CP, et al. ASCO CRA8000. Hypothesis: Histology will ultimately prove to be Suboptimal for Selecting Chemotherapy (or Targeted Therapy) Histologic subtyping groups tumors based on microscopic pattern recognition by a pathologist (using 1800 s technology) At best, Histology = crude molecular selection NSCLC Themes at ASCO & WCLC 2009: Decision-Making for Personalizing & Molecular- based Therapy Histology-based Therapy Maintenance Therapy Predictive Biomarkers Robert Hooke Tissue Microarray 4

5 Proposed Predictive Biomarkers for Chemotherapy in NSCLC Thymidylate Synthetase Expression in Lung Cancer Pemetrexed: TS Platinum: ERCC1, Genomic Signature Gemcitabine: RRM1 Taxanes/Vincas: TUBB-III, BRCA-1 TS SCLC High TS Squamous High TS Adeno Low TS Bhattacharjee PNAS 2001 TS mrna Expression in Lung Cancer 6 5 P<01 TS mrna Expression in NSCLC: Analysis of the Response Genetics (RGI) Database N= NSCLC: 141 adenoca, 183 squamous [SCCA] TS relative mrna levels P<01 P<01 P=9 Tumor NSCLC- Total NSCLC- Adenoca NSCLC- SCCA Median TS Range ADC SCC LCC SCLC N=41 N=30 N=34 N=33 Ceppi: Cancer 2006 Broad overlap of TS range between NSCLC-Adeno & NSCLC-SCCA Gandara: WCLC

6 ERCC1 is both Prognostic & Predictive of benefit of Platinum-based Chemotherapy in NSCLC The Nucleotide excision repair gene ERCC1 plays a key role in DNA repair after Cisplatin damage The balance of DNA damage to DNA repair dictates tumor cell death or survival after Cisplatin therapy Data support the prognostic & predictive value of ERCC1 protein expression and mrna levels in NSCLC ERCC1 mrna levels in NSCLC Stage I/II: Resected (Simon: Chest, 2005) High Stage IV: gem/cis (Lord et al. CCR, 2002) Low DNA damage DNA repair S0720: Biomarker-directed Adjuvant Chemotherapy of Stage I NSCLC (ERCC1 & RRM1) NSCLC Stage I pt1(>2cm) pt2n0m0 R0 resection PS 0-1 N=55 Enrollment Surgery Specimen Collection ERCC1 & RRM1 AQUA testing Assignment Cisplatin- Gemcitabine Vs Observation Prognostic Low Predictive High ERCC1: Excision Repair Cross-Complementing Complementing Group 1 RRM1: Ribonucleotide Reductase M1 Zheng, Bepler: NEJM, 2007; Simon: JCO, 2007 Platinum Compound Metabolism & Disposition Cisplatin Cisplatin Cisplatin Cisplatin ABCG2 ABCC2 Translesional replication cell membrane Detoxify S0720: Biomarker-directed Adjuvant Therapy of Stage I NSCLC RRMI > 4 AND ERCC1 > 66.0 Assignment All Others (RRM1< 4 OR ERCC1 < 66.0 ) Damage recognition MLH1 Mismatch repair MSH6 Cell Death XPA ERCC2 ERCC1 XRCC1 Excision repair Observation Good Prognosis Less benefit from chemotherapy Cisplatin-Gemcitabine Poor Prognosis More benefit from chemotherapy Primary Endpoint: Feasibility measured as % of patients in whom treatment assignment can be made (>75%=success) 6

