Fig S2 Efficiencies of primers used in the taxon-specific qpcr assay. CT: threshold value (A) Universal: 907F R efficiency: 99.

Size: px
Start display at page:

Download "Fig S2 Efficiencies of primers used in the taxon-specific qpcr assay. CT: threshold value (A) Universal: 907F R efficiency: 99."

Transcription

1

2 Fig S2 Efficiencies of primers used in the taxon-specific qpcr assay. CT: threshold value (A) Universal: 907F R efficiency: 99.1% (B) Bacteroidetes: Bac960F+Bac1100R efficiency: 98.5% (C) Firmicutes: Firm934F+Firm1060R efficiency: 94.6% (D) Tenericutes: Ten662F+Ten862R efficiency: 96.5% (E) Deferribacteres: Defer1115F+Defer1265R efficiency: 92.6% (F) : Sac1031F+Sac1218R efficiency: 94.6% (G) -Proteobacteria: Beta979F+Beta1130R efficiency: 94.2% (H) -Proteobacteria: Gamma877F+Gamma1066R efficiency: 96.1% (I) -Proteobacteria:Epslion940F+Epsloin1129R efficiency: 92.1%

3 Fig S3 Specificity of each primer pairs analyzed by QPCR with target and non-target 16S rrna s as templates. a, target 16S rrna (5ng); b, non-target 16S rrna 1 (5ng); c, non-target 16S rrna 2 (5ng) 2; d, non-target 16S rrna 3 (5ng); e, ddh2o as template. (A)Primer pair: Sac1031F/Sac1218R. (B)Primer pair: Ten662F/Ten862R. (C)Primer pair: Epslion940F/Epsloin1129R. (D)Primer pair: Gamma877F/Gamma1066R. (E)Primer pair: Firm934F/Firm1060R. (F)Primer pair: Defer1115F/Defer1265R. (G)Primer pair: Beta979F/Beta1130R. (H)Primer pair: Bac960F/Bac1100R. (I)Primer pair: Act664F/Act941R. (J)Primer pair: Ver1165F/Ver1263R. It must be emphasized that each primer pair with least mismatches to the of the non-targets from Fig S3.

4 Table S1. Taxa dominating the bacterial microbiota of the mouse feces Phylum Class Family Genus Actinobacteria Actinobacteria Bifidobacteriales Bifidobacterium Actinobacteria Actinobacteria Coriobacteriaceae Asaccharobacter Actinobacteria Actinobacteria Coriobacteriaceae Enterorhabdus Actinobacteria Actinobacteria Coriobacteriaceae Olsenella Bacteroidetes Bacteroidia Porphyromonadaceae Barnesiella Bacteroidetes Bacteroidia Porphyromonadaceae Odoribacter Bacteroidetes Bacteroidia Porphyromonadaceae Parabacteroides Bacteroidetes Bacteroidia Prevotellaceae Paraprevotella Bacteroidetes Bacteroidia Prevotellaceae Prevotella Bacteroidetes Bacteroidia Rikenellaceae Alistipes Bacteroidetes Bacteroidia Bacteroidaceae Bacteroides Deferribacteres Deferribacteres Deferribacteraceae Mucispirillum Proteobacteria Betaproteobacteria Sutterellaceae Parasutterella Proteobacteria Betaproteobacteria Neisseriaceae Neisseria Proteobacteria Deltaproteobacteria Bdellovibrionaceae Vampirovibrio Proteobacteria Deltaproteobacteria Desulfovibrionaceae Desulfovibrio Proteobacteria Epsilonproteobacteria Helicobacteraceae Helicobacter Proteobacteria Gammaproteobacteria Enterobacteriaceae Klebsiella Proteobacteria Gammaproteobacteria Pasteurellaceae Haemophilus Tenericutes Mollicutes Anaeroplasmataceae Anaeroplasma Tenericutes Mollicutes Mycoplasmataceae Mycoplasma Tenericutes Mollicutes Mycoplasmataceae Ureaplasma Verrucomicrobia Verrucomicrobiae Verrucomicrobiaceae Akkermansia Firmicutes Bacilli Lactobacillaceae Lactobacillus Firmicutes Clostridia Lachnospiraceae Clostridium_XlVa Firmicutes Clostridia Lachnospiraceae Clostridium_XlVb Firmicutes Clostridia Lachnospiraceae Lachnospiracea Firmicutes Clostridia Ruminococcaceae Butyricicoccus Firmicutes Clostridia Ruminococcaceae Flavonifractor Firmicutes Clostridia Ruminococcaceae Oscillibacter Firmicutes Erysipelotrichia Erysipelotrichaceae Allobaculum Firmicutes Erysipelotrichia Erysipelotrichaceae Turicibacter _class_incertae_sedis _family_incertae_sedis _genera_incertae_sedis

5 Table S2. NCBI BLAST search results and Ribosomal Database Project-II (RDP-II) database classification of 38 clones Clone NCBI Sequence Name Match Description Clone 1 Papyrosolvens strain DSM S ribosomal RNA gene, partial Clone 2 Straminisolvens strain CSK1 16S ribosomal RNA gene, partial Clone 3 Cavendishii strain BL-28 16S ribosomal RNA gene, partial Clone 4 Parasutterella excrementihominis strain YIT S ribosomal RNA gene, Clone 5 Sutterella parvirubra strain YIT S ribosomal RNA gene, Clone 6 Parasutterella secunda strain JCM S ribosomal RNA gene, Clone 7 Mucispirillum schaedleri strain HRI I17 16S ribosomal RNA gene, Clone 8 Calditerrivibrio nitroreducens strain Yu S ribosomal RNA gene, Clone 9 Calditerrivibrio nitroreducens strain DSM S ribosomal RNA gene, complete Clone 10 Desulfovibrio desulfuricans strain Essex 6 16S ribosomal RNA gene, complete Clone 11 Desulfovibrio desulfuricans 16S ribosomal RNA, complete Clone 12 Desulfovibrio vulgaris strain DSM S ribosomal RNA gene, Clone 13 Helicobacter aurati strain MIT c 16S ribosomal RNA gene, GenBank Max Identity Bacterial group Accession Numbers 88% Firmicutes KP % Firmicutes KP % Firmicutes KP % Betaproteobacteria KP % Betaproteobacteria KP % Betaproteobacteria KP % Deferribacteres KP % Deferribacteres KP % Deferribacteres KP % Deltaproteobacteria KP % Deltaproteobacteria KP % Deltaproteobacteria KP % Epsilonproteobacteria KP713730

