Transforming Growth Factor- 1 Stimulates L-Arginine Transport and Metabolism in Vascular Smooth Muscle Cells
|
|
- Lee Johnson
- 5 years ago
- Views:
Transcription
1 Transforming Growth Factor- 1 Stimulates L-Arginine Transport and Metabolism in Vascular Smooth Muscle Cells Role in Polyamine and Collagen Synthesis William Durante, PhD; Lan Liao, MS; Sylvia V. Reyna, BS; Kelly J. Peyton, MA; Andrew I. Schafer, MD Background Transforming growth factor- 1 (TGF- 1 ) contributes to arterial remodeling by stimulating vascular smooth muscle cell (VSMC) growth and collagen synthesis at sites of vascular injury. Because L-arginine is metabolized to growth-stimulatory polyamines and to the essential collagen precursor L-proline, we examined whether TGF- 1 regulates the transcellular transport and metabolism of L-arginine by VSMCs. Methods and Results TGF- 1 increased L-arginine uptake, and this was associated with a selective increase in cationic amino acid transporter-1 (CAT-1) mrna. In addition, TGF- 1 stimulated L-arginine metabolism by inducing arginase I mrna and arginase activity. TGF- 1 also stimulated L-ornithine catabolism by elevating ornithine decarboxylase (ODC) and ornithine aminotransferase (OAT) activity. TGF- 1 markedly increased the capacity of VSMCs to generate the polyamine putrescine and L-proline from extracellular L-arginine. The TGF- 1 mediated increase in putrescine and L-proline production was reversed by methyl-l-arginine, a competitive inhibitor of cationic amino acid transport, or by hydroxy-l-arginine, an arginase inhibitor. Furthermore, the formation of putrescine was inhibited by the ODC inhibitor -difluoromethylornithine, and L-proline generation was blocked by the OAT inhibitor L-canaline. L-Canaline also inhibited TGF- 1 stimulated type I collagen synthesis. Conclusions These results demonstrate that TGF- 1 stimulates polyamine and L-proline synthesis by inducing the genes that regulate the transport and metabolism of L-arginine. In addition, they show that TGF- 1 stimulated collagen production is dependent on L-proline formation. The ability of TGF- 1 to upregulate L-arginine transport and direct its metabolism to polyamines and L-proline may contribute to arterial remodeling at sites of vascular damage. (Circulation. 2001;103: ) Key Words: muscle, smooth amino acids collagen L-Arginine is a dibasic, semiessential amino acid involved in a variety of physiological processes. It is a necessary precursor for protein, creatine, polyamine, L-proline, and nitric oxide (NO) biosynthesis and serves as an intermediate in the urea cycle. 1 Although L-arginine can be obtained by endogenous synthesis, most cells rely on extracellular transport for their L-arginine requirements. In vascular smooth muscle cells (VSMCs), the uptake of L-arginine is mediated by the system y carrier. 2,3 This particular transport system is characterized by its high affinity for cationic amino acids, its independence of Na, and the ability of substrate on the opposite (trans) side of the membrane to increase transport activity. 4 Recently, the genes encoding the proteins responsible for the activity of the system y carrier have been cloned and designated as cationic amino acid transporter-1 (CAT-1), CAT-2, CAT-2A, and CAT-3. Whereas CAT-1, CAT-2, and CAT-3 are high-affinity (K m 100 mol/l) transporters for L-arginine, CAT-2A is an alternative splice variant of CAT-2 that possesses low affinity (K m 1 to 2 mmol/l) for L-arginine. 5 9 Previous studies in our laboratory and others have demonstrated that VSMCs express only CAT-1 and CAT-2 mrna and that specific humoral mediators induce gene expression of both of these transporters Once transported into VSMCs, L-arginine is metabolized to important regulatory molecules. Inducible NO synthase converts L-arginine to NO, which is a potent inhibitor of VSMC growth and collagen synthesis. 15,16 Alternatively, L-arginine is metabolized to L-ornithine by arginase. 1 There are 2 distinct isoenzymes of mammalian arginase that are encoded by separate genes. 17,18 Although these isozymes possess similar Received June 26, 2000; revision received August 24, 2000; accepted September 8, From Houston VA Medical Center and the Departments of Medicine (W.D., L.L., S.V.R., K.J.P., A.I.S.) and Pharmacology (W.D.), Baylor College of Medicine, Houston, Tex. Guest Editor for this article was Joseph Loscalzo, MD, PhD, Boston University School of Medicine, Boston, Mass. Correspondence to William Durante, PhD, Houston VA Medical Center, Building 109, Room 130, 2002 Holcombe Blvd, Houston, TX wdurante@bcm.tmc.edu 2001 American Heart Association, Inc. Circulation is available at
