Biostatistical modelling in genomics for clinical cancer studies
|
|
- Albert Dixon
- 5 years ago
- Views:
Transcription
1 This work was supported by Entente Cordiale Cancer Research Bursaries Biostatistical modelling in genomics for clinical cancer studies Philippe Broët JE 2492 Faculté de Médecine Paris-Sud In collaboration with S. Richardson Imperial College London Statistical Latent Variables Models in the Health Sciences Perugia, Italy, 6-8 September 2006
2 Outline Genomic biotechnologies in clinical research Introduction Comparative Genomic Hybridization (CGH) Spatial mixture model-based approach Model Performance Clinical example: Lung carcinoma study Conclusion
3 Introduction
4 Genomic-oriented biotechnologies thousands of information from one sample
5 Genomic-oriented biotechnologies thousands of information from one sample CGH µarray DNA
6 Genomic-oriented biotechnologies thousands of information from one sample CGH µarray DNA cdna/oligo µarray mrna
7 Genomic-oriented biotechnologies thousands of information from one sample CGH µarray DNA cdna/oligo µarrayµ mrna Protein µarray Protein
8 Context: Cancer Research Analysis of copy number changes of genomic sequences Loss Gain Tumor supressor gene Oncogene Amplification of an oncogene or Deletion of a tumor suppressor gene important mechanisms for tumorigenesis
9 Tumor suppressor gene = Break - Oncogene = Accelerator + Normal cell
10 Tumor suppressor genes - (e.g. p15)
11 Tumor suppressor genes - Oncogenes +++ (e.g. p15) (e.g. EGFR)
12 Tumor suppressor genes - Oncogenes +++ (e.g. p15) (e.g. EGFR) Cancer cell
13 Tumor Normal 1. Extraction (DNA) 2. Labelling (fluo) 3. (Co)-hybridization (oligo/bac) 4. Scanning
14 Tumor Normal 1. Extraction (DNA) 2. Labelling (fluo) 3. (Co)-hybridization (oligo/bac) 4. Scanning Quantitative measures of DNA content Statistical challenges Provide genomic status information (deletion/gain/modal) Estimate the error rate of the allocation
15 Spatial mixture model
16 Mixture model approach Z ik (observed log-ratio) measurement for the i th GS ordered along the chromosome k 3 latent states (mixture model): loss / modal / gain copy state loss gain modal Z ik
17 Mixture model approach Z ik (observed log-ratio) measurement for the i th GS ordered along the chromosome k 3 latent states (mixture model): loss / modal / gain copy state loss f(./θ L ) modal f(./θ M ) gain f(./θ G ) Z ik
18 Mixture model approach Z ik (observed log-ratio) measurement for the i th GS ordered along the chromosome k 3 latent states (mixture model): loss / modal / gain copy state loss f(./θ L ) modal f(./θ M ) gain f(./θ G ) Z i-k Z ik Z i+k
19 Mixture model framework c=-1,0,1 c w c i k : mixing proportion (or weight) for state c f c (./θ): conditional density for state c Latent structure for mixture model L ik an unobserved (latent) categorical variable taking the values (c=-1,0,1) with probability w c i k f c (./θ): N(./µ c, 2 c) Z ik /L ik =c ~ f c (./θ)
20 Spatial structure on the weights (w c i k w c ) Introduce 3 centred Markov random fields {x c i k } with nearest neighbours along the chromosomes Spatial neighbours of GS g x x x g -1 g g+1 Define weights (mixture proportions) to depend on the chromosomic location via a logistic model: with x c i k (latent) spatial variable => favours allocation of nearby GS to same component
21 Three latent Markov random fields x k c = {x c 1 k ;...; x c I k } having Intrinsic Gaussian conditional autoregression (ICAR) prior for δ ik = neighbour of i (m ik = #h), with constraint Σ ik x c 1 k = 0 Variance parameters τ c k2 of the ICAR act as a smoothing prior Switching structure between the states can be different between chromosomes Conditional density f c (./θ): N(./µ c, 2 c) Mean and variances (µ c,η c2 ) of the mixture components are common to all chromosomes borrowing information