7 Epidermal Growth Factor Receptor (EGFR) Inhibitors in NSCLC: Status of Predictive Biomarkers Gefitinib Erlotinib Single Agent EGFR Mt = (+) predictive EGFR FISH = (+) predictive KRAS Mt = (-) predictive TKIs + Chemo effective TKI Ligand TKI K K MoAb K K Cetuximab Single Agent EGFR Mt predictive SWOG Data EGFR FISH= (+) predictive KRAS Mt predictive Cetux + Chemo = effective Individualizing Anti-EGFR Therapy: Methodology GGCGGGCCAAACTGCTGGGTGCG EGFR mutation status by gene sequencing EGFR gene copy number by fluorescence in situ hybridization (FISH) EGFR protein expression by immunohistochemistry (IHC) Signal Transduction Blocked Signal Transduction Blocked Serum Proteomics by MALDI MS 25 Predictive Biomarkers for EGFR Therapy (IPASS) Conducted in China, Japan, Thailand, Taiwan, Indonesia, Malaysia, Philippines, Hong Kong, and Singapore Patients Chemo-naïve Age 18 years Adenocarcinoma histology Never or ex-light smokers* Life expectancy 12 weeks WHO PS 0-2 Measurable stage IIIB / IV disease Mok: NEJM, 2009 Randomization period: March 2006 October 2007 Gefitinib (250 mg/d) 1:1 randomization Carboplatin (AUC 5 or 6) / paclitaxel (200 mg/m 2 ) 3 weekly # 94% Never-Smokers; ~80% female End Points Primary Progression-free survival (noninferiority) Secondary Objective response rate Overall survival Quality of life Disease-related symptoms Safety and tolerability Exploratory Biomarkers EGFR mutation EGFR-gene-copy number EGFR protein expression Probability of PFS IPASS: Progression-free survival Primary Cox analysis with covariates HR <1 implies a lower risk of progression on gefitinib N Events Gefitinib (74.4%) Carboplatin / paclitaxel (81.7%) HR (95% CI) = 41 (51, 45) p<001 Median PFS (months) 4 months progression-free 6 months progression-free 12 months progression-free % 48% 25% % 48% 7% Gefitinib demonstrated superiority relative to carboplatin / paclitaxel in terms of PFS At risk : Months Gefitinib Carboplatin / paclitaxel Mok: NEJM,

8 Probability of progression-free survival IPASS Trial Progression-Free Survival: Gefitinib vs Carboplatin/Paclitaxel in Adv NSCLC EGFR mutation positive ITT population Cox analysis with covariates Gefitinib (n=132) Carboplatin / paclitaxel (n=129) HR (95% CI) = 8 (6, 4) p<001 No. events gefitinib, 97 (73.5%) No. events C / P, 111 (86.0%) Months EGFR mutation negative Clinical Treatment characteristics by subgroup interaction are test, insufficient p<001 Probability of progression-free survival Gefitinib (n=91) Carboplatin / paclitaxel (n=85) HR (95% CI) = 2.85 (2.05, 3.98) p<001 No. events gefitinib, 88 (96.7%) No. events C / P, 70 (82.4%) Months for selection of 1 st line EGFR TKI Therapy Mok: NEJM, 2009 S0819: Phase III Trial of Chemotherapy +/- Cetuximab (builds on S0342 & S0536) NSCLC Adv Stage Tumor Tissue Available R A N D O M I Z E Paclitaxel Carboplatin *Bevacizumab Paclitaxel Carboplatin Cetuximab *Bevacizumab *Bevacizumab Primary Endpoints: OS (entire study), PFS (EGFR FISH) Cetuximab *Bevacizumab *In Bevacizumab appropriate: as piloted in S0536 Correlative Science: Tumor: EGFR/HER pathways; KRAS Genomic DNA: EGFR polymorphisms Plasma: Proteomic predictor EGFR FISH S0342: Cetuximab + Paclitaxel/Carboplatin: Analysis by EGFR FISH Response (CR/PR) DCR (CR/PR/SD) FISH - 26% 55% FISH + 45% 81% (p=2) 100% 80% 60% 40% 20% 0% Progression Free Survival by FISH Score Group PFS Events / N 1-4 Low 31 / High 41 / 45 Logrank P-value = Months After Enrollment Median in Months 3 (2,4) 6 (5,7) NSCLC Themes at ASCO & WCLC 2009: Decision-Making for Personalizing & Molecular- based Therapy Histology-based Therapy Maintenance Therapy 100% 80% 60% Overall Survival by FISH Score Group OS Events / N 1-4 Low 25 / High 29 / 45 Logrank P-value =.04 Median in Months 7 (4,11) 15 (10,19) Predictive Biomarkers 40% 20% 12 June 2007 Hirsch: JCO 2008 (Colorado SPORE) 0% Months After Enrollment 8