2 1122 Circulation February 27, 2001 enzymatic properties, they differ with regard to their tissue distribution, subcellular localization, and immunological reactivity. 19 Type I arginase is a cytosolic enzyme that is highly expressed in the liver and constitutes a majority of total body arginase activity. 20 In contrast, arginase II is a mitochondrial enzyme that is found predominantly in extrahepatic tissues. 20 The arginase metabolite L-ornithine is metabolized by ornithine decarboxylase (ODC) to the polyamine putrescine, which forms the successive polyamines spermine and spermidine via the sequential transfer of a propylamine moiety from S-adenosylmethionine. 21 Polyamines play an integral role in the mitogenic response of VSMCs. VSMC proliferation is preceded by increases in ODC activity and polyamine synthesis, and inhibition of polyamine formation inhibits VSMC growth. 10,14,22 L-Ornithine is also converted by the mitochondrial enzyme ornithine aminotransferase (OAT) to pyrroline-5-carboxylate, which is further metabolized to L-proline, which is essential for the synthesis of many structural proteins, including collagen. 22 Transforming growth factor- 1 (TGF- 1 ) plays an important role in development, differentiation, immune function, and tissue repair. In the vasculature, TGF- 1 plays a critical role in arterial remodeling by stimulating VSMC proliferation and collagen deposition Because L-arginine can be metabolized to important growth-regulatory molecules and to the essential matrix component L-proline, the present study examined the effect of TGF- 1 on L-arginine transport and metabolism in VSMCs. We now report that TGF- 1 stimulates the transport of L-arginine and directs its metabolism to L-ornithine by coordinately inducing CAT-1 and arginase I gene expression. In addition, we demonstrate that TGF- 1 stimulates L-ornithine metabolism in VSMCs, resulting in the production of growth-stimulatory polyamines and of the integral collagen constituent L-proline. Methods Materials L-Arginine, FCS, minimum essential media, SDS, EDTA, methyl-larginine (L-NMA), L-canaline, ammonium hydroxide, chloroform, formamide, urea, -mercaptoethanol, Tris, HEPES, ninhydrin spray, and thinlayer chromatography plates were purchased from Sigma Chemical Co; TGF- 1 wasfromr&dsystems Inc; Dowex resin (50W-X8, 100- to 200-mesh), DDT, and nitrocellulose were from Bio-Rad Laboratories; GAPDH cdna and RNA molecular weight markers were from Ambion Inc; hydroxy-l-arginine (L-NOHA) was from Alexis Corp; rabbit anti-rat collagen type I polyclonal antibody was from Biodesign International; -difluoromethylornithine (DFMO) was generously provided by Dr Ekkhardt H.W. Bohme (Hoechst Marion Roussel, Cincinnati, Ohio); [ 3 H]L-arginine (58 Ci/mmol) was from American Radiolabeled Chemicals; and [1-14 C]L-ornithine (55 mci/mmol), [guanido- 14 C]L-arginine (52 Ci/ mmol), and [ - 32 P]UTP (400 Ci/mmol) were from Amersham Life Sciences. VSMC Culture VSMCs were isolated from rat thoracic aorta and cultured in minimum essential medium. 14 When cells reached confluence, the culture media were replaced with serum-free media containing BSA (0.1%) for 24 hours and then exposed to the various treatment regimens. L-Arginine Transport L-Arginine transport was determined by measuring the influx of [ 3 H]L-arginine into VSMCs, as previously described. 10,13,14 Arginase Activity VSMC lysates were prepared by sonication in Tris buffer (10 mmol/l Tris, 0.4% Triton X-100, 10 mg/ml leupeptin, and 10 mg/ml aprotinin, ph 7.4), and arginase activity was determined by monitoring the formation of [ 14 C]urea from [guanido- 14 C]L-arginine. 13 ODC Assay VSMCs were harvested in ice-cold Tris buffer (mmol/l: Tris 20, EDTA 0.1, DTT 2, and pyridoxal-5-phosphate 0.1, ph 7.4), sonicated, and centrifuged at g for 20 minutes at 4 C. The supernatant was collected, and ODC activity was determined by measuring the release of [ 14 C]CO 2 from [1-14 C]L-ornithine, as previously described. 13 OAT Assay VSMC lysates were prepared by sonication in KPO 4 buffer (0.1 mol/l KPO 4,50 mol/l pyridoxal-5-phosphate, 10 mg/ml leupeptin, and 10 mg/ml aprotinin, ph 7.4), and OAT activity was determined by measuring the conversion of [ 3 H]L-ornithine to [ 3 H]pyrroline-5-carboxylate. 