mm C3a. 1 mm C3a Time (s) C5a. C3a. Blank. 10 mm Time (s) Time (s)
|
|
- Colin Sutton
- 5 years ago
- Views:
Transcription
1 125 I-C5a (cpm) Fluorescnece Em 520nm a c Blank C5a C3a mm C3a mm C5a Time (s) 17 Fluorescnece Em 520nm Fluorescnece Em 520nm b mm C3a mm C3a Time (s) d mm C3a mm Time (s) Supplementary Figure S1. Selectivity and biological evaluations of agonist 17. (a) Small molecule C3aR ligands do not bind to C5aR. Error bars are means ± SEM. (b-d) Desensitization assay. (b) HMDM was treated with 0.3 μm of C3a ligand at t 0 to desensitize the C3a receptor. 1 μm of C3a was then injected at t 920 (s) to confirm C3aR desensitization. (c) Cells were first desensitized by 0.3 μm C3a ligand at t 0, then 0.3 μm C5a was injected at t 920 (s) to make sure only C3aR was desensitized. (d) Cells were first desensitized by 0.3 μm of C3a ligand at t 0, then agonist 17 at 10 μm were administered at t 920 (s). Compound 17 is selective for C3aR at 10 μm.
2 Supplementary Figure S2. Synthesis of oxazole compounds (7 10). Reagents and conditions: a) BOP, DIPEA, DMF; b) DAST, THF -78 C; c) CBrCl 3, DBU, DCM -40 C to RT; d) NaOH, MeOH, H 2 O; e) H-Arg-OEt, HBTU, DIPEA, DMF.
3 Supplementary Figure S3. Synthesis of Boc-(Leu-Thiazole)-Arg (11). Reagents and conditions: a) ClCO 2 Et, Et 3 N, THF, -20 C; b) Lawesson s reagent, DME; c) pyridine, EtOH; d) LiOH, MeOH, H 2 O; e) H-Arg-OEt, HBTU, DIPEA, DMF. f) LiOH, MeOH, H 2 O.
4 Supplementary Figure S4. Synthesis of imidazole compounds (12 14). Reagents and conditions: a) (i) NaNO 2, AcOH/H 2 O; (ii) H 2, EtOH, 10% Pd/C 15 psi; b) Cbz-L-Leu- OH, HBTU, DIPEA, DMF; c) NH 4 OAc, AcOH, microwave 150 C, 30 min; d) H 2, 10% Pd/C, MeOH, 40 psi; e) Boc 2 O, CH 2 Cl 2 ; f) NaOH, H 2 O, EtOH, 120 C; g) H-Arg-OEt, HBTU, DIPEA, DMF; h) NaOH, H 2 O, EtOH, RT; i) MeI, NaH, DMF.
5 Supplementary Figure S5. Synthesis of Boc-(Leu-1,3,4-Oxadiazole)-Arg (15). Reagents and conditions: a) N 2 H 4, EtOH, RT; b) Et 3 N, CH 2 Cl 2 ; c) TsCl, Et 3 N, CH 2 Cl 2 ; d) H-Arg-OEt, MeOH, DIPEA, microwave 100 C; e) NaOH, H 2 O, EtOH, RT.
6 Supplementary Figure S6. 1 H NMR (600 MHz, 90% H 2 O/10% D 2 O) compound 3 Ac-Leu-Ala-Arg.
7 Supplementary Figure S7. 1 H NMR (600 MHz, 90% H 2 O/10% D 2 O) compound 4 Boc-Leu-Ala-Arg.
8 Supplementary Figure S8. 1 H NMR (600 MHz, 90% H 2 O/10% D 2 O) compound 5 H-(Leu-Oxazole)-Arg.
9 Supplementary Figure S9. 1 H NMR (600 MHz, DMSO-d 6 ) compound 6 Ac-(Leu-Oxazole)-Arg.
10 Supplementary Figure S10. 1 H NMR (600 MHz, DMSO-d 6 ) compound 7 Boc-(Leu-Oxazole)-Arg.
11 Supplementary Figure S11. 1 H NMR (600 MHz, DMSO-d 6 ) compound 8 Ac-(Ile-Oxazole)-Arg.
12 Supplementary Figure S12. 1 H NMR (600 MHz, DMSO-d 6 ) compound 9 Ac-(Cha-Oxazole)-Arg.
13 Supplementary Figure S13. 1 H NMR (600 MHz, DMSO-d 6 ) compound 10 Ac-(Ala-Oxazole)-Arg.
14 Supplementary Figure S14. 1 H NMR (600 MHz, DMSO-d 6 ) compound 11 Ac-(Leu-Thiazole)-Arg.
15 Supplementary Figure S15. 1 H NMR (600 MHz, DMSO-d 6 ) compound 12 Ac-(Leu-Imidazole)-Arg.
16 Supplementary Figure S16. 1 H NMR (600 MHz, DMSO-d 6 ) compound 13 Boc-(Leu-N-Me(Y)-Imidazole)-Arg.
17 Supplementary Figure S17. 1 H NMR (600 MHz, DMSO-d 6 ) compound 14 Boc-(Leu-N-Me(X)-Imidazole)-Arg.
18 Supplementary Figure S18. 1 H NMR (600 MHz, DMSO-d 6 ) compound 15 Boc-(Leu-1,3,4-Oxadiazole)-Arg.
19 Supplementary Figure S19. 1 H NMR (600 MHz, DMSO-d 6 ) compound 16 3-Indolyl-(Leu-Imidazole)-Arg.
20 Supplementary Figure S20. 1 H NMR (600 MHz, DMSO-d 6 ) compound 17 3-Indolyl-(Leu-Oxazole)-Arg.
21 Supplementary Table S1. Primer sequences for target genes. Name Forward Reverse CCL3 CCCACATTCCGTCACCTGCTCAG AGCAGCAAGTGATGCAGAGAACTG EGR1 CGAGCACCTGACCGCAGAGTCT GGGGGCAGTCGAGTGGTTTGG FOSB GACCCTCAGCCCTGGCCTTT CAGCCCCTCACTGCCTTCCT IL1β CCTCTTCGAGGCACAAGGCACAA TGGCTGCTTCAGACACTTGAGCAAT IL6 GCCCACCGGGAACGAAAGAGA GACCGAAGGCGCTTGTGGAGAAG IL8 ACCACCGGAAGGAACCATCTCACT CTTGGCAAAACTGCACCTTCACAC TNF TCTGGCCCAGGCAGTCAGATC CACTGGAGCTGCCCCTCAGC 18S CGGCCGGTACAGTGAAACTG GCGCCCGTCGGCATGTATTA
22 Supplementary Methods Solid Phase Syntheses All amino acids and coupling reagents were purchased from Chem-Impex International Inc. Diisopropylethylamine (DIPEA), DMF and TFA were obtained from Auspep Pty Ltd., Australia. All solid phase syntheses were carried out on Wang resin ( mesh, 1.1 mmol/g loading). Short peptides 2-4 were synthesized using standard SPPS Fmoc chemistry. The peptides were cleaved from resin using 20% TFA in CH 2 Cl 2 before purification by reverse phase HPLC and lyophilisation. Leu-Ala-Arg (2). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.58 (br s, 1H), 7.86 (d, J = 7.8 Hz, 1H), 7.09 (br s, 1H), 4.03 (m, 1H), 3.89 (t, J = 7.3 Hz, 1H), 3.65 (t, J = 6.5 Hz, 1H), (m, 2H), 1.76 (m, 1H), (m, 6H), 1.37 (d, J = 7.0 Hz, 1H), 1.30 (d, J = 7.2 Hz, 1H), 0.84 (2 sets of d, J = 6.3 Hz, 6H); HRMS (m/z): [MH] + calc. for C 15 H 31 N 6 O + 4, ; found, Ac-Leu-Ala-Arg (3). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.21 (d, J = 6.3 Hz, 1H), 8.18 (d, J = 8.2 Hz, 1H), 8.07 (d, J = 6.6 Hz, 1H), 4.20 (m, 1H), (m, 2H), 1.91 (s, 3H), 1.82 (m, 1H), 1.66 (m, 1H), (m, 5H), 1.27 (d, J = 7.2 Hz, 3H), 0.82 (d, J = 6.6 Hz, 3H), 0.77 (d, J = 6.6 Hz, 3H); 13 C NMR (150 MHz, H 2 O/D 2 O): 176.3, 174.8, 174.5, 174.3, 156.9, 53.2, 52.5, 49.7, 40.6, 39.9, 28.2, 24.3, 24.2, 22.1, 21.6, 20.8, HRMS (m/z): [MH] + calc. for C 17 H 33 N 6 O + 5, ; found, Boc-Leu-Ala-Arg (4). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.20 (br m, 1H), 7.08 (br s, 1H), 6.80 (br s, 1H), 4.24 (m, 1H), 3.92 (m, 1H), (m, 2H), 1.81 (m, 1H), 1.66 (m, 1H), (m, 3H), (m, 2H), (m, 12H), 0.82 (d, J = 6.6 Hz, 3H), 0.78 (d, J = 6.6 Hz, 3H); 13 C NMR (150 MHz, H 2 O/D 2 O): 176.2, 175.6, 174.5, 157.5, 156.9, 81.4, 53.3, 53.0, 49.6, 40.7, 40.1, 28.1, 27.6, 24.3, 24.2, 22.1, 20.7, HRMS (m/z): [MH] + calc. for C 20 H 39 N 6 O + 6, ; found, Solution Phase Syntheses Synthesis of Boc-(Leu-Oxazole)-Arg (7). The Boc-L-Leu-OH amino acid (7a, 16.0 g, 64.3 mmol) in DMF (130 ml) was activated with BOP (28.4 g, 64.3 mmol) for 15 min