6 Clone 14 Clone 15 Clone 16 Clone 17 Clone 18 Clone 19 Clone 20 Clone 21 Clone 22 Clone 23 Clone 24 Clone 25 Clone 26 Clone 27 Clone 28 Helicobacter cinaedi PAGU611 strain PAGU611 16S ribosomal RNA, complete Helicobacter muridarum strain ST1 16S ribosomal RNA gene, Anaeroplasma abactoclasticum strain S ribosomal RNA gene, Anaeroplasma varium strain A2-T 16S ribosomal RNA gene, Glaciimonas immobilis strain Cr S ribosomal RNA gene, Parasutterella secunda strain JCM S ribosomal RNA gene, Glaciimonas immobilis strain Cr S ribosomal RNA gene, Akkermansia muciniphila strain ATCC BAA S ribosomal RNA gene, complete Akkermansia muciniphila strain Muc 16S ribosomal RNA gene, complete Cavendishii strain BL-28 16S ribosomal RNA gene, partial Sporosalibacterium faouarense strain SOL3F37 16S ribosomal RNA gene, Mogibacterium neglectum strain P9a-h 16S ribosomal RNA gene, Bifidobacterium pseudolongum strain PNC-2-9G 16S ribosomal RNA gene, Olsenella profusa strain DSM S ribosomal RNA gene, Saccharolyticum strain WM1 16S ribosomal RNA gene, complete 97% Epsilonproteobacteria KP % Epsilonproteobacteria KP % Tenericutes KP % Tenericutes KP % Betaproteobacteria KP % Betaproteobacteria KP % Betaproteobacteria KP % Verrucomicrobia KP % Verrucomicrobia KP % Firmicutes KP % 79% KP KP % Actinobacteria KP % Actinobacteria KP % Firmicutes KP713745

7 Clone 29 Clone 30 Clone 31 Clone 32 Clone 33 Clone 34 Clone 35 Clone 36 Clone 37 Clone 38 Barnesiella viscericola 16S ribosomal RNA, complete Helicobacter aurati strain MIT c 16S ribosomal RNA gene, Clostridium formicaceticum strain DSM 92 16S ribosomal RNA gene, Christensenella minuta strain YIT S ribosomal RNA gene, Coprobacter fastidiosus strain NSB1 16S ribosomal RNA gene, Alistipes senegalensis strain JC50 16S ribosomal RNA gene, partial Paraprevotella xylaniphila strain JCM S ribosomal RNA gene, Anaeroplasma abactoclasticum strain S ribosomal RNA gene, Helicobacter equorum strain EqF1 16S ribosomal RNA gene, complete Helicobacter hepaticus strain Hh-2 16S ribosomal RNA gene, 85% Bacteroidetes KP % Epsilonproteobacteria KP % Firmicutes KP % Firmicutes KP % Bacteroidetes KP % Bacteroidetes KP % Bacteroidetes KP % Tenericutes KP % Epsilonproteobacteria KP % Epsilonproteobacteria KP713755

8 Table S3. Representative of qpcr products amplified by group target primers with mouse total fecal DNA as template Classified by Primer pair Sequence(5'to3')* RDP-II Bac960F Bac1100R GTTTAATTCGATGATACGCGAGGAACCTT ACCCGGGCTTGAAATGTGCAGGACTCAA GCAGAGACGCCTGTTTCTTCGGACCTGCA TGTAGGTGCTGCATGGTTGTCGTCAGCTC GTGCCGTGAGGTGTCGGCTTAA Bacteroidetes Firm934F Firm1060R Act664F Act941R Sac1031F Sac1218R Defer1115F Defer1265R Ver1165F Ver1263R Ten662F Ten862R GGAGTATGTGGTTTAATTCGAAGCAACGC GAAGAACCTTACCAAGACTTGACATCGTA TGACCGCCATAGAGATATGGAATTCCCTTT TGGGACATATAGACAGGTGGTGCATGGTT GTCGTCAGCT TGTAGCGGTGGAATGCGCAGATATTGGGA AGAACACCGGCGGCGAAGGCGGCCTTCT GGGCCACGACTGACGCTGAGGCGCGAAA GCTAGGGGAGCGAACAGGATTAGATACCC TGGTAGTCCTAGCCGTAAACGATGGATGC TAGGTGTGGGAGCCAAATGGCTTCCGTGC CGCAGCTAACGCATTAAGCATCCCGCCTG GGGAGTACGGCCGCAAGGCTAAAACTCA AAGGAATTGACGGGGACCCGCACAAGCA GCGGAGCATGTGGCTTAATT AAGAGAACTGTGCCTTCGGGAACCTCGA GACAGGTGATGCATGGCCGTCGTCAGCTC GTGTCGTGAGATGTTTGGTTAAGTCCATC AACGAGCGCAACCCTTGCAACCAGTTGTA TTTTTCTGGTAGGACTGCCCCGGTAACGG GGAGGAAGGAGGGGATGATGTCAGGTCA GTATTTCCCTTACGC CTATTTCCAGTTGCTAACGGGTTAAGCTG AGCACTCTGGAGGGACTGCCAGCGATAA GCTGGAGGAAGGTGGGGACGACGTCAAG TCATCATGGCCCTTATGTCCAGGGCTACAC ACGTGCTACAATGGCATAATCAGAGGGAA GCAGCTC TCAGGTCAGTATGGCCCTTATGCCCAGGG CTGCACACGTACTACAATGCCCAGTACAG AGGGGGCCGAAGCCGCGAGGCGGAGGA AATCCTAAAAACTGGGCGGAGGAAATCCT GAAAACTG ATGTGTAGCGGTAAAATGCGTAAATATATG TAAGAACACCGGTGGCGAAGGCGGCTTG Firmicutes Actinobacteria Deferribacteres Verrucomicrobia Tenericutes

9 Beta979F Beta1130R Epslion940F Epsloin1129R Gamma877F Gamma1066R CTGGGCCTGTACTGACATTGAGGCACGAA AGCGTGGGGAGCAAACAGGATTAGATAC CCTGGTAGTCCACGCCCTAAACGACGAGT ACTAAGTGTTGCCGATAGGCAGTGCTGAA GTTAACGCATTAAGTACTCCGCCTGAGTA GTACGTACGCAAGTAGG AACGCGAAAAACCTTACCTACCCTTGACA TGTCAGAGAAGCTTTTGTAATGAGAGTGT GCCCGCAAGGGCGTCTGAACACAGGTGC TGCATGGCTGTCGTCAGCTCGTGTCGTGA GATGTTGGGTTAAGTCCCGCAACGAGCGC AACCCTTGTCACTAGTTGCTACGAAAGGG CA TAGGCTTGACATTGATAGAATCCTATAGAG ATATGGGAGTGCCCTTTTAGGGAGCTTGA AAACAGGTGCTGCACGGCTGTCGTCAGC TCGTGCCGTGAGATGTTGGGTTAAGTCCC GCAACGAGCGCAACCCTCGTCCTTAGTTG CTAGCAGTTCGGCTGAGCACTCTAAGGAG ACTGCCTTCGTAAG GCTAACGCATTAAGTGTCCCGCCTGGGGA GTACGGTCGCAAGGCTGAAACTCAAAGA AATTGACGGGGGCCCGCACAAGCGGTGG AGTATGTGGTTTAATTCGATGCAACGCGA AGAACCTTACCCAGGCTTGACATCTAGGG AACCTAACAGAGATGTTGGGGTGCTCTTC GGAGAACCCTAAGACAGGTGCTGCATGG C * Base pairs in red are s of primer pairs -proteobacteria -proteobacteria -proteobacteria