22 Polyamine and L-Proline Production Polyamine and L-proline formation were determined by incubating VSMCs with [ 3 H]L-arginine (20 Ci/mmol) for 24 hours and measuring the intracellular formation of radiolabeled putrescine and L-proline by thin-layer chromatography, as previously described. 13,14 Generation of CAT and Arginase Probes CAT and arginase cdna fragments were amplified from VSMCs by reverse transcriptase polymerase chain reaction (RT-PCR). 10 Primers were designed according to the published sequence of the rat CAT and arginase gene products. The forward 5 -TGGCACTCTCC- TGGCTTACT-3 and the reverse 5 -ACTTCTCGGCTGCTGGTA- AA-3 primers were used to amplify a 182-bp CAT-1 transcript, and the forward 5 -GGGTGTCTTTCCTCATCGCTG-3 and the reverse 5 -CAAAGGTGCCACTCCATGCTC-3 primers were used to amplify a 210-bp CAT-2 transcript. 6,7 The forward 5 -TAGAGAAA- GGTCCCGCAGCAT-3 and reverse 5 -TGCTTCCAATTGCCAT- ACTGTG-3 primers were used to amplify a 252-bp arginase I transcript, and the forward 5 -CCTAGTGAAGCTGCGAAC- GTG-3 and reverse 5 -AGAGAAAGGGGCTCCGACTACA-3 were used to amplify a 197-bp arginase II transcript. 17,18 The PCR fragments were then subcloned into pcrii plasmids (Invitrogen) and sequenced to confirm their identity and orientation. Ribonuclease Protection Assay Total RNA (15 g) was hybridized with cpm of [ 32 P]UTPlabeled antisense CAT, arginase, and GAPDH (316-bp) riboprobes. Protected RNA was analyzed by electrophoresis using 6% acrylamide/8 mmol/l urea gels. The size of the protected nucleotide fragments was confirmed by use of a 32 P-labeled RNA ladder. Relative mrna levels were quantified by scanning densitometry (LKB Ultrascan laser densitometer) and normalized with respect to GAPDH mrna. Collagen Synthesis Culture media were collected and concentrated with Centricon YM30 filters (Amicon Inc), and proteins were solubilized with electrophoresis buffer [125 mmol/l Tris-HCl (ph 6.8), 2% SDS, 12.5% glycerol, 1% -mercaptoethanol, and trace bromphenol blue]. Samples were boiled and proteins separated by SDS-PAGE using 6% gels. Gels were electrophoretically transferred to nitrocellulose membranes, blocked for 1 hour at room temperature in Tris buffer (50 mmol/l, ph 7.4) containing 1% BSA, and incubated with rabbit anti collagen type I antibody (1 g/ml) for 1 hour. Membranes
3 Durante et al TGF- 1 Stimulates L-Arginine Transport and Metabolism 1123 Figure 2. Representative Eadie-Hofstee plot of saturable L-arginine transport in VSMCs. Specific transport of [ 3 H]L-arginine was measured in untreated control VSMCs ( ) and in VSMCs pretreated with TGF- 1 (10 ng/ml) for 24 hours ( ). Similar findings were made in 5 separate experiments. Figure 1. Effect of TGF- 1 on L-arginine transport in VSMCs. A, Concentration-dependent increase in L-arginine transport by TGF- 1. VSMCs were treated TGF- 1 (0.3 to 30 ng/ml) for 24 hours, and then the specific transport of [ 3 H]L-arginine was measured. B, Time course of TGF- 1 regulated L-arginine transport. Specific transport of [ 3 H]L-arginine was measured after preincubation with TGF- 1 (10 ng/ml) for the indicated times. Results are mean SEM of between 4 and 5 separate experiments, each performed in triplicate. *Statistically significant effect of TGF-. were then washed in Tris buffer, incubated for 1 hour with anti-rabbit horseradish peroxidase conjugated antibody (1:5000 dilution), and incubated with chemoluminescence reagents. Type I collagen levels were quantified by scanning densitometry. Statistics Results are expressed as mean SEM. Significant differences between multiple groups were evaluated by ANOVA with post hoc Bonferroni s t test. A Student s 2-tailed t test was used to examine significant differences between 2 groups. Values of P 0.05 were considered to be statistically significant. Results Treatment of VSMCs with TGF- 1 for 24 hours stimulated the transport of L-arginine (Figure 1A). Time-course studies demonstrated that TGF- 1 had a biphasic effect on L-arginine transport (Figure 1B). Initially, TGF- 1 inhibited the transport of L-arginine, but by 24 hours of TGF- 1 treatment, a significant increase in transport was observed. Figure 2 shows a representative Eadie-Hofstee plot demonstrating that saturable, high-affinity uptake of L-arginine by VSMCs was mediated by a single carrier. Data from several experiments (n 5) indicated that this transporter had a Michaelis constant (K m ) of mol/l and a maximum transport velocity (V max ) of pmol mg protein 1 45s 1. Pretreatment of VSMCs with TGF- 1 (10 ng/ml) for 24 hours significantly (P 0.05) increased both the K m ( mol/l) and V max ( pmol mg protein 1 45 s 1 ) of L-arginine transport. The increase in V max of L-arginine transport by TGF- 1 was completely abolished by cycloheximide (5 g/ml) (data not shown). Ribonuclease protection assays demonstrated that treatment of VSMCs with TGF- 1 for 24 hours significantly stimulated the expression of CAT-1 mrna ( fold) but had no effect on CAT-2 message ( fold) (Figure 3). TGF- 1 also stimulated arginase activity (Figure 4A). An increase in arginase activity was first detected after 8 hours of TGF- 1 exposure, and arginase activity remained elevated after 24 hours (Figure 4B). The TGF- 1 mediated increase in arginase activity was blocked by cycloheximide (5 g/ml) (data not shown). Ribonuclease protection analysis revealed that TGF- 1 induced arginase I mrna expression ( fold) (Figure 5); however, it failed to detect arginase II mrna expression either in control cells or in cells exposed to TGF- 1 (data not shown). In addition to stimulating L-arginine transport and L-arginine metabolism to L-ornithine, TGF- 1 stimulated the metabolism of L-ornithine to polyamines and L-proline. Treatment of VSMCs with TGF- 1 (10 ng/ml) induced an 8-fold increase in ODC activity and a 2-fold rise in OAT activity (Figure 6). In addition, TGF- 1 increased the capacity Figure 3. Effect of TGF- 1 on the expression of CAT mrna in VSMCs. Ribonuclease protection analysis of CAT-1, CAT-2, and GAPDH mrna from untreated control VSMCs and VSMCs stimulated with TGF- 1 (3 to 30 ng/ml) for 24 hours. Data are representative of 3 separate independent experiments.
4 1124 Circulation February 27, 2001 Figure 6. Effect of TGF- 1 (10 ng/ml) for 24 hours on ODC (A) and OAT activity (B) in VSMCs. Results are mean SEM of between 3 and 4 separate experiments. *Statistically significant effect of TGF- 1. Figure 4. Effect of TGF- 1 on arginase activity in VSMCs. A, Concentration-dependent increase in arginase activity by TGF- 1. VSMCs were treated with TGF- 1 (0.3 to 30 ng/ml) for 24 hours, and arginase activity was determined. B, Time course of TGF- 1 stimulated arginase activity. Arginase activity was measured after exposure of VSMCs to TGF- 1 (10 ng/ml) for the indicated times. Results are mean SEM of between 4 and 5 separate experiments, each performed in triplicate. *Statistically significant effect of TGF- 1. of VSMCs to generate the polyamine putrescine and L-proline from extracellular L-arginine in a concentration-dependent manner (Figures 7A and 8A). The latter experiments were based on the rationale that L-arginine must be converted to L-ornithine by arginase and then metabolized to putrescine and L-proline by the enzymes ODC and OAT, respectively. Therefore, the stimulation of arginase, ODC, and OAT by TGF- 1 would result in increased synthesis of [ 3 H]putrescine and [ 3 H]L-proline from [ 3 H]L-arginine. The stimulatory effect of TGF- 1 on putrescine and L-proline synthesis was inhibited by the cationic amino acid transport inhibitor L-NMA (10 mmol/l) 3 and by the arginase inhibitor L-NOHA (1 Figure 5. Effect of TGF- 1 on the expression of arginase mrna in VSMCs. Ribonuclease protection analysis of arginase I and GAPDH mrna from untreated control VSMCs and VSMCs stimulated with TGF- 1 (3 to 30 ng/ml) for 24 hours. Data are representative of 3 separate independent experiments. mmol/l) 26 (Figures 7B and 8B). Furthermore, the TGF- 1 mediated putrescine formation was blocked by the ODC inhibitor DFMO (2 mmol/l) 27 (Figure 7B), whereas L-proline generation was reversed by the specific OAT inhibitor L-canaline (100 mol/l) 28 (Figure 8B). Treatment of VSMCs with TGF- 1 (10 ng/ml) stimulated the secretion of type I collagen by nearly 3-fold (Figure 9). The addition of L-canaline (100 mol/l) to VSMCs abolished the TGF- 1 induced production of type I collagen without affecting the synthesis of collagen from untreated control cells (Figure 9). Finally, the TGF- 1 stimulated increase in L-arginine transport and collagen production occurred independently of any effects on NO synthesis. Neither control SMCs nor TGF- 1 treated VSMCs generated NO (data not shown). Discussion The present study demonstrates that TGF- 1 stimulates polyamine and L-proline synthesis in VSMCs by inducing the expression of genes that modulate the transport and metabolism of L-arginine. In particular, TGF- 