23 before the addition of DL-serine methyl ester hydrochloride (10.0 g, 64.3 mmol) and DIPEA (22.4 ml, mmol). The reaction mixture was stirred at RT for 1 h. The DMF in the reaction mixture was evaporated under high vacuum and the residue was redissolved in EtOAc (100 ml) and washed with sat. NaHCO 3 (2 70 ml). The organic extract was dried over MgSO 4, filtered and concentrated in vacuo to give product 7b (ESI-MS: m/z [MH] + ). The crude product (7b, 9.00 g, 26.9 mmol) was dissolved in anhydrous DCM (100 ml) and stirred under N 2 at -78 C before dropwise addition of DAST (5.3 ml, 40.3 mmol) over 2 min. The reaction mixture was stirred at -78 C for 1 h. then Na 2 CO 3 (14.2 g, mmol) was added and the reaction was warmed to RT and stirred for 1 h. The solution was diluted with DCM (50 ml) and washed with sat. NaHCO 3 (2 80 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo. The crude product (7c, ESI-MS: m/z [MH] + ) was used for the next step without purification. To a stirred solution of oxazoline 7c (3.40 g, 10.9 mmol) at -40 C in anhydrous DCM (50 ml) was added CBrCl 3 (3.6 ml, 36 mmol) then DBU (6.2 ml, 41.4 mmol) was added dropwise and the reaction mixture was slowly warmed to RT and stirred overnight. The reaction mixture was concentrated in vacuo. The residue was purified by flash column chromatography (SiO 2, 20% EtOAc in petroleum ether, R f 0.2) to give the oxazole product 7d as a pale yellow solid (1.60 g, 46% yield). 1 H NMR (600 MHz, CDCl 3 ), δ 8.16 (s, 1H), 5.05 (m, 1H), 4.97 (m, 1H), 3.90 (s, 3H), (m, 2H), 1.62 (m, 1H), 1.41 (s, 9H), (2 sets of d, J = 6.6 Hz, 6H); ESI-MS: m/z [MH] + ; t R = 11.5 min (20 100% B in 10 min gradient plus 100% B for further 10 min). A solution of the purified 7d (1.60 g, 5.1 mmol) in MeOH (18 ml) was treated with 3 M NaOH (6 ml) and the reaction mixture was stirred at RT for 30 min until the reaction went to completion as monitored by MS. The MeOH was concentrated in vacuo and the residual aqueous solution was acidified with 2 M HCl (10 ml) and extracted with EtOAc (2 15 ml). The organic extracts were combined, washed with brine (1 20 ml) and dried over MgSO 4, filtered and concentrated in vacuo to give 7e as a white powder. 1 H NMR (600 MHz, CDCl3), δ 8.14 (s, 1H), 5.03 (m, 1H), 4.95 (m, 1H), (m, 2H), 1.60 (m, 1H), 1.39 (s, 9H), 0.91 (2 sets of d, J = 6.6 Hz, 6H); ESI-MS: m/z [MH] + ; t R = 10.4 min (20 100% B in 10 min gradient plus 100% B for further 10 min). The Boc-L-Leu-oxazole acid (7e, 0.11 g, 0.37 mmol) in DMF (0.8 ml) was activated with BOP (0.16 g, 0.37 mmol) for 10 min before the addition of H-Arg-OEt (0.10 g, 0.37 mmol) and DIPEA (0.13 ml, 0.74 mmol). The reaction mixture was stirred at RT overnight, then diluted with EtOAc (2 ml) and washed with sat. NaHCO 3 (2 2
24 ml). The organic extract was dried over MgSO 4, filtered and concentrated in vacuo. The crude product (~0.10 g) was dissolved in EtOH/H 2 O/2M NaOH (4:1:1, 2 ml) and stirred until the reaction went to completion. The EtOH in the reaction was concentrated in vacuo and the aqueous solution was acidified with 2 M HCl (1 ml) and extracted with EtOAc (3 2 ml). Combined organic extracts were dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by rphplc to yield 7 as the trifluoroacetate salt (75 mg, 45%). Compounds 8-10 were synthesized by following the same synthetic procedures for compound 7. Boc-(Leu-Oxazole)-Arg (7). 1 H NMR (600 MHz, DMSO-d 6 ), 8.58 (s, 1H), 8.16 (d, J = 7.8 Hz, 1H), (m, 2H), 4.73 (m, 1H), 4.40 (m, 1H), 3.46 (q, J = 7.2 Hz, 2H), (m, 7H), 1.37 (s, 9H), 0.89 (dd, J = 12, 6.4 Hz, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.0, 165.0, 160.0, 156.6, 155.2, 142.1, 135.3, 78.4, 51.2, 46.9, 41.1, 40.3, 28.1, 27.9, 25.3, 24.1, 22.7, HRMS (m/z): [MH] + calc. for C 20 H 34 N 6 O + 6, ; found, ; t R = 7.7 min (20-100% B in 10 min gradient). Boc-(Ile-Oxazole)-Arg (8). 1 H NMR (400 MHz, DMSO-d 6 ), 8.59 (s, 1H), 8.17 (d, J = 5.2 Hz, 1H), 7.58 (d, J = 5.6 Hz, 1H), 7.46 (t, J = 3.8 Hz, 1H), 4.52 (t, J = 5.6 Hz, 1H), 4.39 (m, 1H), (m, 2H), (m, 2H), 1.59 (m, 1H), (m, 2H), 1.36 (s, 9H), (m, 2H), 0.84 (t, J = 4.8 Hz, 3H), 0.72 (d, J = 4.8 Hz, 3H); 13 C NMR (100 MHz, DMSO-d 6 ): 173.0, 163.9, 159.9, 156.6, 153.3, 142.0, 135.2, 78.4, 53.3, 51.2, 37.1, 28.1, 25.3, 24.9, 15.3, HRMS (m/z): [MH] + calc. for C 20 H 35 N 6 O + 6, ; found, ; t R = 7.6 min (20-100% B in 10 min gradient). Boc-(Cha-Oxazole)-Arg (9). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.55 (s, 1H), 8.11 (d, J = 7.9 Hz, 1H), 7.66 (br s, 1H), 7.53 (d, J = 8.6 Hz, 1H), 4.59 (m, 1H), 4.33 (m, 1H), (m, 2H), 1.85 (m, 1H), (m, 3H), (m, 7H), 1.37 (s, 9H), (m, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.2, 165.0, 159.9, 156.8, 155.4, 142.1, 135.6, 78.5, 51.6, 46.3, 40.4, 40.0, 33.5, 33.1, 31.6, 28.2, 26.0, 25.9, 25.7, HRMS (m/z): [MH] + calc. for C 23 H 39 N 6 O + 6, ; found, ; t R = 8.4 min (20-100% B in 10 min gradient).