22 Inference & quantities of interest Bayesian inference via MCMC In particular, latent state allocations, L ik of GS are sampled during the MCMC run Compute posterior probabilities p c ik= P(L ik = c data), c =-1,0,1 Estimated within the algorithm by counting the number of times where the GS is in state c divided by the length of the simulation run
23 Probabilistic allocation We allocate a sequence to a modified state (loss/gain copy state) if its posterior probability is above a threshold (otherwise allocate to modal state) =>Subset S of genomic sequences classified as modified (deleted/amplified) Error rate estimate FDR S = (1/M)Σ m S p* 0m M is the size of set S P* 0 = posterior probability of not being allocated to the modal state -> Can adjust the threshold to get a desired FDR and vice versa
24 Performance of the model
25 Simulation set-up 200 fake genomic sequences loss : Z ik /L c i =-1 k ~ N(./µ -1 =(-0.7;-0.4), 2 = ) modal : Z ik /L c i =0 k ~ N(./µ 0 =0, 2 = ) gain : Z ik /L c i =+1 k ~ N(./µ +1 = (+0.7;+0.4), 2 = ) 50 simulated sets
26 Simulation set-up 200 fake genomic sequences loss : Z ik /L c i =-1 k ~ N(./µ -1 =(-0.7;-0.4), 2 = ) modal : Z ik /L c i =0 k ~ N(./µ 0 =0, 2 = ) gain : Z ik /L c i =+1 k ~ N(./µ +1 = (+0.7;+0.4), 2 = ) 50 simulated sets Pattern of genomic alterations
27 Calculate the realized (estimated) FDR, TPF, TNF realized FDR = realized TPF = (Se) realized TNF = (Sp) # realized false discoveries (belonging to the modal copy state but claimed as modified) # discoveries # realized discoveries # true positives (truly modified sequences) # realized non discoveries # true negatives (truly unmodified sequences) Compare Spatial mixture-model Classical mixture model (without spatial structure) Spatial agglomerative clustering (CGH-Miner, Wang et al., 2005) same FDR target (FDR default of 1% for CGH-Miner)
28 Model performance Operational characteristics
29 Model performance Operational characteristics
30 Model performance FDR estimation threshold threshold threshold
31 Model performance FDR estimation threshold threshold threshold
32 Results Spatial mixture model-based approach Good operating characteristics: Better Se/Sp than the independent mixture model Powerful detection of genomic changes Reliable FDR estimate
33 Clinical example
34 Lung Cancer Study In collaboration with GIS/NCC-Singapore (L. Miller, P. Tan) Samples selection Primary lung adenocarcinoma (pt2n0) Quality of frozen tissue (presence of tumor cells) was checked by cytological apposition CGH technology 32K BAC arrays (2 Chips) Co-hybridization tumoral/normal sample
35
36
37 Individual threshold related to 5% FDR target
38 Cyclin D1 Immunohistochemistry Gene amplification and protein overexpression No gene amplification no protein expression
39 Conclusion
40 Spatial mixture model Interesting operational performance Selection of interesting GS based on an error criteria More powerful than independent mixture model Extension Incorporating genomic location information (distance function) Incorporate additional components Consider other selection rules
41
Bayesian hierarchical modelling
Bayesian hierarchical modelling Matthew Schofield Department of Mathematics and Statistics, University of Otago Bayesian hierarchical modelling Slide 1 What is a statistical model? A statistical model:
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More informationFalse Discovery Rates and Copy Number Variation. Bradley Efron and Nancy Zhang Stanford University
False Discovery Rates and Copy Number Variation Bradley Efron and Nancy Zhang Stanford University Three Statistical Centuries 19th (Quetelet) Huge data sets, simple questions 20th (Fisher, Neyman, Hotelling,...