1 increases the transcellular transport of L-arginine and the intracellular metabolism of L-arginine to L-ornithine by specifically stimulating the expression of the genes for CAT-1 and arginase I. Furthermore, TGF- 1 directs the intracellular metabolism of L-ornithine to polyamines and L-proline by stimulating ODC and OAT activity, respectively. Moreover, the TGF- 1 mediated production of collagen by VSMCs is dependent on L-proline synthesis. TGF- 1 stimulates the transport of L-arginine in a timedependent manner. Kinetic experiments indicate that highaffinity L-arginine (K m 80 mol/l) transport is mediated by a single carrier and that TGF- 1 increases both the V max and K m of this transporter. These kinetic data suggest that the TGF- 1 induced decrease in L-arginine uptake observed at early time points probably arises from the TGF- 1 mediated decrease in the affinity of the transporter. In contrast, the increase in L-arginine transport observed after 24 hours probably arises from the de novo synthesis of additional transport proteins. Consistent with this, we found that cyclo-
5 Durante et al TGF- 1 Stimulates L-Arginine Transport and Metabolism 1125 Figure 7. Effect of TGF- 1 on the formation of putrescine from L-arginine in VSMCs. A, VSMCs were treated with TGF- 1 (0.3 to 30 ng/ml) for 24 hours in the presence of 1 mmol/l [ 3 H]Larginine. B, VSMCs were treated with TGF- 1 (10 ng/ml) for 24 hours in media containing 1 mmol/l [ 3 H]L-arginine in the presence or absence of L-NMA (10 mmol/l), L-NOHA (1 mmol/l), or DFMO (2 mmol/l). Results are mean SEM of 5 separate experiments. *Statistically significant increase from untreated control cells. heximide blocks TGF- 1 induced transport. Moreover, we observed that TGF- 1 stimulates CAT-1 gene expression. The selective induction of CAT-1 mrna by TGF- 1 contrasts with the coinduction of CAT-1 and CAT-2 mrna observed after the administration of other growth factors. 10,11,13,14 In addition to stimulating transcellular L-arginine transport, TGF- 1 stimulates the intracellular metabolism of L-arginine to L-ornithine in VSMCs. TGF- 1 induces a time-dependent increase in arginase activity. This increase in arginase activity is dependent on de novo protein synthesis and is paralleled by a selective increase in arginase I mrna, suggesting that arginase I mediates the TGF- 1 effect. Our finding that TGF- 1 stimulates arginase activity in VSMCs complements an earlier study showing that TGF- increases arginase activity in macrophages, 29 indicating a role for this protein in regulating extrahepatic arginase activity. The selective expression of arginase isozymes has also been reported in other tissues and may serve to regulate L-ornithine metabolism by preferentially directing L-ornithine to the cytosol for polyamine synthesis via ODC or to the mitochondria for L-proline production by OAT. 30,31 L-Ornithine transporters have been identified in mitochondria, however, suggesting that L-ornithine may rapidly equilibrate between the cytosolic and mitochondrial compartments. 32 The coinduction of CAT-1 and arginase I by TGF- 1 found in our study may provide a mechanism by which increased levels of substrate (Larginine) are provided to VSMCs during activation of the arginase enzyme. The ability of TGF- 1 to stimulate arginase activity may function to direct L-arginine to L-ornithine metabolism to generate biologically relevant polyamines and L-proline. In support of this proposal, we found that TGF- 1 increased both ODC and OAT activity. Moreover, TGF- 1 treatment resulted in a prominent increase in the capacity of VSMCs to generate polyamines and L-proline from extracellular L-arginine. This TGF- 1 mediated effect is blocked by the cationic amino acid transport inhibitor L-NMA and by the arginase inhibitor L-NOHA, indicating that both the transcellular transport of L-arginine and intracellular arginase activity are limiting factors that govern the ability of TGF- 1 to generate polyamines and L-proline. In addition, the formation of polyamines was blocked by the ODC inhibitor DFMO, whereas L-proline generation was inhibited by the OAT inhibitor L-canaline. These findings suggest that TGF- 1 mediated increases in both intracellular L-ornithine synthesis and metabolism are coordinated to maximize the cellular capacity for polyamine and L-proline synthesis. The concentration of TGF- 1 (1 to 30 ng/ml) necessary to stimulate L-arginine transport and metabolism in our study is physiologically relevant. Circulating levels of TGF- 1 range from 2 to 10 ng/ml in healthy individuals. 