25 Boc-(Ala-Oxazole)-Arg (10). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.57 (s, 1H), 8.16 (d, J = 8.2 Hz, 1H), 7.60 (d, J = 8.3 Hz, 1H), 7.53 (t, J = 5.8 Hz, 1H), 4.79 (m, 1H), 4.41 (m, 1H), (m, 2H), 1.87 (m, 1H), 1.77 (m, 1H), (m, 2H), 1.43 (d, J = 7.2 Hz, 3H), 1.38 (s, 9H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.0, 160.0, 156.6, 142.0, 135.3, 51.1, 44.2, 40.3, 28.2, 27.9, 25.3, HRMS (m/z):[mh] + calc. for C 17 H 29 N 6 O + 6, ; found, ; t R = 7.3 min (20-100% B in 10 min gradient). H-(Leu-Oxazole)-Arg (5). The crude compound 7 (25 mg, 0.06 mmol) was treated with 20% TFA in CH 2 Cl 2 (0.5 ml) to remove the Boc group. The reaction mixture was dried under N 2 and purified by rphplc to yield 5 as a white powder, as the trifluoroacetate salt (20 mg, 90%). 1 H NMR (600 MHz, H 2 O/D 2 O), δ 8.54 (d, J = 7.8 Hz, 1H), 8.37 (s, 1H), 7.09 (br s, 1H), (m, 2H), 3.12 (q, J = 6.6 Hz, 2H), (m, 2H), (m, 2H), (m, 2H), 1.50 (m, 1H), 0.84 (d, J = 6.6 Hz, 3H), 0.81 (d, J = 6.6 Hz, 3H); 13 C NMR (150 MHz, H 2 O/D 2 O): 173.0, 164.2, 160.0, 156.3, 141.9, 135.2, 51.1, 45.1, 41.2, 40.3, 27.7, 25.3, 22.5, 22.3, HRMS (m/z): [MH] + calc. for C 15 H 27 N 6 O + 4, ; found, ; t R = 7.5 min (0-100% B in 15 min gradient). Ac-(Leu-Oxazole)-Arg (6). Boc-L-Leu-Oxazole methyl ester (7d, 0.17 g, 0.50 mmol) was treated with 20% TFA in CH 2 Cl 2 (3 ml) and stirred at room temperature for 2 h. The reaction mixture was dried under N 2 and the residue in DMF (1.0 ml) was treated with DIPEA (0.4 ml, 2.00 mmol) followed by acetic anhydride (0.10 ml, 1.00 mmol) and stirred at RT for 1 h. The reaction mixture was evaporated and redissolved in EtOAc (2 ml) and washed with sat. NaHCO 3 (2 2 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo. The crude product (~40 mg, ESI-MS: m/z [MH] + ) was dissolved in EtOH/H 2 O/2M NaOH (4:1:1, 2 ml) and stirred until the reaction went to completion. The EtOH in the reaction was removed in vacuo and the aqueous solution was acidified with 2 M HCl (1 ml) and extracted with EtOAc (3 2 ml). Combined organic extracts were dried over MgSO 4, filtered and evaporated to dryness. The Ac-(Leu-Oxazole)-carboxylic acid crude product (0.11 g, 0.46 mmol, ESI- MS: m/z [MH] + ) was coupled to H-Arg-OEt (0.13 g, 0.46 mmol) followed by ester hydrolysis. The last coupling and hydrolysis steps were the same for compound 7 (in page S8). The crude product was purified by rphplc to yield 6 as a white powder, as the trifluoroacetate salt (50 mg, 25%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.57 (m, 1H), 8.47 (m, 1H), 8.19 (d, J = 8.3 Hz, 1H), 7.47 (m, 1H), 5.03 (m, 1H), 4.38 (m, 1H),
26 (m, 2H), 1.85 (s, 3H), (m, 2H), 1.65 (m, 1H), 1.56 (m, 1H), (m, 2H), 0.90 (d, J = 6.8 Hz, 3H), 0.85 (d, J = 6.8 Hz, 3H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.1, 169.2, 164.4, 160.0, 156.5, 142.0, 135.4, 51.2, 45.0, 41.3, 40.3, 27.8, 25.4, 24.1, 22.6, 22.3, HRMS (m/z):[mh] + calc. for C 17 H 29 N 6 O + 5, ; found, ; t R = 10.4 min (0-100% B in 20 min gradient). Boc-Leu-NH 2 (11a). A solution of Boc-Leu-OH (12.47 g, 50 mmol) and triethylamine (7.25 ml, 52 mmol) in THF (30 ml) was cooled to -20 C under argon and a solution of ethyl chloroformate (5.25 ml, 55 mmol) in THF added dropwise. The resultant solution was stirred for 20 minutes, and then ammonium hydroxide (28%, 20 ml) was added in one portion. The mixture was then stirred for 3 hours between 0-5 C, and concentrated in vacuo. The solution was acidified (ph = 2) with aqueous KHSO 4 (1 M, ~50 ml) and extracted with ethyl acetate (2 150 ml). The organic extracts were washed with saturated NaHCO 3 solution (100 ml), water (100 ml) and brine (100 ml), then dried over MgSO 4, filtered and concentrated under reduced pressure to give a white powder (11a, g, 91%) which was used without further purification. Boc-Leu-thioamide (11b). Crude Boc-Leu-NH 2 (11a) was dissolved in 1,2- dimethoxyethane (110 ml) and Lawesson s reagent (11 g, 27.3 mmol, 0.6 eq.) was added in one portion. The suspension was stirred at room temperature for 16 hours, and the resultant clear solution concentrated in vacuo. Purification by column chromatography (1:1 ethyl acetate:petroleum ether) gave a sticky white solid (11b, 7.97 g, 71%). Boc-Leu-5-methylthiazole ethyl ester (11c). To a solution of the thioamide 11b (958 mg, 3.90 mmol) in absolute ethanol (39 ml) was added pyridine (345 µl, 4.30 mmol) and ethyl 2-chloroacetoacetate (540 µl, 3.9 mmol). The solution was refluxed for 2 hours, and additional pyridine (147 µl) and ethyl 2-chloroacetoacetate (540 µl) added. After 2 hours reflux, the mixture was concentrated in vacuo and purified by column chromatography (SiO 2, 1:2 ethyl acetate:petroleum ether) to give a yellow solid (11c, 1.35 g, 98 %). 1 H NMR (400 MHz, DMSO-d 6 ): δ 4.31 (q, J = 7.2 Hz, 2H), 2.70 (s, 3H), (m, 2H), 1.68 (m, 1H), 1.45 (s, 9H), 1.35 (t, J = 6.8 Hz, 3H), 0.97 (m, 6H). Boc-Leu-5-methylthiazole carboxylic acid (11d). To a solution of the ester 11c (320 mg, 0.90 mmol) in methanol (4.2 ml) at -5 C was added aqueous LiOH (0.5 M, 4.2 ml)
27 dropwise. The mixture was stirred for 20 minutes, and then 2 hours at room temperature. The solution was acidified to ph 3 with 10 % citric acid solution and then to ph 2 with 5 drops of 2M hydrochloric acid. The solution was then extracted with ethyl acetate (3 x 25 ml) and the combined organic extracts washed with brine (30 ml), dried over MgSO 4, filtered and concentrated under reduced pressure to give a yellow oil. The oil was redissolved in 1:1 acetonitrile:water and lyophilized to give a white powder (11d, 276 mg, 94%). Boc-(Leu-Thiazole)-Arg (11). To a prestirred solution of the acid 11d (404 mg, 1.23 mmol), BOP (808 mg, 1.83 mmol), and DIPEA (635 µl, 3.65 mmol) in DMF (6 ml) was added H-Arg-OEt 2HCl (670 mg, 2.43 mmol). The resultant mixture was stirred overnight, and then concentrated under reduced pressure. The residue was redissolved in 1:1 methanol:water containing LiOH H 2 O (206 mg, 4.92 mmol, 4 eq.) and stirred for 2 hours. The solution was neutralized with dilute HCl, and subjected to purification by HPLC. Following lyophilization, the titled compound 11 was obtained as a white powder, as the trifluoroacetate salt (179 mg, 24%). 1 H NMR (600 MHz, DMSO-d 6 ): δ 8.41 (d, J = 7.7 Hz, 1H), 7.74 (d, J = 8.2 Hz, 1H), 7.54 (t, J = 5.5 Hz, 1H), 4.74 (m, 1H), 4.29 (m, 1H), 3.1 (m, 2H), 1.84 (m, 1H), 1.71 (m, 1H), 1.67 (d, J = 4.5 Hz, 3H), 1.53 (m, 2H), 1.4 (s, 9H), 0.9 (m, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 175.6, 173.2, 161.6, 156.7, 155.4, 154.3, 125.0, 78.5, 52.3, 51.3, 43.2, 40.3, 28.2, 27.6, 25.5, 24.4, 22.9, 21.3, HRMS (m/z): [MH] + calc. for C 21 H 37 N 6 O 5 S +, ; found, Ethyl 2-amino-3-oxobutanoate hydrochloride (12a). A solution of NaNO 2 (7.0 g, 100 mmol) in H 2 O (15 ml) was added dropwise to a mixture of ethyl acetoacetate (10 ml, 77 mmol) in glacial AcOH (15 ml) at room temperature. The reaction mixture was stirred for 1 h, then H 2 O (55 ml) was added and stirred for 2 h. The reaction mixture was then extracted with Et 2 O (3 80 ml). The combined organic extracts were washed with H 2 O (1 100 ml), sat. NaHCO 3 (1 100 ml) and brine (1 100 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo to give 12.0 g of yellow oil. This was dissolved in EtOH (130 ml) and to this solution, acetyl chloride (7.5 ml) was added dropwise to this solution. After addition, it was diluted with EtOH (75 ml) and then 10% Pd/C (200 mg) was added. The mixture was hydrogenated at 15 psi on a Parr hydrogenator for 3 h. The reaction mixture was filtered through celite and the filtrate was