Supplementary Figures and Tables

Supplementary Figures and Tables Supplementary Figures and Tables Supplementary Figure 1. Intestinal epithelial MyD88 deletion decreases fat mass under HFD. (a) Final fat mass expressed as a percentage of final body weight (n=25). (b)

More information

Structural modulation of the gut microbiota and the relationship with body weight: compared evaluation of liraglutide and saxagliptin treatment

Structural modulation of the gut microbiota and the relationship with body weight: compared evaluation of liraglutide and saxagliptin treatment Structural modulation of the gut microbiota and the relationship with body weight: compared evaluation of liraglutide and saxagliptin treatment Lin Wang, Peicheng Li, Zhaosheng Tang, Xinfeng Yan, Bo Feng

More information

Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1,

Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1, Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1, additional measures of diversity are shown: Figure S2, SDC

More information

Active and secreted IgA-coated bacterial fractions from the human gut reveal an under-represented

Active and secreted IgA-coated bacterial fractions from the human gut reveal an under-represented Supplemental information Title. Active and secreted IgA-coated bacterial fractions from the human gut reveal an under-represented microbiota core. Authors. Giuseppe D'Auria, Francesc Peris-Bondia, Mária

More information

Benakis et al. Supplementary Figure 1

Benakis et al. Supplementary Figure 1 Benakis et al. Supplementary Figure a flora Naive C7BL/ d AC weeks d S rrna sequencing Antibiotic in drinking water Stool pellet collection riginal seeder flora flora Naive C7BL/ d AC weeks d S rrna sequencing

More information

Research Article Antitumor Ability of Berberine Accompanied by Modulation of Gut Microbiome in Sarcoma-180 Tumor-bearing Mice

Research Article Antitumor Ability of Berberine Accompanied by Modulation of Gut Microbiome in Sarcoma-180 Tumor-bearing Mice OPEN ACCESS International Journal of Pharmacology ISSN 1811-7775 DOI: 1.3923/ijp.218.46.47 Research Article Antitumor Ability of Berberine Accompanied by Modulation of Gut Microbiome in Sarcoma-18 Tumor-bearing

More information

SUPPLEMENTARY FIGURES & TABLES

SUPPLEMENTARY FIGURES & TABLES SUPPLEMENTARY FIGURES & TABLES Figures S1-S6 Tables S1-S5 A 6 Bacteroidetes/Firmicutes B 1.0 Prevotellaceae/Bacteroidetes Ratio 5 4 3 2 Ratio 0.8 0.6 0.4 1 0.2 0 1 2 3 4 5 6 BSS 0.0 1 2 3 4 5 6 BSS Supplementary

More information

Modulation of Gut Microbiota during Probiotics-Mediated. Attenuation of Metabolic Syndrome in High Fat Diet-Fed Mice

Modulation of Gut Microbiota during Probiotics-Mediated. Attenuation of Metabolic Syndrome in High Fat Diet-Fed Mice Modulation of Gut Microbiota during Probiotics-Mediated Attenuation of Metabolic Syndrome in High Fat Diet-Fed Mice 1 2 3 Jingjing Wang 1,2, Huang Tang 2, Chenhong Zhang 2, Yufeng Zhao 1, Muriel Derrien

More information

Microbiota-gut-brain-axis and Autism Spectrum disorders

Microbiota-gut-brain-axis and Autism Spectrum disorders Review Microbiota-gut-brain-axis and Autism Spectrum disorders Piranavie Srikantha, M. Hasan Mohajeri * Department of medicine, University of Zurich, Winterthurerstrasse 190, 8057 Zürich, Switzerland.

More information

Microbiome and liver diseases

Microbiome and liver diseases Klinik und Poliklinik für Innere Medizin I Microbiome and liver diseases Bernd Schnabl, M.D. Department of Medicine I have no financial relationship relevant to my presentation AND my presentation does

More information

traits and fasdng TMAO concentradons..6

traits and fasdng TMAO concentradons..6 FIGURE S1: Variability of gut microbiota composidon in Metsim samples 2 FIGURE S2: AssociaDon of bacterial diversity and richness measures with traits.3 FIGURE S3: AssociaDons of OTUs with fasdng blood

More information

Research Article Perilla Oil Has Similar Protective Effects of Fish Oil on High-Fat Diet-Induced Nonalcoholic Fatty Liver Disease and Gut Dysbiosis

Research Article Perilla Oil Has Similar Protective Effects of Fish Oil on High-Fat Diet-Induced Nonalcoholic Fatty Liver Disease and Gut Dysbiosis BioMed Research International Volume 216, Article ID 9462571, 11 pages http://dx.doi.org/1.1155/216/9462571 Research Article Perilla Oil Has Similar Protective Effects of Fish Oil on High-Fat Diet-Induced

More information

Time of day and eating behaviors are associated with the composition and function of the human gastrointestinal microbiota

Time of day and eating behaviors are associated with the composition and function of the human gastrointestinal microbiota Time of day and eating behaviors are associated with the composition and function of the human gastrointestinal microbiota Jennifer L Kaczmarek, 1 Salma MA Musaad, 2 and Hannah D Holscher 1 3 1 Division

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION ARTICLE NUMBER: 16220 DOI: 10.1038/NMICROBIOL.2016.220 Dual-specificity phosphatase 6 deficiency regulates gut microbiome and

More information

Observed # of species (normalized) Chao 1 (richness) Nonsmoker 21 Male 2418 (337) 67 (33)

Observed # of species (normalized) Chao 1 (richness) Nonsmoker 21 Male 2418 (337) 67 (33) Additional Files The human laryngeal microbiome: effects of cigarette smoke and reflux Marie E. Jetté, Kimberly A. Dill-McFarland, Alissa S. Hanshew, Garret Suen, Susan L. Thibeault Table S1. Detailed

More information

MICROBIAL PATTERNS IN PATIENTS WITH HISTAMINE INTOLERANCE

MICROBIAL PATTERNS IN PATIENTS WITH HISTAMINE INTOLERANCE journal OF PHYSIOLOGY AND PHARMACOLOGY 2018, 69, 4, 579-593 www.jpp.krakow.pl DOI: 10.26402/jpp.2018.4.09 M. SCHINK 1, P.C. KONTUREK 2, E. TIETZ 1, W. DIETERICH 1, T.C. PINZER 3, S. WIRTZ 3, M.F. NEURATH

More information

Manuscript Title: Responses in ileal and cecal bacteria to low and high amylose/amylopectin ratio diets in growing pigs