33 Moreover, at sites of vascular injury, where vessel wall TGF- 1 synthesis is induced and activated platelets release TGF- 1, the local concentration of TGF- 1 may be significantly higher. 24 The biological role of ODC and polyamines in stimulating VSMC growth is well established. VSMC proliferation is associated with a striking increase in ODC activity and polyamine formation. 10,14 Moreover, inhibition of ODC activity inhibits VSMC proliferation. 14 In contrast, the physiological function of OAT in vascular cells is not known. In the present study, we are the first to demonstrate that VSMCs express OAT activity and suggest that OAT plays a critical role in collagen synthesis. As previously reported, 34 we found that TGF- 1 increases the formation of type I collagen, which Figure 8. Effect of TGF- 1 on the formation of L-proline from L-arginine in VSMCs. A, VSMCs were treated with TGF- 1 (0.3 to 30 ng/ml) for 24 hours in the presence of 1 mmol/l [ 3 H]Larginine. B, VSMCs were treated with TGF- 1 (10 ng/ml) for 24 hours in media containing 1 mmol/l [ 3 H]L-arginine in the presence or absence of L-NMA (10 mmol/l), L-NOHA (1 mmol/l), or L-canaline (100 mol/l). Results are mean SEM of 5 separate experiments. *Statistically significant increase from untreated control cells.
6 1126 Circulation February 27, 2001 Figure 9. Effect of TGF- 1 on type I collagen synthesis by VSMCs. A, Western blot of type I collagen secretion by VSMCs treated with TGF- 1 (10 ng/ml) for 48 hours in the presence ( ) or absence ( ) ofl-canaline (100 mol/l). B, Type I collagen synthesis determined by laser densitometry. Results are expressed as mean SEM of 6 separate experiments. *Statistically significant increase in type I collagen syntheses. is the predominant form of collagen in blood vessels. Moreover, we observed that the OAT inhibitor L-canaline blocks TGF- 1 mediated collagen production, suggesting that endogenous L-proline synthesis is necessary for collagen synthesis by TGF- 1. Thus, OAT may play an essential role in providing VSMCs with the necessary intracellular levels of L-proline required during periods of elevated collagen synthesis. Considerable evidence indicates that TGF- 1 plays an important role in stimulating intimal thickening and collagen synthesis at sites of vascular injury. Carotid artery injury results in a 5- to 7-fold increase in TGF- 1 mrna that persists during neointima formation and correlates with increases in both type I and type III collagen mrna expression. 24 Furthermore, infusion of recombinant TGF or overexpression of TGF- 1 in the vessel wall 25 leads to neointima formation. In contrast, inhibition of TGF- 1 activity by injecting neutralizing antibodies to TGF or a soluble TGF- 1 type II receptor 36 significantly diminishes intimal thickening and collagen formation after vascular injury. Thus, our finding that physiologically relevant concentrations of TGF- 1 stimulate L-arginine transport and direct its metabolism to growth-stimulatory polyamines and to the collagen precursor L-proline may provide an important mechanism by which TGF- 1 stimulates VSMC growth and collagen synthesis at sites of vascular trauma. Moreover, these TGF- 1 actions that promote VSMC growth and collagen formation may be further amplified in vivo by the ability of TGF- 1 to suppress the inducible NO synthase mediated synthesis of NO, 37 which is an established inhibitor of VSMC proliferation and collagen synthesis. 15,16 In conclusion, these studies demonstrate that TGF- 1 stimulates VSMC polyamine and L-proline synthesis by stimulating the transport and metabolism of L-arginine. In addition, they show that TGF- 1 stimulated collagen synthesis is dependent on L-proline synthesis. The ability of TGF- 1 to upregulate L-arginine transport and direct its metabolism to polyamines and L-proline may contribute to arterial remodeling at sites of vascular damage by stimulating VSMC growth and collagen deposition. Acknowledgments This study was supported in part by National Heart, Lung, and Blood Institute grants HL-59976, HL-62467, and HL and a Grantin-Aid from the American Heart Association. W. Durante is an Established Investigator of the American Heart Association. References 1. Wu G, Morris SM Jr. Arginine metabolism: nitric oxide and beyond. Biochem J. 1998;336: Low BC, Ross IK, Grigor MR. Characterization of system L and system y amino acid transport activity in cultured vascular smooth muscle cells. J Cell Physiol. 