28 concentrated in vacuo to give 11.5 g of product (12a, ESI-MS: m/z [MH] + ) as a yellow syrup. The crude product was used for the next step without purification. Synthesis of 12b. Cbz-protected L-leucine amino acid (6.0 g, 22.5 mmol) in DMF (50 ml) was first activated with HBTU (8.5 g, 22.5 mmol) and DIPEA (4.0 ml, 22.5 mmol) for 15 min. After that, the ethyl 2-amino-3-oxobutanoate hydrochloride (12a, 3.4 g, 18.7 mmol) was added and the reaction mixture was stirred at RT for 2 h. The reaction mixture was concentrated in vacuo and the residue was dissolved in EtOAc (70 ml) and washed with sat. NaHCO 3 (3 100 ml). The combined organic extracts were dried over MgSO 4, filtered and concentrated in vacuo. The crude was purified by flash column chromatography (SiO 2, 30% EtOAc in petroleum ether, R f product 0.2) to give product as a yellow syrup (12b, 3.0 g, 34%, 70% pure, ESI-MS: m/z [MH] +, t R = 9.5 min, % B in 10 min gradient). Cbz-Leu-5-methylimidazole ethyl ester (12c). The product (12b, 3.01 g, 7.61 mmol) was treated with NH 4 OAc (5.8 g, 19.0 mmol) in glacial AcOH (25 ml) and microwave heated at 150 C for 30 min. After 30 min, the reaction mixture was diluted with EtOAc (88 ml) and washed with a mixture of H 2 O/28% aq. NH 3 solution (4:1, 80 ml) and brine (1 80 ml). The organic phase was dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 50% EtOAc in petroleum ether, R f product 0.4) to give 1.4 g of 12c (51%). 1 H NMR (600 MHz, CDCl 3 ), δ 8.50 (t, J = 8.3 Hz, 1H), (m, 5H), (m, 2H), 5.05 (m, 1H), (m, 2H), 2.56 (s, 3H), 1.99 (m, 1H), 1.68 (m, 1H), 1.54 (m, 1H), (m, 3H), (m, 3H), (m, 3H); ESI-MS: m/z [MH] + ; t R = 8.0 min (20-100% B in 10 min gradient). Boc-Leu-5-methylimidazole ethyl ester (12d). The product from above (12c, 1.40 g, 3.70 mmol) was dissolved in MeOH (60 ml), treated with 10% Pd/C (50 mg) and hydrogenated at 40 psi on a Parr hydrogenator for 5 h. The mixture was filtered through celite and the filtrate was concentrated in vacuo. The crude product was then dissolved in CH 2 Cl 2 (15 ml) and treated with di-tert-butyldicarbonate (0.80 g, 3.70 mmol), stirred at RT for 30 min. After 30 min, the reaction mixture was evaporated to dryness. The crude
29 product (12d, 1.40 g, ESI-MS: m/z [MH] + ) was used for the next step without additional purification. N-Methylation of compound 12d. Boc-Leu-5-methylimidazole ethyl ester (12d, 0.40 g, 1.10 mmol) in DMF (5 ml) was treated with NaH (53 mg, 2.20 mmol) and MeI (0.14 ml, 2.20 mmol) and stirred at RT for 2 h. H 2 O (10 ml) and EtOAc (10 ml) was added to the reaction mixture and the two layers were separated. The organic phase was collected, dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 30% EtOAc in petroleum ether, R f for 12e = 0.14, 12f = 0.40) to give 0.4 g of products (70%, 12e, 12f, ratio 1.5:1). Compound 12e. 1 H NMR (600 MHz, CDCl 3 ), δ 5.26 (m, 1H), 4.92 (m, 1H), 4.33 (q, J = 7.2 Hz, 2H), 3.90 (s, 3H), 2.45 (s, 3H), 1.78 (m, 1H), (m, 2H), 1.42 (s, 9H), 1.38 (t, J = 7.2 Hz, 1H), 0.97 (d, J = 6.6 Hz, 3H), 0.94 (d, J = 6.6 Hz, 3H); ESI-MS: m/z [MH] + Compound 12f. 1 H NMR (600 MHz, CDCl 3 ), δ 5.17 (d, J = 9.6 Hz, 1H), 4.92 (m, 1H), 4.40 (q, J = 7.2 Hz, 2H), 3.59 (s, 3H), 2.53 (s, 3H), 1.90 (m, 1H), 1.73 (m, 1H), 1.66 (m, 1H), 1.43 (s, 9H), 1.39 (t, J = 7.2 Hz, 1H), 0.98 (d, J = 6.6 Hz, 3H), 0.95 (d, J = 6.6 Hz, 3H); ESI-MS: m/z [MH] + Ester hydrolysis of 12d-f. The imidazole compounds 12d-f (0.10 g, ~0.30 mmol) were dissolved in EtOH/H 2 O/2M NaOH (4:1:1, 3 ml) and heated in microwave at 120 C for 10 min (hydrolysis required heating). The EtOH in the reaction was concentrated in vacuo and the aqueous solution was acidified with 2 M HCl (2 ml) and extracted with EtOAc (3 3 ml). Combined organic extracts were dried over MgSO 4, filtered and concentrated in vacuo. The crude product was used for next step without further purification. 12d (ESI-MS: m/z [MH] + ); 12e and 12f (ESI-MS: m/z [MH] + ). Synthesis of final imidazole compounds Intermediates 12d-f (~0.10 g, ~0.3 mmol) were coupled to H-Arg-OEt and then treated with aqueous base to hydrolyze the ester by following previously described procedures for compound 7 in page S8. The crude compounds were purified by rphplc.
30 Boc-(Leu-Imidazole)-Arg (12, 35 mg, 25%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.00 (br s, 1H), 7.65 (m, 1H), 7.29 (br s, 1H), 4.67 (m, 1H), 4.39 (m, 1H), (m, 2H), 2.41 (s, 3H), 1.84 (m, 1H), (m, 2H), (m, 4H), 1.36 (s, 9H), (2 sets of d, J = 6.4 Hz, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.3, 173.2, 158.6, 158.4, 156.7, 155.2, 147.8, 78.6, 51.2, 46.5, 40.4, 28.4, 28.1, 25.2, 24.2, 22.7, 21.5, HRMS (m/z): [MH] + calc. for C 21 H 38 N 7 O + 5, ; found, ; t R = 12.2 min (0-100% B in 20 min gradient). Boc-(Leu-NMe(Y)Imidazole)-Arg (13, 30 mg, 21%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 7.67 (m, 1H), 7.59 (m, 1H), 7.28 (t, J = 8.2 Hz, 1H), 4.75 (m, 1H), 4.42 (m, 1H), 3.50 (s, 3H), (m, 2H), 2.43 (s, 1H), (m, 2H), 1.70 (m, 1H), (m, 2H), (m, 2H), 1.36 (s, 9H), (m, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 173.4, 162.6, 158.5, 156.7, 155.4, 147.3, 132.9, 78.1, 50.7, 44.9, 41.5, 40.3, 30.0, 28.9, 28.2, 25.2, 24.2, 23.1, 21.6, 9.3. HRMS (m/z): [MH] + calc. for C 22 H 40 N 7 O + 5, ; found, ; t R = 10.1 min (0-100% B in 15 min gradient). Boc-(Leu-NMe(X)Imidazole)-Arg (14, 32 mg, 22%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 8.93 (m, 1H), 7.86 (m, 1H), 7.75 (m, 1H), 4.87 (m, 1H), 4.36 (m, 1H), 3.77 (s, 3H), (m, 2H), 2.36 (d, J = 4.0 Hz, 3H), (m, 2H), 1.72 (m, 1H), (m, 4H), 1.37 (s, 9H), (2 sets of d, J = 6.0 Hz, 6H); 13 C NMR (150 MHz, DMSOd 6 ): 172.7, 158.8, 158.5, 157.1, 155.4, 148.2, 124.7, 79.2, 52.2, 44.5, 40.3, 32.8, 28.0, 27.6, 25.4, 24.2, 22.7, 21.4, HRMS (m/z): [MH] + calc. for C 22 H 40 N 7 O + 5, ; found, ; t R = 11.7 min (0-100% B in 20 min gradient). Synthesis of compound 15b. Boc-Leu-OMe (15a, 2.01 g, 8.20 mmol) in EtOH (15 ml) was treated with hydrazine hydrate solution (1.6 ml, 32.0 mmol) and the reaction mixture was stirred at RT overnight. After overnight, the reaction mixture was concentrated in vacuo to give 15b as a white solid (1.50 g, ESI-MS: m/z [MH] + ). It was used for next step without additional purification. Synthesis of compound 15c. The starting material 15b (0.60 g, 2.50 mmol) in anhydrous CH 2 Cl 2 (2 ml) was stirred at 0 C under N 2. To this cooled solution, Et 3 N (1.0 ml, 7.50