Manuscript Title: Responses in ileal and cecal bacteria to low and high amylose/amylopectin ratio diets in growing pigs Journal name: Applied Microbiology and Biotechnology Manuscript Title: Responses in ileal and cecal bacteria to low and high amylose/amylopectin ratio diets in growing pigs The names of the authors: Yu-heng

More information

PREBIOTIC MECHANISMS OF ACTION

PREBIOTIC MECHANISMS OF ACTION PREBIOTIC MECHANISMS OF ACTION Seema Hooda, Kelly S. Swanson, George C. Fahey, Jr. Department t of Animal Sciences Division of Nutritional Sciences University of Illinois at Urbana-Champaign Institute

More information

Microbe-Host Interactions in Inflammatory Bowel Diseases. Hera Vlamakis Oct 3, 2018

Microbe-Host Interactions in Inflammatory Bowel Diseases. Hera Vlamakis Oct 3, 2018 Microbe-Host Interactions in Inflammatory Bowel Diseases Hera Vlamakis Oct 3, 2018 Most of the bacteria in your body are in your gut HEALTH BENEFITS Breakdown of polysaccharides Synthesis of vitamins Colonization

More information

Development of OTU Analysis in NutriGen

Development of OTU Analysis in NutriGen Development of OTU Analysis in NutriGen Integrating OTU data with other NutriGen Data Mateen Shaikh and Joseph Beyene McMaster University December 19 2014 Mateen and Joseph (McMaster) Development of OTU

More information

University of Groningen

University of Groningen University of Groningen Maternal exposure to a Western-style diet causes differences in intestinal microbiota composition and gene expression of suckling mouse pups Steegenga, Wilma T.; Mischke, Mona;

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1. (A C) Comparison of Shannon evenness between children who became anti islet autoantibody positive (anti islet aab+) and children who remained autoantibody negative (anti islet aab

More information

Investigation of bacterial diversity in the feces of cattle fed different diets

Investigation of bacterial diversity in the feces of cattle fed different diets University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Faculty Publications in Food Science and Technology Food Science and Technology Department 2014 Investigation of bacterial

More information

Diet, microbiota and the immune system: A gut feeling about type 1 diabetes. Dr. Eliana Mariño Monash University Melbourne, Australia

Diet, microbiota and the immune system: A gut feeling about type 1 diabetes. Dr. Eliana Mariño Monash University Melbourne, Australia Diet, microbiota and the immune system: A gut feeling about type 1 diabetes Dr. Eliana Mariño Monash University Melbourne, Australia Diet, gut microbiota and Western lifestyle diseases Asthma Fatty liver

More information

Fecal bacterial microbiome diversity in chronic HIV-infected patients in China

Fecal bacterial microbiome diversity in chronic HIV-infected patients in China OPEN (2016) 5, e31; doi:10.1038/emi.2016.25 www.nature.com/emi ORIGINAL ARTICLE Fecal bacterial microbiome diversity in chronic HIV-infected patients in China Yang Sun 1,2,3, *, Yingfei Ma 4, *, Ping Lin

More information

Supplemental Information. Commensal Microbes Induce Serum IgA. Responses that Protect against Polymicrobial Sepsis

Supplemental Information. Commensal Microbes Induce Serum IgA. Responses that Protect against Polymicrobial Sepsis Cell Host & Microbe, Volume 23 Supplemental Information Commensal Microbes Induce Serum Ig Responses that Protect against Polymicrobial Sepsis Joel R. Wilmore, rian T. Gaudette, Daniela Gomez tria, Tina

More information

Prevention and treatment of acute exacerbations of COPD

Prevention and treatment of acute exacerbations of COPD Prevention and treatment of acute exacerbations of COPD Prof. Laurent P Nicod Service de pneumologie CHUV-Lausanne-CH SSP-SSC: 15.06.2016 COPD EXACERBATION is an event in the natural course of the disease

More information

Maternal exposure to a Western-style diet causes differences in intestinal microbiota composition and gene expression of suckling mouse pups

Maternal exposure to a Western-style diet causes differences in intestinal microbiota composition and gene expression of suckling mouse pups 1600141 (1 of 17) Mol. Nutr. Food Res. 61, 1, 2017, 1600141 DOI 10.1002/mnfr.201600141 RESEARCH ARTICLE Maternal exposure to a Western-style diet causes differences in intestinal microbiota composition

More information

Microbial nitrogen limitation in the mammalian large intestine

Microbial nitrogen limitation in the mammalian large intestine SUPPLEMENTARY INFORMATION Articles https://doi.org/.38/s16-18-267-7 In the format provided by the authors and unedited. Microbial nitrogen limitation in the mammalian large intestine Aspen T. Reese 1,2,

More information

Role of the Gut Microbiota in Autoimmunity

Role of the Gut Microbiota in Autoimmunity Role of the Gut Microbiota in Autoimmunity Pavan Bhargava, MD - Neuroimmunology Fellow Division of Neuroimmunology and Neurological Infections Johns Hopkins University, Baltimore, MD. May, 2015 None Disclosures

More information

Dynamics of the human gut microbiome in inflammatory bowel disease

Dynamics of the human gut microbiome in inflammatory bowel disease In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION VOLUME: 2 ARTICLE NUMBER: 174 Dynamics of the human gut microbiome in inflammatory bowel disease Jonas Halfvarson, Colin J.

More information

microorganisms ISSN Review

microorganisms ISSN Review Microorganisms 2015, 3, 759-791; doi:10.3390/microorganisms3040759 OPEN ACCESS microorganisms ISSN 2076-2607 www.mdpi.com/journal/microorganisms Review Gut Microbiota and Host Reaction in Liver Diseases

More information

2200 GI Effects Comprehensive Profile Stool Interpretation At-a-Glance

2200 GI Effects Comprehensive Profile Stool Interpretation At-a-Glance P: 1300 688 522 E: info@nutripath.com.au A: PO Box 442 Ashburton VIC 3142 TEST PATIENT Sample Test Name Sex : F Date Collected : 00-00-0000 111 TEST ROAD TEST SUBURB LAB ID: 00000000 UR#:0000000 TEST PHYSICIAN

More information

Stool Testing for the Microbiome - Ready for Primetime?

Stool Testing for the Microbiome - Ready for Primetime? Stool Testing for the Microbiome - Ready for Primetime? Gillian M. Barlow, PhD Project Scientist, Medically Associated Science and Technology (MAST) Program Cedars-Sinai Medical Center Take Charge of

More information

Gut Pathogens. Open Access RESEARCH. Janelle A. Jiminez 1,2, Trina C. Uwiera 3, D. Wade Abbott 1, Richard R. E. Uwiera 2* and G.