More informationHarvard University. A Pseudolikelihood Approach for Simultaneous Analysis of Array Comparative Genomic Hybridizations (acgh)
Harvard University Harvard University Biostatistics Working Paper Series Year 2005 Paper 30 A Pseudolikelihood Approach for Simultaneous Analysis of Array Comparative Genomic Hybridizations (acgh) David
More informationDesign for Targeted Therapies: Statistical Considerations
Design for Targeted Therapies: Statistical Considerations J. Jack Lee, Ph.D. Department of Biostatistics University of Texas M. D. Anderson Cancer Center Outline Premise General Review of Statistical Designs
More informationBayesian Joint Modelling of Benefit and Risk in Drug Development
Bayesian Joint Modelling of Benefit and Risk in Drug Development EFSPI/PSDM Safety Statistics Meeting Leiden 2017 Disclosure is an employee and shareholder of GSK Data presented is based on human research
More informationA fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data
A fully Bayesian approach for the analysis of Whole-Genome Bisulfite Sequencing Data Leonardo Bottolo 1,2,3 1 Department of Medical Genetics, University of Cambridge, UK 2 The Alan Turing Institute, London,
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationBayesian Random SegmentationModels to Identify Shared Copy Number Aberrations for Array CGH Data
From the SelectedWorks of Veera Baladandayuthapani 2 Bayesian Random SegmentationModels to Identify Shared Copy Number Aberrations for Array CGH Data Veera Baladandayuthapani Available at: https://works.bepress.com/veera/3/
More informationInformation Systems Mini-Monograph
Information Systems Mini-Monograph Interpreting Posterior Relative Risk Estimates in Disease-Mapping Studies Sylvia Richardson, Andrew Thomson, Nicky Best, and Paul Elliott Small Area Health Statistics
More informationBoosted PRIM with Application to Searching for Oncogenic Pathway of Lung Cancer
Boosted PRIM with Application to Searching for Oncogenic Pathway of Lung Cancer Pei Wang Department of Statistics Stanford University Stanford, CA 94305 wp57@stanford.edu Young Kim, Jonathan Pollack Department
More informationMissing data. Patrick Breheny. April 23. Introduction Missing response data Missing covariate data
Missing data Patrick Breheny April 3 Patrick Breheny BST 71: Bayesian Modeling in Biostatistics 1/39 Our final topic for the semester is missing data Missing data is very common in practice, and can occur
More informationAnalysis of acgh data: statistical models and computational challenges
: statistical models and computational challenges Ramón Díaz-Uriarte 2007-02-13 Díaz-Uriarte, R. acgh analysis: models and computation 2007-02-13 1 / 38 Outline 1 Introduction Alternative approaches What
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationBayesian Random Segmentation Models to Identify Shared Copy Number Aberrations for Array CGH Data
Supplementary materials for this article are available online. Please click the JASA link at http://pubs.amstat.org. Bayesian Random Segmentation Models to Identify Shared Copy Number Aberrations for Array
More informationIndividual Differences in Attention During Category Learning
Individual Differences in Attention During Category Learning Michael D. Lee (mdlee@uci.edu) Department of Cognitive Sciences, 35 Social Sciences Plaza A University of California, Irvine, CA 92697-5 USA
More informationT-Statistic-based Up&Down Design for Dose-Finding Competes Favorably with Bayesian 4-parameter Logistic Design
T-Statistic-based Up&Down Design for Dose-Finding Competes Favorably with Bayesian 4-parameter Logistic Design James A. Bolognese, Cytel Nitin Patel, Cytel Yevgen Tymofyeyef, Merck Inna Perevozskaya, Wyeth
More informationRisk-prediction modelling in cancer with multiple genomic data sets: a Bayesian variable selection approach