31 mmol) was added followed by dropwise addition of ethyl chlorooxoacetate (0.3 ml, 3.00 mmol). The reaction mixture was stirred at RT overnight. The reaction mixture was diluted with EtOAc (5 ml), the salt was filtered and the filtrate was concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 60% EtOAc in petroleum ether, R f product 0.4) to give 0.60 g of product (15c, 65%) as an offwhite solid. 1 H NMR (600 MHz, CDCl 3 ), δ 9.37 (br s, 1H), 5.01 (br d, J = 6.0 Hz, 1H), 4.41 (q, J = 7.2 Hz, 2H), 4.29 (br s, 1H), 1.59 (m, 1H), 1.48 (s, 9H), 1.42 (t, J = 7.2 Hz, 3H), (2 sets of d, J = 6.6 Hz, 6H); ESI-MS: m/z [MH] + Boc-Leu-1,3,4-Oxadiazole ethyl ester (15d). To compound 15c (0.60 g, 1.60 mmol) in anhydrous CH 2 Cl 2 (5 ml) under N 2 was added Et 3 N (0.3 ml, 2.10 mmol) followed by 4- toluenesulfonyl chloride (0.40 g in 5 ml CH 2 Cl 2, 2.00 mmol). The reaction mixture was stirred at RT overnight. The reaction mixture was diluted with CH 2 Cl 2 (10 ml) and washed with H 2 O (1 10 ml). The organic phase was collected, dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified by flash column chromatography (SiO 2, 20% EtOAc in petroleum ether, R f product 0.2) to give 0.50 g of product (15d, 96%) as a pale yellow syrup. 1 H NMR (600 MHz, CDCl 3 ), δ 5.18 (br m, 1H), 5.04 (br m, 1H), 4.55 (q, J = 7.2 Hz, 2H), (m, 3H), (m, 12H), (2 sets of d, J = 2.4 Hz, 6H); ESI-MS: m/z [MH] + Synthesis of Boc-(Leu-1,3,4-Oxadiazole)-Arg (15). Boc-Leu-1,3,4-Oxadiazole ethyl ester (15d, 0.25 g, 0.77 mmol) in MeOH (2 ml) was treated with DIPEA (0.3 ml, 1.54 mmol) and H-Arg-OEt (0.21, 0.77 mmol). The reaction mixture was heated in microwave at 100 C for 1 h. The reaction was cooled down to RT and treated with 1 M NaOH solution (2 ml) and stirred for 15 min. The MeOH solution was concentrated in vacuo and the residue was redissolved in ACN/H 2 O for rphplc purification. (30 mg, 9%). 1 H NMR (600 MHz, DMSO-d 6 ), δ 9.51 (d, J = 7.3 Hz, 1H), 7.70 (d, J = 8.3 Hz, 1H), 7.64 (t, J = 5.5 Hz, 1H), 4.86 (m, 1H), 4.37 (m, 1H), (m, 2H), 1.89 (m, 1H), (m, 2H), (m, 2H), (m, 2H), 1.38 (s, 9H), (2 sets of d, J = 6.4 Hz, 6H); 13 C NMR (150 MHz, DMSO-d 6 ): 172.2, 168.9, 158.3, 156.7, 155.2, 153.4, 78.7, 52.2, 45.2, 40.5, 40.3, 28.1, 27.2, 25.4, 24.1, 22.6, HRMS (m/z): [MH] + calc. for C 19 H 34 N 7 O + 6, ; found, ; t R = 11.5 min (0-100% B in 15 min).
Supporting Information. Recyclable hypervalent-iodine-mediated solid-phase peptide
Supporting Information Recyclable hypervalent-iodine-mediated solid-phase peptide synthesis and cyclic peptide synthesis Dan Liu, Ya-Li Guo, Jin Qu and Chi Zhang* for Address: State Key Laboratory of Elemento-Organic
More informationSupplemental Material
Supplemental Material General Methods Unless otherwise indicated, all anhydrous solvents were commercially obtained and stored under nitrogen. Reactions were performed under an atmosphere of dry nitrogen
More informationSupporting Information for. Boronic Acid Functionalized Aza-Bodipy (azabdpba) based Fluorescence Optodes for the. analysis of Glucose in Whole Blood
Supporting Information for Boronic Acid Functionalized Aza-Bodipy (azabdpba) based Fluorescence Optodes for the analysis of Glucose in Whole Blood Yueling Liu, Jingwei Zhu, Yanmei Xu, Yu Qin*, Dechen Jiang*
More informationp-toluenesulfonic Acid-Mediated 1,3-Dipolar Cycloaddition of
Supporting Information for: p-toluenesulfonic Acid-Mediated 1,3-Dipolar Cycloaddition of Nitroolefins with NaN 3 for Synthesis of 4-Aryl-NH-1,2,3-triazoles Xue-Jing Quan, Zhi-Hui Ren, Yao-Yu Wang, and
More informationLewis acid-catalyzed regioselective synthesis of chiral α-fluoroalkyl amines via asymmetric addition of silyl dienolates to fluorinated sulfinylimines
Supporting Information for Lewis acid-catalyzed regioselective synthesis of chiral α-fluoroalkyl amines via asymmetric addition of silyl dienolates to fluorinated sulfinylimines Yingle Liu a, Jiawang Liu
More informationSynthesis of cationic porphyrin modified amino. acids
Synthesis of cationic porphyrin modified amino acids Eric Biron and Normand Voyer* Département de chimie and CREFSIP, Faculté des sciences et de génie, Université Laval, Québec, Québec, Canada G1K 7P4
More informationPreparation, isolation and characterization of N α -Fmoc-peptide isocyanates: Solution synthesis of oligo-α-peptidyl ureas
SUPPORTING INFORMATION Preparation, isolation and characterization of N α -Fmoc-peptide isocyanates: Solution synthesis of oligo-α-peptidyl ureas Vommina V. Suresh Babu*, Basanagoud S. Patil, and Rao Venkataramanarao
More informationSupporting Information. Design and Synthesis of Bicyclic Pyrimidinones as Potent and Orally. Bioavailable HIV-1 Integrase Inhibitors.
Supporting Information Design and Synthesis of Bicyclic Pyrimidinones as Potent and Orally Bioavailable HIV-1 Integrase Inhibitors. Ester Muraglia, * Olaf Kinzel, Cristina Gardelli, Benedetta Crescenzi,
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2007
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2007 Supporting Information General. NMR spectra for identification of intermediates and final compoundswere recorded
More informationSupporting Information
Supporting Information Developing novel activity-based fluorescent probes that target different classes of proteases Qing Zhu, Aparna Girish, Souvik Chattopadhaya and Shao Q Yao * Departments of Chemistry
More informationSupporting Information
Supporting Information Synthesis of N-Heteropolycyclic Compounds Including Quinazolinone Skeletons by Using Friedel-Crafts Alkylation Bu Keun Oh, Eun Bi Ko, Jin Wook Han* and Chang Ho Oh* Department of
More informationSupporting Information
Investigation of self-immolative linkers in the design of hydrogen peroxide metalloprotein inhibitors Jody L. Major Jourden, Kevin B. Daniel, and Seth M. Cohen* Department of Chemistry and Biochemistry,
More informationDirect Aerobic Carbonylation of C(sp 2 )-H and C(sp 3 )-H Bonds through Ni/Cu Synergistic Catalysis with DMF as the Carbonyl Source
Direct Aerobic Carbonylation of C(sp 2 )-H and C(sp 3 )-H Bonds through Ni/Cu Synergistic Catalysis with DMF as the Carbonyl Source Xuesong Wu, Yan Zhao, and Haibo Ge* Table of Contents General Information...
More informationUse of degradable cationic surfactants with cleavable linkages for enhancing the. chemiluminescence of acridinium ester labels. Supplementary Material
Use of degradable cationic surfactants with cleavable linkages for enhancing the chemiluminescence of acridinium ester labels Supplementary Material Anand atrajan*and David Wen Siemens Healthcare Diagnostics
More informationph Switchable and Fluorescent Ratiometric Squarylium Indocyanine Dyes as Extremely Alkaline Sensors
ph Switchable and Fluorescent Ratiometric Squarylium Indocyanine Dyes as Extremely Alkaline Sensors Jie Li, Chendong Ji, Wantai Yang, Meizhen Yin* State Key Laboratory of Chemical Resource Engineering,
More informationPreparation of Stable Aziridinium Ions and Their Ring Openings
Supplementary Information Preparation of Stable Aziridinium Ions and Their Ring Openings Yongeun Kim a Hyun-Joon Ha*, a Sae Young Yun b and Won Koo Lee,*,b a Department of Chemistry and Protein Research
More informationMasatoshi Shibuya,Takahisa Sato, Masaki Tomizawa, and Yoshiharu Iwabuchi* Department of Organic Chemistry, Graduate School of Pharmaceutical Sciences,
Oxoammonium ion/naclo 2 : An Expedient, Catalytic System for One-pot Oxidation of Primary Alcohols to Carboxylic Acid with Broad Substrate Applicability Masatoshi Shibuya,Takahisa Sato, Masaki Tomizawa,
More informationTable of contents MS-Experiments... 3 Synthesis of intermediates and precursors... 4 Metabolic stability determination in vitro References...