Gut Pathogens. Open Access RESEARCH. Janelle A. Jiminez 1,2, Trina C. Uwiera 3, D. Wade Abbott 1, Richard R. E. Uwiera 2* and G. DOI 10.1186/s13099-016-0149-6 Gut Pathogens RESEARCH Impacts of resistant starch and wheat bran consumption on enteric inflammation in relation to colonic bacterial community structures and short chain

More information

Microbial Population Differentials between Mucosal and Submucosal Intestinal Tissues in Advanced Crohn's Disease of the Ileum

Microbial Population Differentials between Mucosal and Submucosal Intestinal Tissues in Advanced Crohn's Disease of the Ileum RESEARCH ARTICLE Microbial Population Differentials between Mucosal and Submucosal Intestinal Tissues in Advanced Crohn's Disease of the Ileum Rodrick J. Chiodini 1,2 *, Scot E. Dowd 3, William M. Chamberlin

More information

Running Title: Microbial Ecology Network in Diverticulitis

Running Title: Microbial Ecology Network in Diverticulitis Running Title: Microbial Ecology Network in Diverticulitis The Microbial Ecosystem Distinguishes Chronically Diseased Tissue from Adjacent Tissue in the Sigmoid Colon of Chronic, Recurrent Diverticulitis

More information

Diet-induced extinction in the gut microbiota compounds over generations

Diet-induced extinction in the gut microbiota compounds over generations Diet-induced extinction in the gut microbiota compounds over generations The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation

More information

Asthma and the Airway Microbiome: New Insights and Hypotheses

Asthma and the Airway Microbiome: New Insights and Hypotheses Asthma and the Airway Microbiome: New Insights and Hypotheses Yvonne J. Huang, MD Division of Pulmonary and Critical Care Medicine Department of Internal Medicine University of Michigan, Ann Arbor 3 rd

More information

Structural changes of gut microbiota in mice with chronic constipation and intestinal tumor.

Structural changes of gut microbiota in mice with chronic constipation and intestinal tumor. Biomedical Research 017; 8 (): 1006-10067 ISSN 0970-938X www.biomedres.info Structural changes of gut microbiota in mice with chronic constipation and intestinal tumor. Yunpeng Luan 1,*, Dechang Mao, Min

More information

Paul Cotter Teagasc Food Research Centre & APC

Paul Cotter Teagasc Food Research Centre & APC http://apc.ucc.ie Research into the relationship between digestive bacteria, nutrition and health Paul Cotter Teagasc Food Research Centre & APC paul.cotter@teagasc.ie Our microbes - Some impressive facts

More information

Mary D. Boudreau,*,1 Greg R. Olson, Volodymyr P. Tryndyak,* Matthew S. Bryant,* Robert P. Felton, and Frederick A.

Mary D. Boudreau,*,1 Greg R. Olson, Volodymyr P. Tryndyak,* Matthew S. Bryant,* Robert P. Felton, and Frederick A. TOXICOLOGICAL SCIENCES, 158(2), 2017, 302 318 doi: 10.1093/toxsci/kfx105 Advance Access Publication Date: May 19, 2017 Research Article Aloin, a Component of the Aloe Vera Plant Leaf, Induces Pathological

More information

Intermittent hypoxia alters gut microbiota diversity in a mouse model of sleep apnoea

Intermittent hypoxia alters gut microbiota diversity in a mouse model of sleep apnoea ORIGINAL ARTICLE SLEEP alters gut microbiota diversity in a mouse model of sleep apnoea Isabel Moreno-Indias 1,2,9, Marta Torres 3,4,9, Josep M. Montserrat 3,4,, Lidia Sanchez-Alcoholado 1,2, Fernando

More information

Individual Apostichopus japonicus fecal microbiome reveals a link with polyhydroxybutyrate producers in host growth gaps

Individual Apostichopus japonicus fecal microbiome reveals a link with polyhydroxybutyrate producers in host growth gaps Individual Apostichopus japonicus fecal microbiome reveals a link with polyhydroxybutyrate producers in host growth gaps Yohei Yamazaki 1#, Pedro Milet Meirelles 2#, Sayaka Mino 1, Wataru Suda 3,4, Kenshiro

More information

High-Fat Diet Determines the Composition of the Murine Gut Microbiome Independently of Obesity

High-Fat Diet Determines the Composition of the Murine Gut Microbiome Independently of Obesity GASTROENTEROLOGY 2009;137:1716 1724 BASIC High-Fat Diet Determines the Composition of the Murine Gut Microbiome Independently of Obesity MARIE A. HILDEBRANDT,* CHRISTIAN HOFFMANN, SCOTT A. SHERRILL MIX,

More information

GUT MICROBIOME WHAT IS IT? WHY IS IT IMPORTANT FOR HUMAN HEALTH?

GUT MICROBIOME WHAT IS IT? WHY IS IT IMPORTANT FOR HUMAN HEALTH? GUT MICROBIOME WHAT IS IT? WHY IS IT IMPORTANT FOR HUMAN HEALTH? Corrie Whisner, PhD School of Nutrition and Health Promotion Arizona State University Center for Research on Ingredient Safety Annual Meeting

More information

The Gut Microbiome: Our Misunderstood Friend and Foe

The Gut Microbiome: Our Misunderstood Friend and Foe The Gut Microbiome: Our Misunderstood Friend and Foe Impact of the Gut Microbiome on Nutrients and non-nutrients Metabolism and Energy Availability. Dr Jean-Michel Antoine With the Functional Food, & the

More information

Characterization of the microbial communities along the gastrointestinal tract of sheep by 454 pyrosequencing analysis

Characterization of the microbial communities along the gastrointestinal tract of sheep by 454 pyrosequencing analysis Open Access Asian-Australas J Anim Sci Vol. 30, No. 1:100-110 January 2017 https://doi.org/10.5713/ajas.16.0166 pissn 1011-2367 eissn 1976-5517 Characterization of the microbial communities along the gastrointestinal

More information

Food & Function PAPER. 1. Introduction. Shan Li, a Junhui Li, a Guizhu Mao, a Tiantian Wu, Ding Tian, a Robert J. Linhardt

Food & Function PAPER. 1. Introduction. Shan Li, a Junhui Li, a Guizhu Mao, a Tiantian Wu, Ding Tian, a Robert J. Linhardt Food & Function PAPER View Journal View Issue Cite this: Food Funct., 2018,9, 5371 Received 12th June 2018, Accepted 21st August 2018 DOI: 10.1039/c8fo01174e rsc.li/food-function 1. Introduction A fucoidan

More information

Research Article Microflora Disturbance during Progression of Glucose Intolerance and Effect of Sitagliptin: An Animal Study

Research Article Microflora Disturbance during Progression of Glucose Intolerance and Effect of Sitagliptin: An Animal Study Journal of Diabetes Research Volume 2016, Article ID 2093171, 10 pages http://dx.doi.org/10.1155/2016/2093171 Research Article Microflora Disturbance during Progression of Glucose Intolerance and Effect