Risk-prediction modelling in cancer with multiple genomic data sets: a Bayesian variable selection approach Manuela Zucknick Division of Biostatistics, German Cancer Research Center Biometry Workshop,
More informationBayesian Nonparametric Methods for Precision Medicine
Bayesian Nonparametric Methods for Precision Medicine Brian Reich, NC State Collaborators: Qian Guan (NCSU), Eric Laber (NCSU) and Dipankar Bandyopadhyay (VCU) University of Illinois at Urbana-Champaign
More informationA Strategy for Identifying Putative Causes of Gene Expression Variation in Human Cancer
A Strategy for Identifying Putative Causes of Gene Expression Variation in Human Cancer Hautaniemi, Sampsa; Ringnér, Markus; Kauraniemi, Päivikki; Kallioniemi, Anne; Edgren, Henrik; Yli-Harja, Olli; Astola,
More informationBayesian Models for Combining Data Across Subjects and Studies in Predictive fmri Data Analysis
Bayesian Models for Combining Data Across Subjects and Studies in Predictive fmri Data Analysis Thesis Proposal Indrayana Rustandi April 3, 2007 Outline Motivation and Thesis Preliminary results: Hierarchical
More informationAspects of Statistical Modelling & Data Analysis in Gene Expression Genomics. Mike West Duke University
Aspects of Statistical Modelling & Data Analysis in Gene Expression Genomics Mike West Duke University Papers, software, many links: www.isds.duke.edu/~mw ABS04 web site: Lecture slides, stats notes, papers,
More informationWinBUGS : part 1. Bruno Boulanger Jonathan Jaeger Astrid Jullion Philippe Lambert. Gabriele, living with rheumatoid arthritis
WinBUGS : part 1 Bruno Boulanger Jonathan Jaeger Astrid Jullion Philippe Lambert Gabriele, living with rheumatoid arthritis Agenda 2 Introduction to WinBUGS Exercice 1 : Normal with unknown mean and variance
More informationT. R. Golub, D. K. Slonim & Others 1999
T. R. Golub, D. K. Slonim & Others 1999 Big Picture in 1999 The Need for Cancer Classification Cancer classification very important for advances in cancer treatment. Cancers of Identical grade can have
More informationBayesian Statistics Estimation of a Single Mean and Variance MCMC Diagnostics and Missing Data
Bayesian Statistics Estimation of a Single Mean and Variance MCMC Diagnostics and Missing Data Michael Anderson, PhD Hélène Carabin, DVM, PhD Department of Biostatistics and Epidemiology The University
More informationSelection of Linking Items
Selection of Linking Items Subset of items that maximally reflect the scale information function Denote the scale information as Linear programming solver (in R, lp_solve 5.5) min(y) Subject to θ, θs,
More informationBayesian Inference Bayes Laplace
Bayesian Inference Bayes Laplace Course objective The aim of this course is to introduce the modern approach to Bayesian statistics, emphasizing the computational aspects and the differences between the
More informationBayesian Prediction Tree Models
Bayesian Prediction Tree Models Statistical Prediction Tree Modelling for Clinico-Genomics Clinical gene expression data - expression signatures, profiling Tree models for predictive sub-typing Combining
More informationIdentification of regions with common copy-number variations using SNP array
Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration
More informationBayesian growth mixture models to distinguish hemoglobin value trajectories in blood donors
Bayesian growth mixture models to distinguish hemoglobin value trajectories in blood donors Kazem Nasserinejad 1 Joost van Rosmalen 1 Mireille Baart 2 Katja van den Hurk 2 Dimitris Rizopoulos 1 Emmanuel
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationOrdinal Data Modeling
Valen E. Johnson James H. Albert Ordinal Data Modeling With 73 illustrations I ". Springer Contents Preface v 1 Review of Classical and Bayesian Inference 1 1.1 Learning about a binomial proportion 1 1.1.1