Supporting Information Trisubstituted Pyridinylimidazoles as Potent Inhibitors of the Clinically Resistant L858R/T790M/C797S EGFR Mutant: Targeting of Both Hydrophobic Regions and the Phosphate Binding
More informationSynthesis and Blastocyst Implantation Inhibition Potential of Lupeol Derivatives in Female Mice
Supporting Information Rec. Nat. Prod. 9:4 (2015) 561-566 Synthesis and Blastocyst Implantation Inhibition Potential of Lupeol Derivatives in Female Mice Anita Mahapatra 1*, Purvi Shah 1, Mehul Jivrajani
More informationChristophe Lincheneau, Bernard Jean-Denis and Thorfinnur Gunnlaugsson* Electronic Supplementary Information
Self-assembly formation of mechanically interlocked [2]- and [3]catenanes using lanthanide ion [Eu(III)] templation and ring closing metathesis reactions Christophe Lincheneau, Bernard Jean-Denis and Thorfinnur
More informationSupporting Information for
Supporting Information for Tandem Mass Spectrometry Assays of Palmitoyl Protein Thioesterase and Tripeptidyl Peptidase Activity in Dried Blood Spots for the Detection of Neuronal Ceroid Lipofuscinoses
More informationELECTRONIC SUPPLEMENTARY INFORMATION
ELECTRIC SUPPLEMETARY IFRMATI Searching for new cell-penetrating agents: hybrid cyclobutane-proline γ, γ peptides. Esther Gorrea, a Daniel Carbajo, b,c Raquel Gutiérrez-Abad, a na Illa, a Vicenç Branchadell,
More informationNovel Aldosterone Synthase Inhibitors with Extended Carbocyclic Skeleton by a Combined Ligand-Based and Structure-Based Drug Design Approach
Supporting Information Novel Aldosterone Synthase Inhibitors with Extended Carbocyclic Skeleton by a Combined Ligand-Based and Structure-Based Drug Design Approach Simon Lucas, Ralf Heim, Matthias Negri,
More informationElectronic Supplementary Information
Electronic Supplementary Information A Novel and Facile Zn-mediated Intramolecular Five-membered Cyclization of β-tetraarylporphyrin Radicals from β-bromotetraarylporphyrins Dong-Mei Shen, Chao Liu, Qing-Yun
More informationSupporting Information. Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base
Supporting Information Efficient copper-catalyzed Michael addition of acrylic derivatives with primary alcohols in the presence of base Feng Wang, a Haijun Yang, b Hua Fu, b,c * and Zhichao Pei a * a College
More informationFacile Cu(II) mediated conjugation of thioesters and thioacids to peptides and proteins under mild conditions
Electronic Supplementary Material (ESI) for Organic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2018 Facile Cu(II) mediated conjugation of thioesters and thioacids to peptides
More informationSupporting Information. Nitrodibenzofuran: a One- and Two-Photon Sensitive Protecting Group that is Superior to
Supporting Information Nitrodibenzofuran: a One- and Two-Photon Sensitive Protecting Group that is Superior to Brominated Hydroxycoumarin for Thiol Caging in Peptides M. Mohsen Mahmoodi, Daniel Abate-Pella,
More informationL-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular
Supporting Information: L-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular Hydrogels Rita Das Mahapatra, a Joykrishna Dey* a, and Richard G. Weiss b a
More informationAnalysis of fatty acid metabolism using Click-Chemistry and HPLC-MS
Analysis of fatty acid metabolism using Click-Chemistry and HPLC-MS Alexander J. Pérez and Helge B. Bode -Supporting Information- Contents Experimental section Supplementary figures NMR spectra Page S2
More informationSupporting Information. Radical fluorination powered expedient synthesis of 3 fluorobicyclo[1.1.1]pentan 1 amine
Electronic Supplementary Material (ESI) for rganic & Biomolecular Chemistry. This journal is The Royal Society of Chemistry 2015 Supporting Information Radical fluorination powered expedient synthesis
More informationEthyl 2-hydroxy-4-methyl-1-((prop-2-yn-1-yloxy)methyl)cyclohex-3-enecarboxylate (16):
General methods: 1 H NMR and 13 C NMR spectra were recorded in CDCl 3 or CDCl3 and CCl 4 as solvent on 300 MHz or 500 MHz spectrometer at ambient temperature. The coupling constant J is given in Hz. The
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 Supporting Information Facile Three-Step Synthesis and Photophysical Properties of [8]-, [9]-,
More informationSupporting information to Amino-functional polyester dendrimers based on bis-mpa as nonviral vectors for sirna delivery
Supporting information to Amino-functional polyester dendrimers based on bis-mpa as nonviral vectors for sirna delivery P. Stenström, D. Manzanares, Y. Zhang, V. Ceña and M. Malkoch* * To whom correspondence
More informationAn efficient methodology to introduce o-(aminomethyl) phenyl-boronic acids into peptides: alkylation of secondary amines
Electronic Supplementary Material (ESI) for ew Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre ational de la Recherche Scientifique 2016 An efficient methodology to
More informationDirect ortho-c H Functionalization of Aromatic Alcohols Masked by Acetone Oxime Ether via exo-palladacycle
Direct ortho-c H Functionalization of Aromatic Alcohols Masked by Acetone Oxime Ether via exo-palladacycle Kun Guo, Xiaolan Chen, Mingyu Guan, and Yingsheng Zhao* Key Laboratory of Organic Synthesis of
More informationOrvinols with Mixed Kappa/Mu Opioid Receptor Agonist Activity
Supporting Information Orvinols with Mixed Kappa/Mu Opioid Receptor Agonist Activity Greedy, Benjamin M.; Bradbury, Faye.; Thomas, Mark P.; Grivas, Konstantinos; Cami-Kobeci, Gerta; Archambeau, Ashley.;
More informationSupporting Information. for. Access to pyrrolo-pyridines by gold-catalyzed. hydroarylation of pyrroles tethered to terminal alkynes
Supporting Information for Access to pyrrolo-pyridines by gold-catalyzed hydroarylation of pyrroles tethered to terminal alkynes Elena Borsini 1, Gianluigi Broggini* 1, Andrea Fasana 1, Chiara Baldassarri
More informationMicrowave heating in peptide side chain modification via sulfhydryl reaction
Microwave heating in peptide side chain modification via sulfhydryl reaction E. Calce and S. De Luca* Institute of Biostructures and Bioimaging, National Research Council, 80134 Naples, Italy stefania.deluca@cnr.it
More informationSupporting Information
Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Free Radical Based, Specific Desulfurization of Cysteine: A Powerful Advance in the Synthesis of Polypeptides and Glycopolypeptides Qian Wan
More informationInhibition of glyoxalase I: the first low-nanomolar tight-binding inhibitors. Swati S. More ξ and Robert Vince*
S1 Inhibition of glyoxalase I: the first low-nanomolar tight-binding inhibitors Swati S. More ξ and Robert Vince* Center for Drug Design, Academic ealth Center, and Department of Medicinal Chemistry, College
More informationSupporting information
Supporting information Conformationally Induced Off-On Cell Membrane Chemosensor Targeting Receptor Protein-Tyrosine Kinases for in Vivo and in Vitro Fluorescence Imaging of Cancers Yang Jiao,, Jiqiu Yin,
More informationThermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein
Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-
More informationSupporting Information. for. Pd-catalyzed decarboxylative Heck vinylation of. 2-nitro-benzoates in the presence of CuF 2
Supporting Information for Pd-catalyzed decarboxylative Heck vinylation of 2-nitro-benzoates in the presence of CuF 2 Lukas J. Gooßen*, Bettina Zimmermann, Thomas Knauber Address: Department of Chemistry,
More informationScheme S1. Synthesis of glycose-amino ligand.