More information

Shifts on gut microbiota composition in an APP/PSS1 transgenic mouse model of Alzheimer s disease during lifespan

Shifts on gut microbiota composition in an APP/PSS1 transgenic mouse model of Alzheimer s disease during lifespan Shifts on gut microbiota composition in an APP/PSS1 transgenic mouse model of Alzheimer s disease during lifespan Journal: Applied Microbiology Manuscript ID Draft Journal Name: Letters in Applied Microbiology

More information

Prebiotics and food allergies

Prebiotics and food allergies Prebiotics and food allergies Cathryn Nagler, Ph.D. Committee on Immunology University of Chicago Workshop: Prebiotics Quantifying impact on host health Probiota Americas, Chicago, IL May 31, 2016 Oral

More information

THE EFFECTS OF EXERCISE AND ESTROGEN ON GUT MICROBIOTA IN FEMALE MICE REBECCA MELVIN. A thesis submitted to the. Graduate School-New Brunswick

THE EFFECTS OF EXERCISE AND ESTROGEN ON GUT MICROBIOTA IN FEMALE MICE REBECCA MELVIN. A thesis submitted to the. Graduate School-New Brunswick THE EFFECTS OF EXERCISE AND ESTROGEN ON GUT MICROBIOTA IN FEMALE MICE By REBECCA MELVIN A thesis submitted to the Graduate School-New Brunswick Rutgers, The State University of New Jersey In partial fulfillment

More information

Microbial DNA qpcr Array Metabolic Disorders

Microbial DNA qpcr Array Metabolic Disorders Microbial DNA qpcr Array Metabolic Disorders Cat. no. 330261 BAID-1406ZRA For real-time PCR-based, application-specific microbial identification or profiling The Metabolic Disorders Microbial DNA qpcr

More information

The gut microbiota in conventional and serrated precursors of colorectal cancer

The gut microbiota in conventional and serrated precursors of colorectal cancer Peters et al. Microbiome (2016) 4:69 DOI 10.1186/s40168-016-0218-6 RESEARCH The gut microbiota in conventional and serrated precursors of colorectal cancer Open Access Brandilyn A. Peters 1, Christine

More information

Characterisation of Gut Microbiota in Ossabaw and Göttingen Minipigs as Models of Obesity and Metabolic Syndrome

Characterisation of Gut Microbiota in Ossabaw and Göttingen Minipigs as Models of Obesity and Metabolic Syndrome Downloaded from orbit.dtu.dk on: Dec 12, 2018 Characterisation of Gut Microbiota in Ossabaw and Göttingen Minipigs as Models of Obesity and Metabolic Syndrome Pedersen, Rebecca; Ingerslev, Hans-Christian;

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12198 1. Supplementary results 1.1. Associations between gut microbiota, glucose control and medication Women with T2D who used metformin had increased levels of Enterobacteriaceae (i.e.

More information

Interpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE. GI Effects Comprehensive Profile - Stool. Patient: SAMPLE PATIENT

Interpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE. GI Effects Comprehensive Profile - Stool. Patient: SAMPLE PATIENT 3425 Corporate Way Duluth, GA 30096 Patient: AMPLE PATIENT GI Effects Comprehensive Profile - tool Interpretation At-a-Glance INFECTION INFLAMMATION INUFFICIENCY Calprotectin Pancreatic Elastase 1 Fecal

More information

Gestational diabetes is associated with change in the gut microbiota composition in third trimester of pregnancy and postpartum

Gestational diabetes is associated with change in the gut microbiota composition in third trimester of pregnancy and postpartum Crusell et al. Microbiome (2018) 6:89 https://doi.org/10.1186/s40168-018-0472-x RESEARCH Open Access Gestational diabetes is associated with change in the gut microbiota composition in third trimester

More information

High-throughput sequencing identifies distinct fecal and mucosal gut microbiota correlating with different mucosal proteins

High-throughput sequencing identifies distinct fecal and mucosal gut microbiota correlating with different mucosal proteins High-throughput sequencing identifies distinct fecal and mucosal gut microbiota correlating with different mucosal proteins Li-na Dong 1, Jun-ping Wang Corresp., 2, Ping Liu 3, Yun-feng Yang 2, Jing Feng

More information

Physiology of the Weaner Pig

Physiology of the Weaner Pig Physiology of the Weaner Pig Microbiota,, Gut Immunity and Performance Denise Kelly, Rowett Institute of Nutrition & Health, University of Aberdeen, Scotland Gut surfaces and Epithelial cells Gut Bacteria

More information

Links of gut microbiota composition with alcohol dependence syndrome and alcoholic liver disease

Links of gut microbiota composition with alcohol dependence syndrome and alcoholic liver disease Dubinkina et al. Microbiome (2017) 5:141 DOI 10.1186/s40168-017-0359-2 RESEARCH Open Access Links of gut microbiota composition with alcohol dependence syndrome and alcoholic liver disease Veronika B.

More information

Inflammatory bowel diseases (IBDs) including Crohn s

Inflammatory bowel diseases (IBDs) including Crohn s Imaging and Advanced Technology A Pyrosequencing Study in Twins Shows That Gastrointestinal Microbial Profiles Vary With Inflammatory Bowel Disease Phenotypes BEN P. WILLING,* JOHAN DICKSVED,* JONAS HALFVARSON,

More information

Intestinal colonization in premature and very low birth weight infants: Influencing factors and necrotizing enterocolitis (NEC)

Intestinal colonization in premature and very low birth weight infants: Influencing factors and necrotizing enterocolitis (NEC) Wageningen University Utrecht MASTER THESIS Intestinal colonization in premature and very low birth weight infants: Influencing factors and necrotizing enterocolitis (NEC) M.A.M. Lohuis, BSc Master Infection

More information

Interpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE RELATIVE ABUNDANCE GI Effects Comprehensive Profile - Stool.

Interpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE RELATIVE ABUNDANCE GI Effects Comprehensive Profile - Stool. 3425 Corporate Way Duluth, GA 30096 Patient: DOB: Sex: MRN: 2200 GI Effects Comprehensive Profile - Stool Interpretation At-a-Glance INFECTION INFAMMATION INSUFFICIENCY Pancreatic Elastase 1 IMBAANCE Beneficial

More information

Supplemental Information. Colonic Pro-inflammatory Macrophages. Cause Insulin Resistance in an Intestinal. Ccl2/Ccr2-Dependent Manner

Supplemental Information. Colonic Pro-inflammatory Macrophages. Cause Insulin Resistance in an Intestinal. Ccl2/Ccr2-Dependent Manner Cell Metabolism, Volume Supplemental Information Colonic Pro-inflammatory Macrophages Cause Insulin Resistance in an Intestinal Ccl/Ccr-Dependent Manner Yoshinaga Kawano, Jun Nakae, Nobuyuki Watanabe,

