GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
|
|
|
- Michael Stephens
- 5 years ago
- Views:
Transcription
1 a GPR120 GPR120 mrna/ppia mrna Arbitrary Units Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction camp camp SB H GW7647 Supplementary Figure 1. GPR120 expression and effects of p38 MAPK and PKA inhibitors and PPARα agonist on UCP1 mrna levels. (a) GPR120 mrna expression in mouse tissues using cyclophilin mrna as housekeeping reference gene. Bars are means s.e.m. (P <0.05, P <0.01, P <0.001 compared with ileum; two-tailed unpaired student t-test). (b) Effects of 10 μm SB (a p38 MAPK inhibitor), or 20 μm H89 (a PKA inhibitor) on the up-regulation of UCP1 mrna in response to 1mM dibutyryl-camp, and effects of 1 μm GW7647 (PPARα agonist) in brown adipocytes differentiated in primary culture (n = 4). Bars are means s.e.m. (P <0.05, P <0.001 compared with controls; P<0.01, P<0.001 for the effects of SB or H89; ANOVA with Tukey s post hoc test).
2 Relative lipid content (%) mrna fold induction a 5 Control GW b PGC-1 UCP1 Glut1 PRDM16 CoxIV Sirt3 FABP4 Lep tin Thermogenic Genes Adipogenic Genes c C GW Supplementary Figure 2. Effects of GW9508 on thermogenic genes in epididymal WAT. Adult mice were fed for 7 days a control diet (white bars) or a diet supplemented with GW9508 (blue bars) (n = 6). (a) Relative expression levels of thermogenic and adipogenic genes in ewat, (b) representative optical microscopy images from H&E-stained ewat (scale, 125µm), (c) relative lipid content. Bars are means s.e.m. (P<0.05 and P<0.01relative to untreated control mice; twotailed unpaired student t-test).
3 a Relative transcript levels GPR40mRNA ND ND ND Liver BAT iwat ew AT mw AT Ileum b Relative transcript levels GW9508 Glucagon gene (GLP-1) mrna FGF21 mrna ND ND - - Ileum Supplementary Figure 3. GPR40 mrna expression levels in adipose depots and GW9508 effect on intestinal cells. (a) GPR40 mrna expression levels in mouse tissues (n = 4). (b) Relative expression levels of GLP-1 and FGF21 in Ileum from adult mice fed for 7 days a control diet (white bars) or a diet supplemented with GW9508 (blue bars). Bars are means s.e.m. (P<0.05 relative to liver GPR40 mrna expression; two-tailed unpaired student t-test).
4 a Relative transcript levels Interscapular Brown Adipose Tissue Wild-type Wild-type fed GW9508 GPR120 -/- GPR120 -/- fed GW9508 PGC-1 UCP 1 Glut1 PRD M16 Bmp8b CoxIV Sirt3 FABP4 Leptin Thermogenic Genes Adipogenic Genes b Wild-type GPR120 -/- C GW9508 C GW9508 c d Relative lipid droplet content (%) UCP1/BAT (A.U.) UCP1 protein Supplementary Figure 4. Effects of GPR120 gene invalidation on the response to GW9508 treatment in ibat. Wild-type and GPR120-/- mice (n = 5) were fed for 7 days a control diet (white and grey bars, respectively) or a diet supplemented with GW9508 (blue and black bars, respectively). (a) Relative expression levels of thermogenic and adipogenic genes in ibat. (b) Representative optical microscopy from H&E-stained ibat (scale, 200µm), (c) relative lipid content, (d) UCP1 protein levels. Bars are means s.e.m. (P<0.05, P<0.01, and P<0.001 relative to untreated mice of each genotype; P<0.05, P<0.01 relative to the effects of the genotype in mice under the same treatment; ANOVA with Tukey s post hoc test).
5 a mrna fold induction Thermogenic Genes Wild-type GPR120 -/ FGF21 Bmp8b PGC-1α UCP1 Glut1 PRDM16 CoxIV Sirt3 FABP4 Leptin Adipogenic Genes b Wild-type GPR120 -/- Relative lipid content (%) c Relative mrna levels2.0 Liver FGF21 mrna Muscle FGF21 mrna Supplementary Figure 5. Effects of GPR120 invalidation on ibat from mice exposed to cold. Wild-type (white bars) and GPR120-/- (grey bars) mice were exposed to cold (4ºC) for 7 days (n=5). (a) Relative expression levels of thermogenic and adipogenic genes in ibat. (b) Representative images of H&E-stained ibat (scale, 125µm) and the relative lipid droplet content. (c) FGF21 mrna expression levels in liver and skeletal muscle. Bars are means s.e.m. (P<0.05, relative to wildtype control mice; two-tailed unpaired student t-test).