1993;156: Durante W, Liao L, Schafer AI. Differential regulation of L-arginine transport and inducible NOS in cultured vascular smooth muscle cells. Am J Physiol. 1995;268:H1158 H White MF. The transport of cationic amino acids across the plasma membrane of mammalian cells. Biochim Biophys Acta. 1985;822: Albritton LM, Tseng L, Scadden D, et al. A putative murine ecotropic retrovirus receptor gene encodes a multiple membrane-spanning protein and confers susceptibility to virus infections. Cell. 1989;57: MacLeod CL, Finley KD, Kakuda DK, et al. Activated T cells express a novel gene on chromosome 8 that is closely related to the murine ecotropic retroviral receptor. Mol Cell Biol. 1990;10: Closs EI, Lyons CR, Kelly C, et al. Characterization of the third member of the MCAT family of cationic amino acid transporters: identification of a domain that determines the transport properties of the MCAT proteins. J Biol Chem. 1993;268: Closs EI, Albritton LM, Kim JW, et al. Identification of a low affinity, high capacity transporter of cationic amino acids in mouse liver. J Biol Chem. 1993;268: Hosokawa H, Sawamura T, Kobayashi S, et al. Cloning and characterization of a brain-specific cationic amino acid transporter. J Biol Chem. 1997;272: Durante W, Liao L, Iftikhar I, et al. Platelet-derived growth factor regulates vascular smooth muscle cell proliferation by inducing cationic amino acid transporter gene expression. J Biol Chem. 1996;271: Low BC, Grigor MR. Angiotensin II stimulates system y and cationic amino acid transporter gene expression in cultured vascular smooth muscle cells. J Biol Chem. 1995;270: Gill DJ, Low BC, Grigor MR. Interleukin-1 and tumor necrosis factor- stimulate the cat-2 gene of the L-arginine transporter in cultured vascular smooth muscle cells. J Biol Chem. 1996;271: Durante W, Liao L, Peyton KJ, et al. Lysophosphatidylcholine regulates cationic amino acid transport and metabolism in vascular smooth muscle cells: role in polyamine biosynthesis. J Biol Chem. 1997;272: Durante W, Liao L, Peyton KJ, et al. Thrombin stimulates vascular smooth muscle cell polyamine synthesis by inducing cationic amino acid transporter and ornithine decarboxylase gene expression. Circ Res. 1998; 83: Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromocyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest. 1990;83: Kalpakov V, Gordon D, Kulik TJ. Nitric oxide-generating compounds inhibit total protein and collagen synthesis in cultured vascular smooth muscle cells. Circ Res. 1995;76:
7 Durante et al TGF- 1 Stimulates L-Arginine Transport and Metabolism Kawamoto S, Amaya Y, Murakami K, et al. Complete nucleotide sequence of cdna and deduced amino acid sequence of the rat liver arginase. J Biol Chem. 1987;262: Gotoh T, Sonoki T, Nagasaki A, et al. Molecular cloning of cdna for nonhepatic mitochondrial arginase (arginase II) and comparison of its induction with nitric oxide synthase in a murine macrophage-like cell line. FEBS Lett. 1996;395: Spector EB, Jenkinson CP, Grigor MR, et al. Subcellular location and differential antibody specificity of arginase in tissue culture and whole animals. Int J Dev Neurosci. 1994;12: Jenkinson CP, Grody WW, Cederbaum SD. Comparative properties of arginases. Comp Biochem Physiol. 1996;114B: Tabor CW, Tabor H. Polyamines. Annu Rev Biochem. 1984;53: Valle D, Kaiser-Kupfer MI, Del Valle LA. Gyrate atrophy of the choroid and retina: deficiency of ornithine aminotransferase in transformed lymphocytes. Proc Natl Acad Sci U S A. 1977;74: Nabel EG, Schum L, Pompili VJ, et al. Direct transfer of transforming growth factor- 1 gene into arteries stimulates fibrocellular hyperplasia. Proc Natl Acad Sci U S A. 1993;90: Majesky MW, Lindner V, Twardzik DR, et al. Production of transforming growth factor- 1 during repair of arterial injury. J Clin Invest. 1991;88: Schulick AH, Taylor A, Zuo W, et al. Overexpression of transforming growth factor- 1 in arterial endothelium causes hyperplasia, apoptosis, and cartilaginous metaplasia. Proc Natl Acad Sci U S A. 1998;95: Daghigh F, Fukuto JM, Ash DE. Inhibition of rat liver arginase by an intermediate in NO biosynthesis, N G -hydroxy-l-arginine: implications for the regulation of nitric oxide biosynthesis by arginase. Biochem Biophys Res Commun. 