More information

Interpretation At-a-Glance

Interpretation At-a-Glance 3425 Corporate Way Duluth, GA 30096 Patient: AMPLE PATIENT DOB: ex: MRN: Order Number: Completed: Received: Collected: GI Effects Comprehensive Profile - tool Interpretation At-a-Glance INFECTION INFLAMMATION

More information

Consistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile

Consistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile Consistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile Infection: Application of a Novel Diagnostic for Dysbiosis Courtney Jones, BS Rebiotix Inc. Roseville, MN USA

More information

ISSN: (Print) (Online) Journal homepage:

ISSN: (Print) (Online) Journal homepage: Gut Microbes ISSN: 1949-0976 (Print) 1949-0984 (Online) Journal homepage: http://www.tandfonline.com/loi/kgmi20 The structures of the colonic mucosa-associated and luminal microbial communities are distinct

More information

Exercise is More Effective at Producing Robust, Lasting Changes in Gut Microbial Composition in Juvenile than in Adult Male F344 Rats

Exercise is More Effective at Producing Robust, Lasting Changes in Gut Microbial Composition in Juvenile than in Adult Male F344 Rats University of Colorado, Boulder CU Scholar Integrative Physiology Graduate Theses & Dissertations Integrative Physiology Spring 1-1-2014 Exercise is More Effective at Producing Robust, Lasting Changes

More information

Supplementary Table 1. Identification of bacterial sequences in different manure samples.

Supplementary Table 1. Identification of bacterial sequences in different manure samples. Supplementary Table 1. Identification of bacterial sequences in different manure samples. NA, 0 day of incubation N= 39 (5%) 98-100% 95-97% 94% Lactobacillus sp. DJF_WC57 (EU728799) 3 (99-100%) Porcine

More information

Research Article Gut Microbiome and Inflammation: A Study of Diabetic Inflammasome-Knockout Mice

Research Article Gut Microbiome and Inflammation: A Study of Diabetic Inflammasome-Knockout Mice Hindawi Diabetes Research Volume 217, Article ID 6519785, 5 pages https://doi.org/1.1155/217/6519785 Research Article Gut Microbiome and Inflammation: A Study of Diabetic Inflammasome-Knockout Mice Roma

More information

INFANT GUT MICROBIAL MARKERS OF FOOD SENSITIZATION AT AGE 1

INFANT GUT MICROBIAL MARKERS OF FOOD SENSITIZATION AT AGE 1 INFANT GUT MICROBIAL MARKERS OF FOOD SENSITIZATION AT AGE 1 Anita Kozyrskyj, PhD, Professor Dept Pediatrics, Faculty of Medicine & Dentistry School of Public Health, University of Alberta kozyrsky@ualberta.ca

More information

A diet based on cured acorn ham with oleic acid content promotes anti-inflammatory gut

A diet based on cured acorn ham with oleic acid content promotes anti-inflammatory gut 1 2 3 Article A diet based on cured acorn ham with oleic acid content promotes anti-inflammatory gut microbiota shifts and prevents ulcerative colitis in an animal model 4 5 6 J. Fernández, 1 V. García

More information

Analysis of the effect of probiotics on shaping human gut microbiota

Analysis of the effect of probiotics on shaping human gut microbiota Analysis of the effect of probiotics on shaping human gut microbiota Masahira HATTORI Center for Omics and Bioinformatics, The University of Tokyo http://www.cb.k.u-tokyo.ac.jp/hattorilab

More information

INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE

INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE TEST NAME: GI Effects - Comprehensive Profile - Stool 2200 GI Effects Comprehensive Profile Stool Interpretation At-a-Glance INFECTION INFLAMMATION INSUFFICIENCY IMBALANCE EPX Fecal Fats (Total) PP Bacteria

More information

Targeting the Microbiota-Gut-Brain Axis: Prebiotics Have Anxiolytic and Antidepressantlike Effects and Reverse the Impact of Chronic Stress in Mice

Targeting the Microbiota-Gut-Brain Axis: Prebiotics Have Anxiolytic and Antidepressantlike Effects and Reverse the Impact of Chronic Stress in Mice Archival Report Targeting the Microbiota-Gut-Brain Axis: Prebiotics Have Anxiolytic and Antidepressantlike Effects and Reverse the Impact of Chronic Stress in Mice Aurelijus Burokas, Silvia Arboleya, Rachel

More information

Fecal metagenomic profiles in subgroups of patients with myalgic encephalomyelitis/chronic fatigue syndrome

Fecal metagenomic profiles in subgroups of patients with myalgic encephalomyelitis/chronic fatigue syndrome Fecal metagenomic profiles in subgroups of patients with myalgic encephalomyelitis/chronic fatigue syndrome The Harvard community has made this article openly available. Please share how this access benefits

More information

Although the bacterial community in the oral cavity may comprise over 700 species

Although the bacterial community in the oral cavity may comprise over 700 species Exploring Bacterial Diversity of Endodontic Microbiota by Cloning and Sequencing 16S rrna Adriana C. Ribeiro, PhD,* Flavia Matarazzo, PhD,* Marcelo Faveri, PhD, Denise M. Zezell, PhD, and Marcia P.A. Mayer,

More information

Ecology of bacteria in the human gastrointestinal tract identification of keystone and foundation taxa

Ecology of bacteria in the human gastrointestinal tract identification of keystone and foundation taxa Trosvik and Muinck Microbiome (2015) 3:44 DOI 10.1186/s40168-015-0107-4 RESEARCH Open Access Ecology of bacteria in the human gastrointestinal tract identification of keystone and foundation taxa Pål Trosvik

More information

Gut microbiota in experimental murine model of Graves orbitopathy established in different environments may modulate clinical presentation of disease

Gut microbiota in experimental murine model of Graves orbitopathy established in different environments may modulate clinical presentation of disease Masetti et al. Microbiome (2018) 6:97 https://doi.org/10.1186/s40168-018-0478-4 RESEARCH Gut microbiota in experimental murine model of Graves orbitopathy established in different environments may modulate

More information

Role of colonic microbiota in the pathogenesis of ulcerative colitis

Role of colonic microbiota in the pathogenesis of ulcerative colitis Pei et al. BMC Gastroenterology (2019) 19:10 https://doi.org/10.1186/s12876-019-0930-3 RESEARCH ARTICLE Role of colonic microbiota in the pathogenesis of ulcerative colitis Ling-yan Pei 1,2, Yu-shi Ke

More information

MICROBIOME ANALYSIS REPORT

MICROBIOME ANALYSIS REPORT MICROBIOME ANALYSIS REPORT Client name: N.E. Body Order No.: 6140 Report date: 2018-04-19 Sample Type: Gut Sample Barcode: 322672 Report Type: Single Hello Please find enclosed the results of your personalised

More information

INTRODUCTION. Ireland

INTRODUCTION. Ireland Microbiology (215), 161, 182 193 DOI 1.199/mic..8261- Streptozotocin-induced type-1-diabetes disease onset in Sprague Dawley rats is associated with an altered intestinal microbiota composition and decreased

More information

Modulation of Body Weight by Intestinal Flora in Orphan Nuclear Receptor SHP-/- Mice

Modulation of Body Weight by Intestinal Flora in Orphan Nuclear Receptor SHP-/- Mice The University of Akron IdeaExchange@UAkron Honors Research Projects The Dr. Gary B. and Pamela S. Williams Honors College Spring 2016 Modulation of Body Weight by Intestinal Flora in Orphan Nuclear Receptor

More information

6/24/2014. How do you study microbial communities? Outnumbers Cells of the Body 10:1 Outnumber Human Genes 100:1. Michael T. Bailey, Ph.D.