Scheme S1. Synthesis of glycose-amino ligand. 5-Chloro-1-pentyl-2,3,4,6-tetra-O-acetyl-ß-D-glucopyranoside S2 To a solution of penta-o-acetyl-ß-d-glucopyranoside S1 (3.0 g, 7.69 mmol) and 5-chloropentan-1-ol
More informationSupporting Information
Supporting Information Discovery of TUG-770: A Highly Potent Free Fatty Acid Receptor 1 (FFA1/GPR40) Agonist for Treatment of Type 2 Diabetes Elisabeth Christiansen, Steffen V. F. Hansen, Christian Urban,
More informationAll chemicals were obtained from Aldrich, Acros, Fisher, or Fluka and were used without
Supplemental Data Alexander et al. Experimental Procedures General Methods for Inhibitor Synthesis All chemicals were obtained from Aldrich, Acros, Fisher, or Fluka and were used without further purification,
More informationSupporting Information Synthesis of 2-Aminobenzonitriles through Nitrosation Reaction and Sequential Iron(III)-Catalyzed C C Bond Cleavage of 2-Arylin
Supporting Information Synthesis of 2-Aminobenzonitriles through Nitrosation Reaction and Sequential Iron(III)-Catalyzed C C Bond Cleavage of 2-Arylindoles Wei-Li Chen, Si-Yi Wu, Xue-Ling Mo, Liu-Xu Wei,
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Synthesis and Preliminary Pharmacological Evaluation of Aryl Dithiolethiones with Cyclooxygenase-2 Selective Inhibitory Activity and Hydrogen-Sulfide-Releasing Properties Shannon
More informationNaoya Takahashi, Keiya Hirota and Yoshitaka Saga* Supplementary material
Supplementary material Facile transformation of the five-membered exocyclic E-ring in 13 2 -demethoxycarbonyl chlorophyll derivatives by molecular oxygen with titanium oxide in the dark Naoya Takahashi,
More informationEnantioselective synthesis of anti- and syn-β-hydroxy-α-phenyl carboxylates via boron-mediated asymmetric aldol reaction
Enantioselective synthesis of anti- and syn-β-hydroxy-α-phenyl carboxylates via boron-mediated asymmetric aldol reaction P. Veeraraghavan Ramachandran* and Prem B. Chanda Department of Chemistry, Purdue
More informationSupplementary Materials
Supplementary Materials Supplementary Materials and Methods Biochemical Methods Methods to assay HMT activities have been previously described (1). In vitro cell assays Proliferation and LCC calculations
More informationNature Biotechnology: doi: /nbt.2354
a b c Summed up peptide ion signals (arb. u.) 1E+03 INSR 1E+02 1E+01 1E+00-10 - 5 0 5 10 Summed up peptide ion signals (arb. u.) 1E+03 INSR 1E+02 1E+01 1E+00-10 -5 0 5 10 1E+03 1E+02 1E+01 INSR 1E+00-10
More informationSupporting Information. for. Synthesis of dye/fluorescent functionalized. dendrons based on cyclotriphosphazene
Supporting Information for Synthesis of dye/fluorescent functionalized dendrons based on cyclotriphosphazene Aurélien Hameau 1,2, Sabine Fuchs 1,2, Régis Laurent 1,2, Jean-Pierre Majoral* 1,2 and Anne-Marie
More informationSupporting Information for. Use of the Curtius Rearrangement of Acryloyl Azides in the Synthesis of. 3,5-Disubstituted Pyridines: Mechanistic Studies
Supporting Information for Use of the Curtius Rearrangement of Acryloyl Azides in the Synthesis of 3,5-Disubstituted Pyridines: Mechanistic Studies Ta-Hsien Chuang* a, Yu-Chi Chen b and Someshwar Pola
More informationCytosolar delivery of large proteins using nanoparticlestabilized
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Supporting Information Cytosolar delivery of large proteins using nanoparticlestabilized nanocapsules
More informationSupporting information D. A. Fort, T. J. Woltering, M. Nettekoven, H. Knust, T. Bach ELECTRONIC SUPPORTING INFORMATION BELONGING TO THE PAPER
S1 =========================================== ELECTRONIC SUPPORTING INFORMATION =========================================== BELONGING TO THE PAPER Conformationally restricted pyrrolidines by intramolecular
More informationFluorescent probes for detecting monoamine oxidase activity and cell imaging
Fluorescent probes for detecting monoamine oxidase activity and cell imaging Xuefeng Li, Huatang Zhang, Yusheng Xie, Yi Hu, Hongyan Sun *, Qing Zhu * Supporting Information Table of Contents 1. General
More informationSupporting Information
Supporting Information Wiley-VCH 2008 69451 Weinheim, Germany Supporting Information Enantioselective Cu-catalyzed 1,4-Addition of Various Grignard Reagents to Cyclohexenone using Taddol-derived Phosphine-Phosphite
More informationSupporting Information
Supporting Information for Selectively fluorinated cyclohexane building blocks: Derivatives of carbonylated all-cis-3-phenyl-1,2,4,5- tetrafluorocyclohexane Mohammed Salah Ayoup 1,2, David B. Cordes 1,
More informationStructure and conserved function of iso-branched sphingoid bases from the nematode Caenorhabditis elegans
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 207 Structure and conserved function of iso-branched sphingoid bases from the nematode Caenorhabditis
More informationPolyamine Functionalized Carbon Nanotubes: Synthesis, Characterization, Cytotoxicity and sirna Binding
Polyamine Functionalized Carbon Nanotubes: Synthesis, Characterization, Cytotoxicity and sirna Binding Prabhpreet Singh a, Cristian Samorì a, Francesca Maria Toma b, Cyrill Bussy c, Antonio Nunes c, Khuloud
More informationThiol-Activated gem-dithiols: A New Class of Controllable. Hydrogen Sulfide (H 2 S) Donors
Thiol-Activated gem-dithiols: A New Class of Controllable Hydrogen Sulfide (H 2 S) Donors Yu Zhao, Jianming Kang, Chung-Min Park, Powell E. Bagdon, Bo Peng, and Ming Xian * Department of Chemistry, Washington
More informationInhibition of Cancer-Associated Mutant Isocitrate. Dehydrogenases: Synthesis, SAR and Selective Antitumor. Activity
Supporting Information Inhibition of Cancer-Associated Mutant Isocitrate Dehydrogenases: Synthesis, SAR and Selective Antitumor Activity Zhen Liu,, Yuan Yao,, Mari Kogiso, Baisong Zheng, Lisheng Deng,
More informationChemo- and Enantioselective Rh-Catalyzed Hydrogenation of 3-Methylene-1,2-diazetidines: Application to Vicinal Diamine Synthesis
Chemo- and Enantioselective Rh-Catalyzed Hydrogenation of 3-Methylene-1,2-diazetidines: Application to Vicinal Diamine Synthesis Greg P. Iacobini, a David W. Porter, b and Michael Shipman* a a Department
More informationDual-site Controlled and Lysosome-targeted ICT-PET-FRET. Fluorescent Probe for Monitoring ph Changes in Living Cells
Supporting information for Dual-site Controlled and Lysosome-targeted ICT-PET-FRET Fluorescent Probe for Monitoring ph Changes in Living Cells Baoli Dong, Xuezhen Song, Chao Wang, Xiuqi Kong, Yonghe Tang
More informationA Facile Route to Triazolopyrimidines Using Continuous Flow Chemistry. Table of Contents
Supporting Information 1 A Facile Route to Triazolopyrimidines Using Continuous Flow Chemistry Sara Sadler a, Meaghan M. Sebeika a, Nicholas L. Kern a, David E. Bell a, Chloe A. Laverack a, Devan J. Wilkins
More informationSupplementary Information
Supplementary Information Efficient use of the Dmab Protecting Group: Applications for the Solid-Phase Synthesis of N- Linked Glycopeptides Trent Conroy, Katrina A. Jolliffe and Richard J. Payne* School
More informationAutomated synthesis of backbone protected peptides
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information Automated synthesis of backbone protected peptides Abu-Baker
More informationaq: aqueous;; Boc: tert butyloxycarbonyl; DCM: dichloromethane; br: broad; d:
SUPPLEMENTARY NOTE Synthetic Procedures 1 1 1 Abbreviations and Acronyms aq: aqueous;; Boc: tert butyloxycarbonyl; DCM: dichloromethane; br: broad; d: doublet; DIPEA: diisopropylethylamine; DME: dimethoxyethane;
More informationSUPPLEMENTAL FIGURE 1 Structures and IC50 values of compounds 13 32
SUPPLEMETAL FIGURE 1 Structures and IC50 values of compounds 13 32 THE JURAL F UCLEAR MEDICIE Vol. 53 o. 11 ovember 2012 Synthesis of [ 19 F]1 ([ 19 F]--(2-{4-[5-(benzyloxy)pyridin-2-yl]piperazin-1-yl}-2-oxoethyl)-
More informationCDI Mediated Monoacylation of Symmetrical Diamines and Selective Acylation of Primary Amines of Unsymmetrical Diamines
Supporting information: CDI Mediated Monoacylation of Symmetrical Diamines and Selective Acylation of Primary Amines of Unsymmetrical Diamines Sanjeev K. Verma*, Ramarao Ghorpade, Ajay Pratap and M. P.
