Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Size: px
Start display at page:

Download "Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent"

Transcription

1 Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk, Robert Besch, Stephanie Potthoff, Martin Leverkus and Georg Häcker Supplementary figure legends Figure S1 Induction of apoptosis in HaCaT keratinocytes and human melanoma cell lines by poly I:C/CHX-treatment A, HaCaT cells were treated without or with varying concentrations of poly I:C () for 24 h and cell death was assayed by staining for Annexin V, followed by flow cytometric analysis. 5 µm zvad-fmk was added 2 min before the addition of the maximum concentrations of poly I:C used. Data represent means ± SEM of three experiments. B, Cells were treated without (-) or with poly I:C alone (5 µg/ml), cycloheximide (CHX, 2.5 µg/ml), or the combination of poly I:C/bafilomycin A, poly I:C/CHX +/- bafilomycin A (5 nm, BafA) for 24 h and cell death was assayed by staining for active caspase-3, followed by flow cytometric analysis. Bafilomycin A and CHX was added 2.5 h before the addition of poly I:C. Data for melanoma cells represent means ± SEM of at least three experiments. Data for HaCaT cells and all bafilomycin A experiments represent mean values of two independent experiments. *, P <.2 compared to cells treated solely with CHX or poly I:C. C, Relative mrna levels of TLR3 in melanoma cell lines. qrt-pcr for TLR3 was performed with untreated (-) cells or cells treated 24 h with poly I:C () or CHX. Data represent mean ± SD of two independent experiments.

2 D, Western blot analysis of whole-cell lysates from HaCaT cells pretreated for 2.5 h with cycloheximide (CHX, 2.5 µg/ml) before adding polyi:c (5 µg/ml) for additional 24 h. and GAPDH were used as a loading control. The immunoblots show representative results from two independent experiments. Note that during poly I:C treatment HaCaT cells die when combined with CHX more efficiently than alone (not shown). E, sirna knock-down of IFNAR1 inhibits Noxa induction by poly I:C in HaCaT keratinocytes. Cells were transfected for 48 h with an sirna targeting IFNAR1 followed by poly I:C treatment for 24h and subsequent Western-blotting. Apoptosis induction was not impaired by IFNAR1 knock-down (not shown). F, Localization of Bcl-2 family proteins in HaCaT cells after polyi:c treatment. Cells were incubated without or with 5 µg/ml polyi:c. 24 h later cells were collected and subjected to fractionation experiments. Caspase-8 was used as a cytosolic, CoxIV as a mitochondrial loading control. The immunoblots are representatives of three separate experiments. All lanes on each blot was run on the same gel but was not contiguous, as indicated by the black line. Figure S2 A, Immunoblot showing levels of Noxa and Bim expression in polyclonal HaCaT cell lines expressing shrna specific for Noxa or Bim or a control shrna (scrambled anti-bim sequence) after 24 h of stimulation with 5 µg/ml poly I:C. was used as a loading control. The first lane on each blot was run on the same gel but was not contiguous, as indicated by the black line. B, C, Cells were transiently transfected with control (), Noxa, Bid, Puma, TLR3, TRIF or caspase-8-specific sirnas. 48 h post transfection, cells were treated with 5 µg/ml poly I:C for 24 h as indicated and caspase-8, knock-downs of Noxa and Bid were analysed by Western-blotting (B) or qrt-pcr (TLR3, Puma, TRIF, and IFNAR1) (C). All immunoblots show one representative of two independent experiments. Data obtained from quantitative

3 RT-PCR for TLR3 represent means ± SEM of three experiments; knockdown of TRIF, PUMA, and IFNAR1 from two independent experiments. Figure S3 Bcl-2 does not protect against poly I:C-induced cell death HaCaT cells were infected with lentivirus driving expression of GFP (plvub-gfp) or murine Bcl-2 (plvub-mbcl-2) and were selected for 5 days with puromycin. Induction of apoptosis was either done using 5 µg/ml poly I:C () for 24h or 5h of UV (16 J/m 2 ). Inset, immunoblot analysis of mbcl-2 expressing HaCaT cells after lentiviral infection. **, P <.5 compared to HaCaT cells stably expressing GFP treated for 5h with UV. Figure S4 Poly I:C together with cycloheximide cause caspase-8 cleavage in melanoma cells A, Whole cells lysates from melanoma cell lines 1Lu, WM35 and Sbcl2 were subjected to Western Blot analysis after stimulation with poly I:C (, 5 µg/ml) and cycloheximide (CHX, 2.5µg/ml). Cells were stimulated for 2 and 6 h with poly I:C, cycloheximide was added 1.5 h earlier. Samples were analyzed for presence of caspase-8 and FLIP L. B, Western blots of whole cell extracts from melanoma cells untreated or treated with poly I:C (5 µg/ml) or LBW242 (1 µm) alone (48 h for 1Lu and 451Lu; 24 h for WM35 and Sbcl2). The first lane on each blot was run on the same gel but was not contiguous, as indicated by the black line. Figure S5 Induction of apoptosis in human melanoma cell lines by treatment with poly A:U and LBW242

