Human breast milk mirna, maternal probiotic supplementation and atopic dermatitis in offsrping

Transcription

1 Human breast milk mirna, maternal probiotic supplementation and atopic dermatitis in offsrping Melanie Rae Simpson PhD candidate Department of Public Health and General Practice Norwegian University of Science and Technology

2 Probiotics in the Prevention of Allergies among Children in Trondheim ProPACT Study -4 wks n=415 Probiotic milk (n=211) Lactobacillus rhamnosus GG (LGG; 5 x CFU) Bifidobacterium animalis subsp. lactis Bb-12 (Bb-12; 5 x CFU) Lactobacillus acidophilus La-5 (La-5; 5 x 10 9 CFU). Placebo milk (n=204) Cultured milk, sterilised after culture process

3 ProPACT Study -4 wks Birth 3 mths n=415 Intervention period Probiotic milk (n=211) Lactobacillus rhamnosus GG (LGG; 5 x CFU) Bifidobacterium animalis subsp. lactis Bb-12 (Bb-12; 5 x CFU) Lactobacillus acidophilus La-5 (La-5; 5 x 10 9 CFU). Placebo milk (n=204) Cultured milk, sterilised after culture process

4 ProPACT Study -4 wks Birth 6 wks 3 mths 1 yr 2 yrs n=415 Intervention period n=287 QUESTIONNAIRES 6 weeks, 1 year, 2 years, (6 years) CLINICAL EXAMINATION 2 and 6 years Offered earlier with persistent itchy rash

5 ProPACT Study -4 wks Birth 6 wks 3 mths 1 yr 2 yrs n=415 Intervention period n=287 40% fewer cases of atopic dermatitis at 2 years No effect on other allegy related diseases

6 ProPACT Study -4 wks Birth 6 wks 3 mths 1 yr 2 yrs n=415 Intervention period n=287 BREAST MILK SAMPLES Collected at 10 days and 3 months post-partum Only 3 month samples used in this analysis

7 Breast milk and mirnas Breastfeeding may have long lasting immunological consequences Relationship between breastfeeding and allergy related diseases (atopic dermatitis, asthma, allergic rhinoconjunctivitis, allergic sensitisation) is controversial mirnas Short non-coding RNAs Approx. 22 nucleotides (nt) Regulate gene expression at post-transcriptional level Human breast milk contains high concentration of mirna Stable under harsh conditions Potentially active after ingestion

8 Objectives 1. Describe mirna profile of human breast milk 2. Investigate associations between maternal probiotic supplementation and mirnas 3. Investigate associations between mirnas, as mediators of the effect of probiotics, on the development of atopic dermatitis

9 Methods SAMPLE SELECTION 54 breast milk samples Randomly selected Criteria ensured sufficient number with atopic dermatitis

10 Methods SAMPLE PREPARATION Enriched for extracellular vesicles (Exoquick ) RNA isolated (Quigen mirneasy kit)

11 Methods UCAGUGCACUACAGAACUUUGU AAGCUGCCAGUUGAAGAACUGU SEQUENCING nucleotides Library preparation (ScriptMinder Small RNA-Seq Library Prepartion Kit) Sequencing (Illumina HiSeq 2000) 50 base pair single end reads

12 Methods UCAGUGCACUACAGAACUUUGU AAGCUGCCAGUUGAAGAACUGU BIOINFORMATICS Raw reads were processed, filtered Mapped to the human genome (hg 19) mirnas mapped to mirbase version 20.0 Differential expression of mirnas using limma (R package) Probiotic vs placebo Atopic dermatitis vs no atopic dermatitis hsa-mir-148a-3p hsa-mir-22-3p

13 Methods UCAGUGCACUACAGAACUUUGU AAGCUGCCAGUUGAAGAACUGU FUNCTIONAL PREDICTIONS TargetScan v7.0 Database for Annotation, Visualisation and Integrated Discovery (DAVID) v6.7 Enrichment Map app in Cytoscape hsa-mir-148a-3p hsa-mir-22-3p Target genes and their functions

14 Results Fifty-four (54) mother-infant pairs 32 from the probiotics group (11 with atopic dermatitis) 22 from the placebo group (18 with atopic dermatitis) Representative of original population, except Higher proportion with maternal and family history of allergy related disease