6 Supplementary Figure 6. GPR120 activation induces thermogenesis-related genes expression, glucose oxidation and FGF21 protein release in brown adipocytes. ibat precursors were differentiated and treated for 24h with 100µM GW9508 (n = 5) (a) Relative expression levels of UCP1, PGC-1α, CoxIV, FGF21 and Glut1. (b) FGF21 protein in supernatant (24h accumulation). (c) Glucose oxidation rate. (d) Cell culture temperature. Bars are means s.e.m. (P<0.05, P<0.01, and P<0.001 relative to untreated control cells; two-tailed unpaired student t-test).
7 Supplementary Figure 7. GPR120 activation promotes ewat derived beige adipocyte differentiation and increases FGF21 expression and release. For a-c, ewat precursors from wild-type mice were differentiated (n=3-5) in the presence of the differentiation media (DM) (n=3), supplemented with rosiglitazone to drive beige differentiation (DM Rosiglitazone)(n=5), or treated with GW9508 instead of rosiglitazone (DM GW9508) (n=5) (see Methods section). (a) Representative optical microscopy images at the end of differentiation (day 7) (scale bar, 200µm). (b) Relative mrna expression levels of browning-related and general adipogenic genes. (c) Cell culture temperature. For d-g, ewat precursors from wild-type mice were differentiated and treated during 24h with GW9508 (100µM) (n=5). (d) mrna expression levels of UCP1, PGC-1α, Glut1, COXIV, FGF21, Sirt3, and FABP4. (e) FGF21 protein levels in culture media (24h accumulation). (f) Glucose oxidation rate. (g) Cell culture temperature. Bars are means s.e.m. (P<0.05, p<0.01, and p<0.001 versus controls; two-tailed unpaired student t-test).
8 a mrna fold induction PPARα gene invalidation Control GW9508 Eicosapentaenoic Acid FGF21 UCP1 PGC-1 FGF21 UCP1 PGC-1 Wild-type PPARα KO b PPARγ antagonism Control GW9508 Eicosapentaenoic Acid mrna fold induction FGF21 UCP1 PGC-1 FGF21 UCP1 PGC-1 Control GW9662 Supplementary Figure 8. Involvement of the PPARα and PPARγ pathways in the FGF21 induction elicited by activation of GPR120. (a) ibat precursors from wild-type and PPARα null mice were differentiated and treated during 24h with GW9508 (100µM) or EPA (100µM). Relative mrna expression for FGF21, UCP1 and PGC-1α is shown (n = 3). (b) ibat precursors from wildtype mice were differentiated and treated with GW9508 or EPA and the PPARγ antagonist (GW9662). Relative mrna expression for FGF21, UCP1 and PGC-1α is shown (n = 3). Bars are means s.e.m. (P<0.05, p<0.01, and p<0.001 versus controls; P<0.05, p<0.01, and p<0.001 PPARα-null cells or GW9662 treated cells; ANOVA with Tukey s post hoc test).
9 Supplementary Figure 9. Effects of GW9508 or EPA on FGF21 mrna expression in the presence of kinases inhibitors, phosphorylation of regulatory kinases, and FGF21 gene promoter activity. Brown adipocytes in culture were used. (a) FGF21 mrna expression after 24h treatment with GW9508 (100µM) or EPA (100µM) in the presence of 2 µm wortmannin (PI3K inhibitor), 10 µm compound C (AMP kinase inhibitor),10 µm SB (p38 MAPK inhibitor), 20 µm H89 (PKA inhibitor), 10 µm U-0128 (ERK inhibitor) (n = 4). (b) Relative levels of phosphorylated versus total kinases in response to GW9508 or EPA at the indicated times of treatment (n = 3). (c) Wild-type (1.4 FGF21-Luc) and deleted (69-FGF21-Luc) FGF21 gene promoter activity in transfected brown adipocytes in response to GW9508 or EPA. Effects of co-transfection with the dominant negative form of MKK6 (K82A) (n = 4). Bars are means s.e.m. (P<0.05, versus controls in the absence of inhibitors in (a), and versus non-treated cells in (b) and (c); for a, Student s t test was used and for b and c, ANOVA and Tukey post-hoc tests.
10 mrna fold induction 5 Wt Control Wt GW9508 FGF21 -/- Control FGF21 -/- GW PGC-1 UCP1 Glut1 PRDM16 CoxIV Sirt3 FABP4 Leptin Thermogenic Genes Adipogenic Genes Supplementary Figure 10. Impaired effects of GW9508 on FGF21-null beige adipocytes derived from ewat. ewat precursors from wild-type and FGF21-null mice were differentiated and treated with GW9508 (24h) (n = 5), mrna expression levels of thermogenic and adipogenic genes are shown. Bars are means s.e.m. (P<0.05, P<0.01, for the effects of GW9508; and P<0.05, P<0.01, for comparisons between wild-type and FGF21-null cells; ANOVA with Tukey s post hoc test).