More informationPackage xseq. R topics documented: September 11, 2015
Package xseq September 11, 2015 Title Assessing Functional Impact on Gene Expression of Mutations in Cancer Version 0.2.1 Date 2015-08-25 Author Jiarui Ding, Sohrab Shah Maintainer Jiarui Ding
More informationBayesian meta-analysis of Papanicolaou smear accuracy
Gynecologic Oncology 107 (2007) S133 S137 www.elsevier.com/locate/ygyno Bayesian meta-analysis of Papanicolaou smear accuracy Xiuyu Cong a, Dennis D. Cox b, Scott B. Cantor c, a Biometrics and Data Management,
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationProtocol to Patient (P2P)
Protocol to Patient (P2P) Ghulam Warsi 1, Kert Viele 2, Lebedinsky Claudia 1,, Parasuraman Sudha 1, Eric Slosberg 1, Barinder Kang 1, August Salvado 1, Lening Zhang 1, Donald A. Berry 2 1 Novartis Pharmaceuticals
More informationExperimental Design For Microarray Experiments. Robert Gentleman, Denise Scholtens Arden Miller, Sandrine Dudoit
Experimental Design For Microarray Experiments Robert Gentleman, Denise Scholtens Arden Miller, Sandrine Dudoit Copyright 2002 Complexity of Genomic data the functioning of cells is a complex and highly
More informationAtt vara eller inte vara (en Bayesian)?... Sherlock-conundrum
Att vara eller inte vara (en Bayesian)?... Sherlock-conundrum (Thanks/blame to Google Translate) Gianluca Baio University College London Department of Statistical Science g.baio@ucl.ac.uk http://www.ucl.ac.uk/statistics/research/statistics-health-economics/
More informationIntroduction to Discrimination in Microarray Data Analysis
Introduction to Discrimination in Microarray Data Analysis Jane Fridlyand CBMB University of California, San Francisco Genentech Hall Auditorium, Mission Bay, UCSF October 23, 2004 1 Case Study: Van t
More informationDetection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit
APPLICATION NOTE Ion PGM System Detection of aneuploidy in a single cell using the Ion ReproSeq PGS View Kit Key findings The Ion PGM System, in concert with the Ion ReproSeq PGS View Kit and Ion Reporter
More informationMultilevel IRT for group-level diagnosis. Chanho Park Daniel M. Bolt. University of Wisconsin-Madison
Group-Level Diagnosis 1 N.B. Please do not cite or distribute. Multilevel IRT for group-level diagnosis Chanho Park Daniel M. Bolt University of Wisconsin-Madison Paper presented at the annual meeting
More informationHuman Cancer Genome Project. Bioinformatics/Genomics of Cancer:
Bioinformatics/Genomics of Cancer: Professor of Computer Science, Mathematics and Cell Biology Courant Institute, NYU School of Medicine, Tata Institute of Fundamental Research, and Mt. Sinai School of
More informationHierarchical Bayesian Modeling of Individual Differences in Texture Discrimination
Hierarchical Bayesian Modeling of Individual Differences in Texture Discrimination Timothy N. Rubin (trubin@uci.edu) Michael D. Lee (mdlee@uci.edu) Charles F. Chubb (cchubb@uci.edu) Department of Cognitive
More informationStatistics 202: Data Mining. c Jonathan Taylor. Final review Based in part on slides from textbook, slides of Susan Holmes.
Final review Based in part on slides from textbook, slides of Susan Holmes December 5, 2012 1 / 1 Final review Overview Before Midterm General goals of data mining. Datatypes. Preprocessing & dimension
More informationIntroduction to Bayesian Analysis 1
Biostats VHM 801/802 Courses Fall 2005, Atlantic Veterinary College, PEI Henrik Stryhn Introduction to Bayesian Analysis 1 Little known outside the statistical science, there exist two different approaches
More informationGene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering
Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene
More informationIntroduction. We can make a prediction about Y i based on X i by setting a threshold value T, and predicting Y i = 1 when X i > T.