4 Melanoma cells were treated with solvent (control), LBW242 (1 µm), poly A:U (pau, 5 µg/ml), or combination of both pau and LBW242 for 72 h. Cell death was determined by flow cytometric analysis of propidium iodide (PI) uptake by the cells. Data represents means ± SEM of three independent experiments. Figure S6 Cowpox virus CrmA reduces poly I:C/LBW242-induced cell death in melanoma Human melanoma cell lines 1Lu and 451Lu were transfected with control vector or a Flag-tagged CrmA vector. 24h later cells were stimulated with 1 µm LBW242 plus 5µg/ml poly I:C for 72 h and stained for PI-positive cells. Western blots indicated expression level of Flag-CrmA 24 h post transfection. All data represent two independent experiments. *Cross reactive band. Figure S7 Poly I:C or LBW treatment of melanoma cells induce NF- B A, NF- B activity measured by luciferase activity 24 h post stimulation with 5 µg/ml poly I:C or 1 µm LBW. Both stimuli resulted in induced luciferase expression driven by the NF- B promoter. B, qrt-pcr of IL-8 in melanoma lines as a readout of the canonical NF- B pathway 24 h post stimulation. Poly I:C, not LBW242, induces IL-8 mrna levels in melanoma cell lines 1Lu, WM35, and Sbcl2. All data represent mean ± SD of two independent experiments.

5 Figure S1 A Annexin V positive cells (%) C zvad-fmk [μg/ml] B Active caspase-3 positive cells (%) BafA HaCaT CHX + + CHX CHX+ BafA 1Lu * * CHX + + CHX CHX+ BafA 451Lu Melanoma CHX + CHX WM35 * Relative TLR3 mrna (AU) CHX - CHX - CHX - CHX 1Lu 451Lu WM35 Sbcl2 D CHX CHX+ Mcl-1 NOXA Bid tbid E 1 5 siifnar siifnar1335 F NOXA Mitochondria Cytosol UZ-Pellet Bim EL Bax Noxa Mcl-1 Caspase-8 CoxIV

6 Figure S2 A shscrambled shnoxan8 Bim EL Noxa (short exposure) Noxa (long exposure) 5 shscrambled shbim Bim EL B sicaspase-8 sinoxa sibid Caspase-8 Bid tbid Noxa C Relative Units Relative Units Relative Units Relative Units sitlr3 sitrif sitrif Exp. #1 Exp. #2 sipuma sipuma Exp. #1 Exp. #2 siifnar1335 siifnar1335 Exp. #1 Exp. #2

7 Figure S3 plvub-gfp plvub-mbcl-2 mbcl Active caspase-3 positive cells (%) ** - pi:c UV plvub-gfp - pi:c UV plvub-mbcl-2

8 Figure S4 A Control 2h + 3.5h CHX 3.5h CHX 6h + 7.5h CHX 7.5h CHX Control 2h + 3.5h CHX 3.5h CHX 6h + 7.5h CHX 7.5h CHX Control 2h + 3.5h CHX 3.5h CHX 6h + 7.5h CHX 7.5h CHX Pro-Caspase-8 p41/ Pro-Caspase-8 p41/ Pro-Caspase-8 p41/ p18 FlipL FlipL FlipL 1Lu WM35 Sbcl2 B LBW LBW LBW LBW 43 Pro-Caspase-8 p41/ Lu 451Lu WM35 Sbcl2

9 Figure S5 7 PI positive cells (%) Control LBW242 pau pau + LBW242 1 Sbcl2 WM35

10 Figure S6 PI positive cells (%) Control Vector 7 Flag-CrmA Flag-CrmA Flag-CrmA * Flag-CrmA 1Lu 451Lu 1 Exp. #1 Exp. #2 1Lu Exp. #1 Exp. #2 451Lu

11 Figure S7 A 35 B Relative Luciferase Activity Relative IL-8 mrna (AU) Relative IL-8 mrna (AU) Ctr LBW 1Lu Ctr LBW 1Lu Ctr LBW Ctr LBW WM35 Sbcl2

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T

Bhatnagar et al, 2010 Cell Death and Disease Manuscript # CDDIS T Bhatnagar et al, Cell Death and Disease Manuscript # CDDIS--98-T Supplemental Materials. Supplemental Figure Legends Supplemental Figure (A) WPE-NA and WPE-NB6 cells were treated with 4 nm of Docetaxel

More information

Endogenous Noxa Determines the Strong Proapoptotic Synergism of the BH3-Mimetic ABT-737 with Chemotherapeutic Agents in Human Melanoma Cells 1,2

Endogenous Noxa Determines the Strong Proapoptotic Synergism of the BH3-Mimetic ABT-737 with Chemotherapeutic Agents in Human Melanoma Cells 1,2 Translational Oncology Volume 2 Number 2 June 2009 pp. 73 83 73 www.transonc.com Endogenous Noxa Determines the Strong Proapoptotic Synergism of the BH3-Mimetic ABT-737 with Chemotherapeutic Agents in

More information

Supplementary Information

Supplementary Information Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells

Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations

More information

BIK BIM NOXA PUMA MCL-1. p53

BIK BIM NOXA PUMA MCL-1. p53 HT116 cells A IK IM NOXA PUMA ML-1 p53 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 24 48 Procaspase 3 PARP leaved Product 12 8 4 24 hr 48 hr Figure S1. HT116 cell death by different proteasome inhibitors.