11 Supplementary Figure 11. Validation of specificity of GPR120 detection by immunoblot using BAT from GPR120-null mice. The Figure shows a representative western blot of 20 µg of protein extracts from mouse ibat from wild-type (WT) and GPR120-null (KO) mice probed with the sc rabbit anti-gpr120 antibody (1:150) (Santa Cruz, USA). N.s., non-pecific. GAPDH, probing of the membrane with the leading control GAPDH (1:3000) to ensure equal loading of lanes.
12 Supplementary Figure 12. Methodology for infrared thermography of brown adipocytes in culture. Example of thermographic recording of brown adipocytes in culture as described in Methods.
13 Western blot figure 1 b: Cold (4ºC) C 24h 7d 21d Cold (4ºC) C 24h 7d 21d BAT 50 KDa Cold (4ºC) C 24h 7d 21d Cold (4ºC) C 24h 7d 21d iwat 50 KDa Western blot figure 1 f: C NE camp 6h 24h 24h C NE camp 6h 24h 24h 50 KDa Western blot figure 2: BAT 25 KDa Wild-type GPR120-/- Wild-type GPR120-/- C GW9508 C GW9508 C GW9508 C GW9508 Wild-type GPR120-/- Wild-type GPR120-/- C GW9508 C GW9508 C GW9508 C GW9508 iwat 25 KDa Supplementary Figure 13. Uncropped western blots and markers. Immunoblots (left) and Ponceau-stained membranes showing weight markers (right). Arrow, specific immunoblot signal. Black areas, lanes unrelated to current study.
14 Supplementary Table 1. Tissue weight, body temperature and circulating metabolic and hormonal parameters in mice treated with dietary GW9508 for 7 days Adult mice were fed a standard chow diet supplemented with or without GW9508 for 7 days. Data are means ± s.e.m. (P<0.05 relative to untreated control mice; two-tailed unpaired student t-test). Control (n=5) GW9508(n=6) Body Weight (g) 29.0 ± ,6 ± 0.6 Food intake (g) 6.4 ± ± 0.6 ibat (mg) 99.4 ± ± 3.1 iwat (mg) 95.4 ± ± 11.8 ewat (mg) ± ± 25.9 mwat (mg) ± ± 13.0 Rectal temperature (ºC) 35.7 ± ± 0.4 Core temperature (eye) (ºC) 35.9 ± ± 0.3 Glucose (mg/dl) 183 ± ± 14 Triglycerides (mg/dl) 140 ± ± 12 Insulin (pg/dl) 966 ± ± 62 IL-6 (pg/dl) 54 ± ± 11 Leptin (pg/dl) 1090 ± ± 324 PAI1 (pg/dl) 1168 ± ± 329 Resistin (pg/dl) 1930 ± ± 171
15 Supplementary Table 2. Tissue weight, body temperature and circulating metabolic and hormonal parameters in wild-type mice and GPR120-null mice treated with dietary GW9508 for 7 days Adult mice were fed a standard chow diet supplemented with or without GW9508 for 7 days. Data are means ± s.e.m. (P<0.05 relative to untreated control mice; ANOVA with Tukey s post hoc test). Wild-type GPR120-/- Control GW9508 Control GW9508 Body weight (g) 27.7 ± ± ± ± 0.3 Food intake (g) 4.0 ± ± ± ± 0.21 ibat (mg) 83.7 ± ± ± ± 7.4 iwat (mg) ± ± ± ± 31.9 ewat(mg) ± ± ± ± 50.0 Core temperature (eye) (ºC) 35.8 ± 0, ± 0, ± 0, ± 0.2 Glucose (mg/dl) 195 ± ± ± ± 17 Triglycerides (mg/dl) 159 ± ± ± ± 19 Insulin (pg/dl) 1520 ± ± ± ± 180
16 Supplementary Table 3. TaqMan probes (Applied Biosystems) used for RT-PCR quantification of gene transcripts. Gene 18S rrna FGF21 PGC-1alpha UCP1 Glut1 PRDM16 Bmp8b CoxIV Sirt3 PPARg FABP4 GPR120 GPR40 Leptin Reference Hs _s1 Mm _g1 Mm447183_m1 Mm _m1 Mm _m1 Mm _m1 Mm _g1 Mm _g1 Mm _m1 Mm440945_m1 Mm _m1 Mm _m1 Mm _s2 Mm _m1 PPIA( cyclophillin) Mm _g1
SUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
SUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
Supplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supplementary Figure 1.
Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration
Supplementary Figure 1
VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat
A microrna-34a/fgf21 Regulatory Axis and Browning of White Fat Jongsook Kim Kemper, Ph.D Department of Molecular and Integrative Physiology, University of Illinois at Urbana-Champaign, USA 213 International
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
Control 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
a b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
Supplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Brown Adipose Tissue Responds to Cold and Adrenergic Stimulation by Induction of FGF21
Brown Adipose Tissue Responds to Cold and Adrenergic Stimulation by Induction of FGF21 Dionysios V Chartoumpekis, 1* Ioannis G Habeos, 1* Panos G Ziros, 1 Agathoklis I Psyrogiannis, 1 Venetsana E Kyriazopoulou,
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
Table 1. Oligonucleotides and RT-PCR conditions Supplementary Material and Methods Fig. 1
Table 1. Oligonucleotides and RT-PCR conditions. Overview of PCR templates, gene accession number of sequences used as template, product size, annealing temperatures and optimal cycles, cdna and MgCl 2
Molecular Medicine. Brown adipose tissue responds to cold and adrenergic
Brown adipose tissue responds to cold and adrenergic stimulation by induction of FGF21 Dionysios V. Chartoumpekis, 1, Ioannis G. Habeos, 1, Panos G. Ziros, 1 Agathoklis I. Psyrogiannis, 1 Venetsana E.
ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota
Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,
HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Supplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8
1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,
Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue
Manuscript EMBO-2015-40819 Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue Wuping Sun, Kunitoshi Uchida, Yoshiro Suzuki, Yiming Zhou, Minji Kim, Yasunori Takayama, Nobuyuki Takahashi,
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
Supporting Information
Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs
Regulation of adipose tissue remodeling by peripheral serotonin
Regulation of adipose tissue remodeling by peripheral serotonin Sangkyu Park Catholic Kwandong University College of Medicine Department of Biochemistry Serotonin (5-HT) is a signaling molecule Hemostasis
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Project Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids
Project Summary Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids Principal Investigators: S. Smith 1, B. Johnson 2 and M. Doumit 3 Texas A&M University 1, Texas Tech University
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1
Title: Obesity in mice with adipocyte-specific deletion of clock component Bmal1 Authors: Georgios K. Paschos, Salam Ibrahim, Wen-Liang Song, Takeshige Kunieda, Gregory Grant, Teresa M. Reyes, Christopher
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
In The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Supplemental Information. Brown Adipogenic Reprogramming. Induced by a Small Molecule
Cell Reports, Volume 18 Supplemental Information rown dipogenic Reprogramming Induced by a Small Molecule aoming Nie, Tao Nie, Xiaoyan Hui, Ping Gu, Liufeng Mao, Kuai Li, Ran Yuan, Jiashun Zheng, Haixia
FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
Metabolic Solutions Development Company, Kalamazoo, USA.
New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.
GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC
Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis
Article Mfn2 deletion in brown adipose tissue protects from insulin resistance and impairs thermogenesis Kiana Mahdaviani 1,2, Ilan Y Benador 1,2, Shi Su 1, Raffi A Gharakhanian 1, Linsey Stiles 1,2, Kyle
ECM microenvironment unlocks brown adipogenic potential of adult human bone marrow-derived MSCs
SUPPLEMENTARY INFORMATION ECM microenvironment unlocks brown adipogenic potential of adult human bone marrow-derived MSCs Michelle H. Lee 1,2,3,+, Anna G. Goralczyk 1,3,+, Rókus Kriszt 1,2,3, Xiu Min Ang
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Expanded View Figures
Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction
Intestine-selective farnesoid X receptor inhibition improves obesity-related metabolic dysfunction Jiang, C., Xie, C., Lv, Y., Li, J., Krausz, K. W., Shi, J.,... & Gonzalez, F. J. (215). Intestine-selective
Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes
Research article Related Commentary, page 804 Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes Marica Bordicchia, 1,2 Dianxin Liu,
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
Control. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
Beneficial effects of naringenin and indomethacin on white and brown adipocytes
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Masters Theses Graduate School 12-2016 Beneficial effects of naringenin and indomethacin on white and brown adipocytes
DOI: 10.1038/ncb2210 b. ICAM1 ng ml -1 P = 0.0001 Small RNA (15-30nts) ng ml -1 Cell Lysate Exosome HDL Plasma HDL Normal Human HDL mirnas R = 0.45 P < 0.0001 Normal Human Exosome mirnas Figure S1. Characterization
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Histone demethylase JMJD1A coordinates acute and chronic adaptation to cold stress via thermogenic phospho-switch. Abe et al.
Histone demethylase JMJD1A coordinates acute and chronic adaptation to cold stress via thermogenic phospho-switch Abe et al. a BAT 1 kb Ucp1 H3Kme3 H3K7ac (., ) (., ) -13 kb -. kb -. kb b scwat Chronic
Supporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c
ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
Nature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,