Diagnostic Tests 1 Introduction Suppose we have a quantitative measurement X i on experimental or observed units i = 1,..., n, and a characteristic Y i = 0 or Y i = 1 (e.g. case/control status). The measurement
More informationA HIERARCHICAL BAYESIAN MODEL FOR INFERENCE OF COPY NUMBER VARIANTS AND THEIR ASSOCIATION TO GENE EXPRESSION
The Annals of Applied Statistics 2014, Vol. 8, No. 1, 148 175 DOI: 10.1214/13-AOAS705 Institute of Mathematical Statistics, 2014 A HIERARCHICAL BAYESIAN MODEL FOR INFERENCE OF COPY NUMBER VARIANTS AND
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationAnalysis of CGH and SNP arrays for the detection of chromosomal aberrations in single cells
Analysis of CGH and SNP arrays for the detection of chromosomal aberrations in single cells Peter Konings 1 Evelyne Vanneste 1,2 Thierry Voet 1 Cédric Le Caignec 1 Michèle Ampe 1 Cindy Melotte 1 Sophie
More informationOutlier Analysis. Lijun Zhang
Outlier Analysis Lijun Zhang zlj@nju.edu.cn http://cs.nju.edu.cn/zlj Outline Introduction Extreme Value Analysis Probabilistic Models Clustering for Outlier Detection Distance-Based Outlier Detection Density-Based
More informationKnowledge Discovery and Data Mining I
Ludwig-Maximilians-Universität München Lehrstuhl für Datenbanksysteme und Data Mining Prof. Dr. Thomas Seidl Knowledge Discovery and Data Mining I Winter Semester 2018/19 Introduction What is an outlier?
More information10CS664: PATTERN RECOGNITION QUESTION BANK
10CS664: PATTERN RECOGNITION QUESTION BANK Assignments would be handed out in class as well as posted on the class blog for the course. Please solve the problems in the exercises of the prescribed text
More informationGenomics Research. May 31, Malvika Pillai
Genomics Research May 31, 2018 Malvika Pillai Outline for Research Discussion Why Informatics Read journal articles! Example Paper Presentation Research Pipeline How To Read A Paper If I m aiming to just
More informationData Analysis Using Regression and Multilevel/Hierarchical Models
Data Analysis Using Regression and Multilevel/Hierarchical Models ANDREW GELMAN Columbia University JENNIFER HILL Columbia University CAMBRIDGE UNIVERSITY PRESS Contents List of examples V a 9 e xv " Preface
More informationGianluca Baio. University College London Department of Statistical Science.
Bayesian hierarchical models and recent computational development using Integrated Nested Laplace Approximation, with applications to pre-implantation genetic screening in IVF Gianluca Baio University
More informationarxiv: v2 [stat.ap] 11 Apr 2018
A Novel Bayesian Multiple Testing Approach to Deregulated mirna Discovery Harnessing Positional Clustering Noirrit Kiran Chandra 1, Richa Singh 2 and Sourabh Bhattacharya 1 1 Interdisciplinary Statistical
More informationInference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
More informationJoint Spatio-Temporal Modeling of Low Incidence Cancers Sharing Common Risk Factors
Journal of Data Science 6(2008), 105-123 Joint Spatio-Temporal Modeling of Low Incidence Cancers Sharing Common Risk Factors Jacob J. Oleson 1,BrianJ.Smith 1 and Hoon Kim 2 1 The University of Iowa and
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationOncoPhase: Quantification of somatic mutation cellular prevalence using phase information
OncoPhase: Quantification of somatic mutation cellular prevalence using phase information Donatien Chedom-Fotso 1, 2, 3, Ahmed Ashour Ahmed 1, 2, and Christopher Yau 3, 4 1 Ovarian Cancer Cell Laboratory,
More informationImproving ecological inference using individual-level data
Improving ecological inference using individual-level data Christopher Jackson, Nicky Best and Sylvia Richardson Department of Epidemiology and Public Health, Imperial College School of Medicine, London,
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationNeoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
More informationA Case Study: Two-sample categorical data
A Case Study: Two-sample categorical data Patrick Breheny January 31 Patrick Breheny BST 701: Bayesian Modeling in Biostatistics 1/43 Introduction Model specification Continuous vs. mixture priors Choice
More informationExpanded View Figures