More information

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis

Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis 1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Supplementary Figure 1. Exposure of CRT occurs independently from the apoptosisassociated loss of the mitochondrial membrane potential (MMP). (A) HeLa cells treated with MTX

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-

mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee

More information

Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis

Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis induction in bladder transitional-cell papilloma RT4 cells: Evidence for a regulatory loop between

More information

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Proapoptotic signaling induced by RIG-I and MDA-5 results in type I interferon independent apoptosis. in melanoma cells.

Proapoptotic signaling induced by RIG-I and MDA-5 results in type I interferon independent apoptosis. in melanoma cells. Related Commentary, page 2127 Research article Proapoptotic signaling induced by RIG-I and MDA-5 results in type I interferon independent apoptosis in human melanoma cells Robert Besch, 1 Hendrik Poeck,

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate

More information

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR

More information

A. Generation and characterization of Ras-expressing autophagycompetent

A. Generation and characterization of Ras-expressing autophagycompetent Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in

More information

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1 1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting

More information

Supplementary Figure S1 Supplementary Figure S2

Supplementary Figure S1 Supplementary Figure S2 Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented

More information

Molecular mechanisms of apoptosis Caspase-8-activation: death receptors and TRIF

Molecular mechanisms of apoptosis Caspase-8-activation: death receptors and TRIF Molecular mechanisms of apoptosis Cell death by apoptosis occurs when a specialised intracellular signalling pathway is activated and kills the cell. Apoptosis is the most common way of cells to die in

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

Tel: ; Fax: ;

Tel: ; Fax: ; Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

BH3-only proteins are tail-anchored in the outer mitochondrial membrane and can initiate

BH3-only proteins are tail-anchored in the outer mitochondrial membrane and can initiate H3-only proteins are tail-anchored in the outer mitochondrial membrane and can initiate the activation o ax Florian Willing 1, rnim Weber 1, Stephanie Pottho, F.-Nora Vögtle, hris Meisinger, Stean. Paschen

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained

Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells Supplementary Figure Legends FIG S1 Examination of expression after virus infection. () 549 cells were infected with herpes simplex virus (HSV) (MOI = 1), and harvested at the indicated times, followed

More information

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap

Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized

More information

Supporting Information

Supporting Information Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Nature Immunology doi: /ni.3268

Nature Immunology doi: /ni.3268 Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

A. List of selected proteins with high SILAC (H/L) ratios identified in mass Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,

More information

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well

More information

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.

Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed

More information

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80% Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

Prolonged mitotic arrest induces a caspase-dependent DNA damage

Prolonged mitotic arrest induces a caspase-dependent DNA damage SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey

More information

CAN Resubmission SUPPLEMENTAL INFORMATION

CAN Resubmission SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION CAN-5-686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western

More information

Rapid parallel measurements of macroautophagy and mitophagy in

Rapid parallel measurements of macroautophagy and mitophagy in Supplemental Figures Rapid parallel measurements of macroautophagy and mitophagy in mammalian cells using a single fluorescent biosensor Sargsyan A, Cai J, Fandino LB, Labasky ME, Forostyan T, Colosimo

More information

ABSTRACT INTRODUCTION. Zongwei Gao 1,2,*, Qingjuan Shang 1,2,* Zhaoyun Liu 1,*, Chun Deng 1,3, Chunbao Guo 1

ABSTRACT INTRODUCTION. Zongwei Gao 1,2,*, Qingjuan Shang 1,2,* Zhaoyun Liu 1,*, Chun Deng 1,3, Chunbao Guo 1 /, Vol. 6, No. 34 Mitochondrial ATF2 translocation contributes to apoptosis induction and BRAF inhibitor resistance in melanoma through the interaction of Bim with VDAC1 Zongwei Gao 1,2,*, Qingjuan Shang

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage

More information

Supplementary Material

Supplementary Material Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx

More information

Supplemental Figures:

Supplemental Figures: Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)

More information

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were

Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent

More information

CAN Resubmission SUPPLEMENTAL INFORMATION

CAN Resubmission SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION CAN-05-0686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)

More information

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation

Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

A BAX/BAK and Cyclophilin D-Independent Intrinsic Apoptosis Pathway

A BAX/BAK and Cyclophilin D-Independent Intrinsic Apoptosis Pathway A BAX/BAK and Cyclophilin D-Independent Intrinsic Apoptosis Pathway Sebastián Zamorano 1,2, Diego Rojas-Rivera 1,2, Fernanda Lisbona 1,2, Valentina Parra 2,3, Felipe A. Court 4, Rosario Villegas 4, Emily

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via

microrna-200b and microrna-200c promote colorectal cancer cell proliferation via Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Table File Name: Peer Review File Description: Supplementary Table 1 Primers and taqman probes used were the following:

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Supplementary information

Supplementary information Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information