15 Small RNA profile 50 After sequencing (11-28nt): Short RNAs up to approx. 1000nt Percentage of reads mirna trna rrna

16 Highly expressed mirnas TOP 5 CPM mature mirnas ,000 mir-148a-3p mir-22-3p mir-30d-5p Let-7b-5p 0 mir-148a-3p mir-22-3p mir-30d-5p let-7b-5p mir-200a-3p let-7a-5p let-7f-5p mir-146b-5p mir-24-3p mir-21-5p mir-30a-5p mir-29a-3p mir-335-5p mir-26a-5p mir-429 mir-30b-5p mir-193a-3p mir-375 mir-27a-3p mir-141-3p mir-200a-3p

17 Target predictions Top 20 mirnas 76.0% of reads 3498 targets Top 10 mirnas 63.0% of reads 1759 targets Top 5 mirnas 53.8% 1371 predicted targets 125 mirnas 98.5% of reads 6568 targets Functional predictions broad range of potential functions a) the positive and negative regulation of metabolic processes involving nitrogen compounds, RNA, DNA and macromolecules and the positive regulation of transcription and gene expression, b) embryonic development, c) angiogenesis, d) catabolic processes e) cell migration and localisation.

18 Enrichment Map of top 50 Gene Ontology (GO) Terms

19 Differential expression: Probiotic vs Placebo mirna Fold change p-value FDR Probiotic vs Placebo mir-574-3p mir-340-5p let-7d-3p mir-218-5p

20 Differential expression: AD vs no-ad mirna Fold change p-value FDR Atopic dermatitis vs no-atopic dermatitis mir-452-5p let-7d-3p mir-146b-5p mir-21-5p mir-22-3p mir mir-16-5p mir-511-5p mir-26b-5p let-7f-5p mir-30e-5p mir-374a-5p mir-335-5p

21 Conclusions Stable group of core breast milk mirnas At least partially conserved across a number of mammalian species Predicted functional consequences suggest a broad range of biological processes and molecular functions Individual mirnas are unlikely to play a major role in the prevention of atopic dermatitis in infancy by probiotics ingested in the perinatal period.

22 Further research Mediators of beneficial effect of probiotic supplementation Stool samples Peripheral blood mononuclear cells (PBMC) Bacterial swabs from mouth and vagina mirna and other short RNA in breast milk In vitro experiments and computational modelling Paired fresh and frozen samples

23 Thanks Supervisors Dr Torbjørn Øien Dr Ola Storrø Co-authors BioCore: Jostein Johansen and Prof Pål Sætrom Laboratory: Dr Gaute Brede Participants and co-workers International Milk Genomics Consortium

24 References Baier, S., C. et al (2014). "MicroRNAs are absorbed in biologically meaningful amounts from nutritionally relevant doses of cow milk and affect gene expression in peripheral blood mononclear cells, HEK-293 kidney cell cultures, and mouse livers." The Journal of Nutrition doi: /jn Bartel, D. P. (2004). "MicroRNAs: genomics, biogenesis, mechanism, and function." Cell 116(2): Bartel, D. P. (2009). "MicroRNAs: target recognition and regulatory functions." Cell 136(2): Chen, T., et al (2014). "Exploration of micrornas in porcine milk exosomes." BMC Genomics 15: 100. Chen, X., et al (2010). "Identification and characterization of micrornas in raw milk during different periods of lactation, commercial fluid, and powdered milk products." Cell Res 20(10): Davis, M. K. (2001). "Breastfeeding and chronic disease in childhood and adolescence." Pediatric Clinics of North America 48(1): , ix. Dotterud, C. K., et al. (2010). "Probiotics in pregnant women to prevent allergic disease: a randomized, double-blind trial." Br J Dermatol 163(3): Izumi, H., et al (2014). "Time-dependent expression profiles of micrornas and mrnas in rat milk whey." PLoS One 9(2): e Gu, Y., et al (2012). "Lactation-related microrna expression profiles of porcine breast milk exosomes." PLoS One 7(8): e Kosaka, N., et al (2010). "microrna as a new immune-regulatory agent in breast milk." Silence 1(1): 7. Matheson MC, et al. Understanding the evidence for and against the role of breastfeeding in allergy prevention. Clinical and Experimental Allergy 2012; 42(6): Modepalli, V., et al (2014). "Differential temporal expression of milk mirna during the lactation cycle of the marsupial tammar wallaby (Macropus eugenii)." BMC Genomics 15: Patelarou, E., et al (2012). "Current evidence on the associations of breastfeeding, infant formula, and cow's milk introduction with type 1 diabetes mellitus: a systematic review." Nutrition Reviews 70(9): Webber, J., et al (2010). "The microrna spectrum in 12 body fluids." Clinical Chemistry 56(11): 9. Zhou, Q., et al (2012). "Immune-related micrornas are abundant in breast milk exosomes." Int J Biol Sci 8(1):