Solip Park & Ben Lehner Epistasis is cancer type specific Molecular Systems Biology Expanded View Figures A B G C D E F H Figure EV1. Epistatic interactions detected in a pan-cancer analysis and saturation
More informationThe Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0
The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used
More informationSensitivity of heterogeneity priors in meta-analysis
Sensitivity of heterogeneity priors in meta-analysis Ma lgorzata Roos BAYES2015, 19.-22.05.2015 15/05/2015 Page 1 Bayesian approaches to incorporating historical information in clinical trials Joint work
More informationAPPENDIX AVAILABLE ON REQUEST. HEI Panel on the Health Effects of Traffic-Related Air Pollution
APPENDIX AVAILABLE ON REQUEST Special Report 17 Traffic-Related Air Pollution: A Critical Review of the Literature on Emissions, Exposure, and Health Effects Chapter 3. Assessment of Exposure to Traffic-Related
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationUsing mixture priors for robust inference: application in Bayesian dose escalation trials
Using mixture priors for robust inference: application in Bayesian dose escalation trials Astrid Jullion, Beat Neuenschwander, Daniel Lorand BAYES2014, London, 11 June 2014 Agenda Dose escalation in oncology
More informationBayesians methods in system identification: equivalences, differences, and misunderstandings
Bayesians methods in system identification: equivalences, differences, and misunderstandings Johan Schoukens and Carl Edward Rasmussen ERNSI 217 Workshop on System Identification Lyon, September 24-27,
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationBayesian methods in health economics
Bayesian methods in health economics Gianluca Baio University College London Department of Statistical Science g.baio@ucl.ac.uk Seminar Series of the Master in Advanced Artificial Intelligence Madrid,
More informationSensory Cue Integration
Sensory Cue Integration Summary by Byoung-Hee Kim Computer Science and Engineering (CSE) http://bi.snu.ac.kr/ Presentation Guideline Quiz on the gist of the chapter (5 min) Presenters: prepare one main
More informationGenome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre
Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Structural variation (SVs) Copy-number variations C Deletion A B C Balanced rearrangements A B A B C B A C Duplication Inversion Causes
More informationGenetic alterations of histone lysine methyltransferases and their significance in breast cancer
Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the
More informationComputational Analysis of Genome-Wide DNA Copy Number Changes
Computational Analysis of Genome-Wide DNA Copy Number Changes Lei Song Thesis submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements
More informationKelvin Chan Feb 10, 2015
Underestimation of Variance of Predicted Mean Health Utilities Derived from Multi- Attribute Utility Instruments: The Use of Multiple Imputation as a Potential Solution. Kelvin Chan Feb 10, 2015 Outline
More informationCARISMA-LMS Workshop on Statistics for Risk Analysis
Department of Mathematics CARISMA-LMS Workshop on Statistics for Risk Analysis Thursday 28 th May 2015 Location: Department of Mathematics, John Crank Building, Room JNCK128 (Campus map can be found at
More informationA Multi-Sample Based Method for Identifying Common CNVs in Normal Human Genomic Structure Using High- Resolution acgh Data
A Multi-Sample Based Method for Identifying Common CNVs in Normal Human Genomic Structure Using High- Resolution acgh Data Chihyun Park 1, Jaegyoon Ahn 1, Youngmi Yoon 2, Sanghyun Park 1 * 1 Department
More informationSystematic Analysis for Identification of Genes Impacting Cancers
Systematic Analysis for Identification of Genes Impacting Cancers Arpita Singhal Stanford University Saint Francis High School ABSTRACT Currently, vast amounts of molecular information involving genomic
More informationSiFit: inferring tumor trees from single-cell sequencing data under finite-sites models
Zafar et al. Genome Biology (2017) 18:178 DOI 10.1186/s13059-017-1311-2 METHOD Open Access SiFit: inferring tumor trees from single-cell sequencing data under finite-sites models Hamim Zafar 1,2, Anthony