6/24/2014. How do you study microbial communities? Outnumbers Cells of the Body 10:1 Outnumber Human Genes 100:1. Michael T. Bailey, Ph.D. Interactions between Diet and the Intestinal Microbiota: Implications for Obesity The Body is Colonized by an Enormous Array of Bacteria Outnumbers Cells of the Body 10:1 Outnumber Human Genes 100:1 Michael

More information

Different Flavonoids Can Shape Unique Gut Microbiota Profile In Vitro

Different Flavonoids Can Shape Unique Gut Microbiota Profile In Vitro Different Flavonoids Can Shape Unique Gut Microbiota Profile In Vitro Jiacheng Huang, Long Chen, Bin Xue, Qianyue Liu, Shiyi Ou, Yong Wang, and Xichun Peng Abstract: The impact of flavonoids has been discussed

More information

1. Introduction. Correspondence should be addressed to Shujie Chen;

1. Introduction. Correspondence should be addressed to Shujie Chen; Gastroenterology Research and Practice, Article ID 696178, 9 pages https://doi.org/1.11/18/696178 Research Article Altered Intestinal Microbiota with Increased Abundance of Prevotella Is Associated with

More information

Cordycepin reduces weight through regulating gut microbiota in high-fat dietinduced

Cordycepin reduces weight through regulating gut microbiota in high-fat dietinduced An et al. Lipids in Health and Disease (2018) 17:276 https://doi.org/10.1186/s12944-018-0910-6 RESEARCH Cordycepin reduces weight through regulating gut microbiota in high-fat dietinduced obese rats Open

More information

Super-organism. 2 kg microbes microbial cells (10 12 human cells) 10M microbial genes (25000 human genes)

Super-organism. 2 kg microbes microbial cells (10 12 human cells) 10M microbial genes (25000 human genes) Microbiology and NGS Henrik Bjørn Nielsen Center for Biological Sequence Analysis, Department of Systems Biology, Technical University of Denmark hbjorn@cbs.dtu.dk Microbiome Super-organism 2 kg microbes

More information

DO SWEETENERS AFFECT THE GUT MICROBIOME?

DO SWEETENERS AFFECT THE GUT MICROBIOME? DO SWEETENERS AFFECT THE GUT MICROBIOME? What does the science and evidence tell us? Alexandra Lobach, M.Sc., Ph.D. Manager, Toxicology, Chemistry & Regulatory Affairs Food & Nutrition Health, Environmental

More information

HIV-associated changes in the enteric microbial community: potential role in loss of homeostasis and development of systemic inflammation

HIV-associated changes in the enteric microbial community: potential role in loss of homeostasis and development of systemic inflammation HIV-associated changes in the enteric microbial community: potential role in loss of homeostasis and development of systemic inflammation The Harvard community has made this article openly available. Please

More information

- B [6] (TAC) [DOI] /j.issn

- B [6] (TAC) [DOI] /j.issn 88 216 1 1 41 1 [ ] (TAC) 12 C57BL/6 (N ) ( ) 6 N 22d 16S rdna N [ ] [ ] R543.1 [ ] A [ ] 577-742(216)1-88-5 [DOI] 1.11855/j.issn.577-742.216.1.4 Intestinal flora changes in a mouse model of transverse

More information

Meta-Omic Platforms to Assist in the Understanding of NAFLD Gut Microbiota Alterations: Tools and Applications

Meta-Omic Platforms to Assist in the Understanding of NAFLD Gut Microbiota Alterations: Tools and Applications Int. J. Mol. Sci. 2014, 15, 684-711; doi:10.3390/ijms15010684 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Meta-Omic Platforms to Assist in the

More information

Gut microbiota, diet, and obesity-related disorders The good, the bad, and the future challenges

Gut microbiota, diet, and obesity-related disorders The good, the bad, and the future challenges Mol. Nutr. Food Res. 61, 1, 2017, 1600252 (1 of 17) 1600252 DOI 10.1002/mnfr.201600252 REVIEW Gut microbiota, diet, and obesity-related disorders The good, the bad, and the future challenges Kevin J. Portune,

More information

Purified rutin and rutin-rich asparagus attenuates disease severity and tissue damage following dextran sodium sulfate-induced colitis

Purified rutin and rutin-rich asparagus attenuates disease severity and tissue damage following dextran sodium sulfate-induced colitis 2396 Mol. Nutr. Food Res. 2016, 60, 2396 2412 DOI 10.1002/mnfr.201500890 RESEARCH ARTICLE Purified rutin and rutin-rich asparagus attenuates disease severity and tissue damage following dextran sodium

More information

Research Article Colonic Mucosal Microbiota in Colorectal Cancer: A Single-Center Metagenomic Study in Saudi Arabia

Research Article Colonic Mucosal Microbiota in Colorectal Cancer: A Single-Center Metagenomic Study in Saudi Arabia Gastroenterology Research and Practice, Article ID 5284754, 9 pages https://doi.org/10.1155/2018/5284754 Research Article Colonic Mucosal Microbiota in Colorectal Cancer: A Single-Center Metagenomic Study

More information

Lipid hydrolysis products affect the composition of infant gut microbial communities in vitro

Lipid hydrolysis products affect the composition of infant gut microbial communities in vitro , page 1 of 1 q The Authors 15 doi:1.117/s711515811 Lipid hydrolysis products affect the composition of infant gut microbial communities in vitro Rikke G. Nejrup 1,, Martin I. Bahl, Louise K. Vigsnæs,

More information

THE EFFECTS OF ORAL PROBIOTIC SUPPLEMENTS ON THE HUMAN GUT MICROBIOME. By Erin Kyle Hudnall. Oxford May 2016

THE EFFECTS OF ORAL PROBIOTIC SUPPLEMENTS ON THE HUMAN GUT MICROBIOME. By Erin Kyle Hudnall. Oxford May 2016 THE EFFECTS OF ORAL PROBIOTIC SUPPLEMENTS ON THE HUMAN GUT MICROBIOME By Erin Kyle Hudnall A thesis submitted to the faculty of The University of Mississippi in partial fulfillment of the requirements

More information