More informationSupporting Information. for. Synthesis of 2,1-benzisoxazole-3(1H)-ones by basemediated. photochemical N O bond-forming
Supporting Information for Synthesis of 2,1-benzisoxazole-3(1H)-ones by basemediated photochemical N O bond-forming cyclization of 2-azidobenzoic acids Daria Yu. Dzhons and Andrei V. Budruev* Address:
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Exploiting the Ring Strain in Bicyclo[2.2.1]heptane Systems for the Stereoselective Preparation of Highly Functionalized Cyclopentene, Dihydrofuran, Pyrroline and Pyrrolidine Scaffolds
More informationSupporting Information
Supporting Information Wiley-VCH 2008 69451 Weinheim, Germany Chemoselective Peptide Cyclization via Induced Traceless Staudinger Ligation Rolf Kleineweischede, Christian P.R. Hackenberger* Institute for
More informationAn Unusual Glycosylation Product from a Partially Protected Fucosyl Donor. under Silver Triflate activation conditions. Supporting information
An Unusual Glycosylation Product from a Partially Protected Fucosyl Donor under Silver Triflate activation conditions Robin Daly a and Eoin M. Scanlan* a e-mail: eoin.scanlan@tcd.ie a Trinity Biomedical
More informationAn Orthogonal Array Optimization of Lipid-like Nanoparticles for. mrna Delivery in Vivo
Supporting Information An rthogonal Array ptimization of Lipid-like Nanoparticles for mrna Delivery in Vivo Bin Li, Xiao Luo, Binbin Deng, Junfeng Wang, David W. McComb, Yimin Shi, Karin M.L. Gaensler,
More informationSupplementary Material
10.1071/C15460_AC CSIR 2016 Australian Journal of Chemistry 69 (3), 328-335 Supplementary Material Synthesis and Characterization of Bradykinin Derivatives Based on a β-cyclodextrin Core Rachel J. Stephenson,
More informationSupporting Information for. An approach to hyperolactone C and analogues using late stage conjugate addition on an oxonium ylide-derived spirofuranone
Supporting Information for An approach to hyperolactone C and analogues using late stage conjugate addition on an oxonium ylide-derived spirofuranone David M. Hodgson* Elena Moreno-Clavijo, Sophie E. Day
More informationSupporting Information
Supporting Information The Discovery of The First α-amino-3-hydroxy-5- Methyl-4-Isoxazolepropionic Acid (AMPA) Receptor Antagonist Dependent Upon Transmembrane AMPA Receptor Regulatory Protein (TARP) Gamma-8
More informationSupporting Information
Zinc-Mediated Addition of Diethyl Bromomalonate to Alkynes for the Cascade Reaction towards Polysubstituted Pyranones and Tetracarbonyl Derivatives Anne Miersch, Klaus Harms, and Gerhard Hilt* Fachbereich
More informationSupporting Information. Stereoselective synthesis of trans-fused iridoid. lactones and their identification in the parasitoid
Supporting Information for Stereoselective synthesis of trans-fused iridoid lactones and their identification in the parasitoid wasp Alloxysta victrix, Part I: Dihydronepetalactones Nicole Zimmermann,
More informationin palmitoylation of numerous proteins. P10 mitochondria enriched fractions from primary rat
SUPPLEMENTARY MATERIALS: Supplementary Figures: Supplementary Figure S1. Alkynyl-palmitate is readily imported into mitochondria resulting in palmitoylation of numerous proteins. P10 mitochondria enriched
More informationCHAPTER - 2 SYNTHESIS AND CHARACTERIZATION
26 CHAPTER - 2 SYNTHESIS AND CHARACTERIZATION OF NOVEL ANTI-LIPIDEMIC AGENTS 27 2.1 - INTRODUCTION 2.1.1 - Drug Discovery and Anti-lipidemic agents: Anti-lipidemic agents are basic drugs for prevention
More informationSupporting information
Supporting information Diversity Oriented Asymmetric Catalysis (DOAC): Stereochemically Divergent Synthesis of Thiochromanes Using an Imidazoline-aminophenol aminophenol (IAP)-Ni Catalyzed Michael/Henry
More informationSUPPLEMENTARY RESULTS 2 EXPERIMENTAL METHODS 5 REAGENTS AND EQUIPMENT 5 SYNTHESIS OF 1,3,5-TRIS(MERCAPTOMETHYL)BENZENE (2) 5 SYNTHESIS OF
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 SUPPLEMENTARY RESULTS 2 EXPERIMENTAL METHODS 5 REAGENTS AND EQUIPMENT 5 SYNTHESIS OF 1,3,5-TRIS(MERCAPTOMETHYL)BENZENE
More informationSupplementary Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2017 Supplementary Information Geometrical Confinement Directed Albumin-Based
More informationCu-Catalyzed Direct C6-Arylation of Indoles
Cu-Catalyzed Direct C6-Arylation of Indoles (Supporting Information) Youqing Yang, Ruirui Li, Yue Zhao, Dongbing Zhao, and Zhuangzhi Shi*, State Key Laboratory of Coordination Chemistry, Collaborative
More informationCopyright Wiley-VCH Verlag GmbH, D Weinheim, Angew. Chem
Copyright Wiley-VCH Verlag GmbH, D-69451 Weinheim, 2000. Angew. Chem. 2000. Supporting Information for Salen as Chiral Activator : Anti vs Syn Switchable Diastereoselection in the Enantioselective Addition
More informationA multicomponent CuAAC click approach. to a library of hybrid polydentate 2-pyridyl- the generation of metallosupramolecular. architectures.
Supporting information A multicomponent CuAAC click approach to a library of hybrid polydentate 2-pyridyl- 1,2,3-triazole ligands: New building blocks for the generation of metallosupramolecular architectures.
More informationStructure Enabled Design of BAZ2-ICR, a Chemical Probe Targeting the Bromodomains of BAZ2A and BAZ2B. Table of Contents
Supporting information For Structure Enabled Design of BAZ2-ICR, a Chemical Probe Targeting the Bromodomains of BAZ2A and BAZ2B Ludovic Drouin, # Sally McGrath, # Lewis R. Vidler, # Apirat Chaikuad, Octavio
More informationElectronic Supplementary Material
Electronic Supplementary Material PAMAM Dendrimers Bearing Electron-Donating Chromophores: Fluorescence and Electrochemical Properties Bing-BingWang a, Xin Zhang a, Ling Yang a, Xin-Ru Jia* a, Yan Ji a,
More informationNovel D-erythro N-Octanoyl Sphingosine Analogs As Chemo- and Endocrine. Resistant Breast Cancer Therapeutics
Page 11 of 32 Cancer Chemotherapy and Pharmacology Novel D-erythro N-Octanoyl Sphingosine Analogs As Chemo- and Endocrine Resistant Breast Cancer Therapeutics James W. Antoon, Jiawang Liu, Adharsh P. Ponnapakkam,
More informationIn situ thioester formation for protein ligation using α-methyl cysteine F. Burlina, G. Papageorgiou, Caroline Morris, Peter D. White and J.
Electronic Supplementary Information In situ thioester formation for protein ligation using α-methyl cysteine F. Burlina, G. Papageorgiou, Caroline Morris, Peter D. White and J. Offer* Abbreviations ACN:
More informationOrganic Letters. Synthesis of Oxygen-Free [2]Rotaxanes: Recognition of Diarylguanidinium Ions by Tetraazacyclophanes. and Sheng-Hsien Chiu*
Organic Letters Synthesis of Oxygen-Free [2]Rotaxanes: Recognition of Diarylguanidinium Ions by Tetraazacyclophanes Yu-Hsuan Chang, Yong-Jay Lee, Chien-Chen Lai, Yi-Hung Liu, Shie-Ming Peng, and Sheng-Hsien
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Exponential growth of functional poly(glutamic acid) dendrimers with varying stereochemistry Sebastian Hartwig, Mary M. Nguyen and Stefan Hecht* Department of Chemistry, Humboldt-Universität
More informationStereoselective Aza-Darzens Reactions of Tert- Butanesulfinimines: Convenient Access to Chiral Aziridines
Stereoselective Aza-Darzens Reactions of Tert- Butanesulfinimines: Convenient Access to Chiral Aziridines Toni Moragas Solá, a Ian Churcher, b William Lewis a and Robert A. Stockman* a Supplementary Information
More informationSupplementary Material. Efficient Synthesis of an Indinavir Precursor from Biomass Derived (-)- Levoglucosenone
1.171/CH17227_AC CSIRO 217 Australian Journal of Chemistry 217, 7(1), 1146-115 Supplementary Material Efficient Synthesis of an Indinavir Precursor from Biomass Derived (-)- Levoglucosenone Edward T. Ledingham,
More informationSupporting Information. Copyright Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, 2006
Supporting Information Copyright Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, 2006 Gold Catalysis: The Phenol Synthesis in the Presence of Functional Groups A. Stephen K. Hashmi, Jan P. Weyrauch,
More informationEur. J. Org. Chem WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim, 2009 ISSN X SUPPORTING INFORMATION
Eur. J. rg. Chem. 2009 WILEY-VC Verlag Gmb & Co. KGaA, 69451 Weinheim, 2009 ISS 1434 193X SUPPRTIG IFRMATI Title: ew GM1 Ganglioside Derivatives for Selective Single and Double Labelling of the atural
More informationNitro-Grela-type complexes containing iodides. robust and selective catalysts for olefin metathesis
Supporting Information for Nitro-Grela-type complexes containing iodides robust and selective catalysts for olefin metathesis under challenging conditions. Andrzej Tracz, 1,2 Mateusz Matczak, 1 Katarzyna
More information