9 Maintenance Pemetrexed vs after initial Platinum-based Chemotherapy Stage IIIB/IV Four cycles of platinum-based chemotherapy (no pemetrexed) ECOG PS 0-1 Non-PD (CR, PR, SD) (n=663) Randomization factors: gender PS stage best tumor response non-platinum drug brain mets Pemetrexed 500mg/m 2 q3w d1, until progression (n=441) (n=222) JCO 2009 Maintenance Pemetrexed vs After Platinum-based Chemotherapy Progression-free Survival Overall Survival Progression-free Probability Survival Probability CI: confidence interval; HR: hazard ratio; mos: months Belani CP, et al. ASCO CRA mos HR = 0 (95% CI: 9-3) P <0001 Pemetrexed 4.0 mos HR = 9 (95% CI: 5-5) P = 12 Pemetrexed 13.4 mos 1 mos Survival Probability JMEN: Maintenance Pemetrexed vs : Survival by Histology Non-squamous (n = 481) Squamous (n = 182) HR = 0 (95% CI: 6-8); P = 02 1 mos Belani CP, et al. ASCO CRA8000. Pemetrexed 15.5 mos HR = 7 (95% CI: 9 3); P = 78 1 mos Pemetrexed 9.9 mos JMEN: Maintenance Pemetrexed vs After Platinum-based Chemotherapy JMEN: Systemic Pemetrexed Post-study study Therapy N = 309 N = 178 Any systemic therapy 51% 67% Docetaxel 22% 29% Erlotinib 22% 21% Gefitinib 13% 10% Pemetrexed 1% 19% Post-study study therapy was not balanced between the arms 51% of patients on the pemetrexed arm received further therapy (equates to third-line therapy) Only 19% of placebo-arm arm patients received pemetrexed Would survival benefits have been preserved if more patients on the placebo arm received pemetrexed? Belani CP, et al. ASCO CRA

10 Chemo-naïve advanced NSCLC n = 1949 Mandatory tumor sampling SATURN Study Design 4 cycles of first-line platinum doublet chemotherapy* Stratification factors: EGFR IHC (positive vs negative vs indeterminate) Stage (IIIB vs IV) ECOG PS (0 vs 1) CT regimen (cis/gem vs carbo/doc vs others) Smoking history (current vs former vs never) Region Non-PD n = 889 Erlotinib 150 mg/d 1:1 Co-primary endpoints: PFS in all patients PFS in patients with EGFR IHC+ tumors Secondary endpoints: PD PD OS in all patients and those with EGFR IHC+ tumors, OS and PFS in EGFR IHC tumors; biomarker analyses; safety; time to symptom progression; QOL *Cisplatin/paclitaxel; cisplatin/gemcitabine; cisplatin/docetaxel cisplatin/vinorelbine; carboplatin/gemcitabine; carboplatin/docetaxel carboplatin/paclitaxel CT: chemotherapy; EGFR: epidermal growth factor receptor; IHC: immunohistochemistry Cappuzzo F, et al. ASCO Abstract SATURN: Maintenance Erlotinib vs Progression Free Survival (PFS) Probability Time (weeks) Cappuzzo F, et al. ASCO Abstract Median PFS (wks) PFS at 12 wks (%) HR = 1 (2-2) Log-rank P <001 Erlotinib PFS at 24 wks (%) Erlotinib (n = 437) (n = 447) Empiric Personalized & Molecular-Based Therapy Gandara, Mack, Li, Lara, Herbst: Clin Lung Cancer,

11 Algorithm for Therapy of Advanced Stage NSCLC (Good PS): 2012 Gandara, Mack, Li, Lara, Herbst: Clin Lung Cancer, 2009 Gandara, Mack, Li, Lara, Herbst: Clin Lung Cancer,