More informationUsing the Testlet Model to Mitigate Test Speededness Effects. James A. Wollack Youngsuk Suh Daniel M. Bolt. University of Wisconsin Madison
Using the Testlet Model to Mitigate Test Speededness Effects James A. Wollack Youngsuk Suh Daniel M. Bolt University of Wisconsin Madison April 12, 2007 Paper presented at the annual meeting of the National
More informationBayesian Benefit-Risk Assessment. Maria Costa GSK R&D
Assessment GSK R&D Disclosure is an employee and shareholder of GSK Data presented is based on human research studies funded and sponsored by GSK 2 Outline 1. Motivation 2. GSK s Approach to Benefit-Risk
More informationWhite Paper. Copy number variant detection. Sample to Insight. August 19, 2015
White Paper Copy number variant detection August 19, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com
More informationTRIPODS Workshop: Models & Machine Learning for Causal I. & Decision Making
TRIPODS Workshop: Models & Machine Learning for Causal Inference & Decision Making in Medical Decision Making : and Predictive Accuracy text Stavroula Chrysanthopoulou, PhD Department of Biostatistics
More information1 Introduction. st0020. The Stata Journal (2002) 2, Number 3, pp
The Stata Journal (22) 2, Number 3, pp. 28 289 Comparative assessment of three common algorithms for estimating the variance of the area under the nonparametric receiver operating characteristic curve
More informationApplications with Bayesian Approach
Applications with Bayesian Approach Feng Li feng.li@cufe.edu.cn School of Statistics and Mathematics Central University of Finance and Economics Outline 1 Missing Data in Longitudinal Studies 2 FMRI Analysis
More informationBayesian Models for Combining Data Across Domains and Domain Types in Predictive fmri Data Analysis (Thesis Proposal)
Bayesian Models for Combining Data Across Domains and Domain Types in Predictive fmri Data Analysis (Thesis Proposal) Indrayana Rustandi Computer Science Department Carnegie Mellon University March 26,
More informationSearching for Temporal Patterns in AmI Sensor Data
Searching for Temporal Patterns in AmI Sensor Data Romain Tavenard 1,2, Albert A. Salah 1, Eric J. Pauwels 1 1 Centrum voor Wiskunde en Informatica, CWI Amsterdam, The Netherlands 2 IRISA/ENS de Cachan,
More informationMISSING DATA AND PARAMETERS ESTIMATES IN MULTIDIMENSIONAL ITEM RESPONSE MODELS. Federico Andreis, Pier Alda Ferrari *
Electronic Journal of Applied Statistical Analysis EJASA (2012), Electron. J. App. Stat. Anal., Vol. 5, Issue 3, 431 437 e-issn 2070-5948, DOI 10.1285/i20705948v5n3p431 2012 Università del Salento http://siba-ese.unile.it/index.php/ejasa/index
More informationWINTHER: GUSTAVE ROUSSY GUSTAVE ROUSSY. NOM DU DOCUMENT / Date
WINTHER Study Jean-Charles Soria, Razelle Kurzrock, Josep Tabernero, Apostolia Tsimberidou, Jordi Rodon, Raanan Berger, Amir Onn, Gerald Batist, Eitan Rubin, Yohann Loriot, Catherine Bresson, Vladimir
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationReducing Decision Errors in the Paired Comparison of the Diagnostic Accuracy of Continuous Screening Tests
Reducing Decision Errors in the Paired Comparison of the Diagnostic Accuracy of Continuous Screening Tests Brandy M. Ringham, 1 Todd A. Alonzo, 2 John T. Brinton, 1 Aarti Munjal, 1 Keith E. Muller, 3 Deborah
More informationPancreatic Cancer Research and HMGB1 Signaling Pathway
Pancreatic Cancer Research and HMGB1 Signaling Pathway Haijun Gong*, Paolo Zuliani*, Anvesh Komuravelli*, James R. Faeder #, Edmund M. Clarke* * # The Hallmarks of Cancer D. Hanahan and R. A. Weinberg
More informationBayesian and Frequentist Approaches
Bayesian and Frequentist Approaches G. Jogesh Babu Penn State University http://sites.stat.psu.edu/ babu http://astrostatistics.psu.edu All models are wrong But some are useful George E. P. Box (son-in-law
More informationIntegrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
More informationCombining Risks from Several Tumors Using Markov Chain Monte Carlo
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln U.S. Environmental Protection Agency Papers U.S. Environmental Protection Agency 2009 Combining Risks from Several Tumors
More information