1994;202: Pegg A. Polyamine metabolism and its importance in neoplastic growth and as a target for chemotherapy. Cancer Res. 1988;48: Kito K, Sanada Y, Katunuma N. Mode of inhibition of ornithine aminotransferase by L-canaline. J Biochem. 1978;83: Boutard V, Havois R, Fouqueray B, et al. Transforming growth factor- stimulates arginase activity in macrophages: implications for the regulation of macrophage cytotoxicity. J Immunol. 1995;155: Louis CA, Reichner JS, Henry WL Jr, et al. Distinct arginase isoforms expressed in primary and transformed macrophages: regulation by oxygen tension. Am J Physiol. 1998;274:R775 R Davis PK, Wu G. Compartmentation and kinetics of urea cycle enzymes in porcine enterocytes. Comp Biochem Physiol. 1988;119B: Passarella S, Atlante A, Quagliariello E. Ornithine/phosphate antiport in rat kidney mitochondria: some characteristics of the process. Eur J Biochem. 1990;193: Grainger DJ, Kemp PR, Metcalf JC, et al. The serum concentration of active TGF- is severely depressed in advanced atherosclerosis. Nat Med. 1995;1: Amento EP, Ehsani N, Palmer H, et al. Cytokines and growth factors positively and negatively regulate interstitial collagen gene expression in human vascular smooth muscle cells. Arterioscler Thromb. 1991;11: Wolf YG, Rasmussen LM, Ruoslahti E. Antibodies against transforming growth factor- 1 suppress intimal hyperplasia in a rat model. J Clin Invest. 1994;93: Smith JD, Bryant SR, Couper LL, et al. Soluble transforming growth factor- type II receptor inhibits negative remodeling, fibroblast transdifferentiation, and intimal lesion formation but not endothelial growth. Circ Res. 1999;84: Perrella MA, Hsieh CM, Lee WS, et al. Arrest of endotoxin-induced hypotension by transforming growth factor 1. Proc Natl Acad Sci U S A. 1996;93:
Supplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More information, L2Arg NO. (ischemia reperfusion injury, IRI) (L2arginine/ nitric oxide, L2Arg/ NO) IRI g Wistar,, g/ kg) ip, Acta Physiologica Si nica
, 1999 2, 51 (1), 25 30 25 Acta Physiologica Si nica L2Arg/ NO 1997212227 1998203230 3 3 (, 524023 ; 3, 100083) ( IRI) (NO), 15 min, 45 min, 30 ml KH 15 min, (LDH) NO2 - NOS L2 (L2Arg), IRI LDH 411, 514
More informationArginine as an Example of a Conditionally Essential Nutrient: Sickle Cell Disease & Trauma Claudia R. Morris MD, FAAP
Arginine as an Example of a Conditionally Essential Nutrient: Sickle Cell Disease & Trauma Claudia R. Morris MD, FAAP Examining Special Nutritional Requirements in Disease States, A Workshop April 1, 2018
More informationRecovery of Myocardial Infarction via Unique Modulation of the Cardiac Microenvironment
2016 춘계심혈관통합학술대회, 경주 Recovery of Myocardial Infarction via Unique Modulation of the Cardiac Microenvironment Youngkeun Ahn, MD, PhD Department of Cardiology, Cardiovascular Center Chonnam National University
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationASSAY OF SPHINGOMYELINASE ACTIVITY
ASSAY OF SPHINGOMYELINASE ACTIVITY Protocol for Protein Extraction Stock Solution 1. Leupeptin/hydrochloride (FW 463.0,
More informationThe rabbit femoral artery was prepared and each arterial ring was permeabilized
Online Supplement Nakmura et al. cgmp-dependent relaxation of smooth muscle Materials and Methods Measurement of tension The rabbit femoral artery was prepared and each arterial ring was permeabilized
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationProduct Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions
Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationSUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
More informationRegulation of the IGF axis by TGF-b during periosteal chondrogenesis: implications for articular cartilage repair
Regulation of the IGF axis by TGF-b during periosteal chondrogenesis: implications for articular cartilage repair Chapter 04 Boek 1_Gie.indb 55 21-05-2007 12:27:33 Chapter 04 Abstract Goal: TGF-b and IGF-I
More informationHuman and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
More informationIII. Results and Discussion
III. Results and Discussion 1. Histological findings in the coronary artery Twenty-four swine had surgical treatments performed in two of the coronary arteries, LAD as well as either the LCX or RCA. A
More informationCaution: For Laboratory Use. A product for research purposes only. Eu-W1284 Iodoacetamido Chelate & Europium Standard. Product Number: AD0014
TECHNICAL DATA SHEET Lance Caution: For Laboratory Use. A product for research purposes only. Eu-W1284 Iodoacetamido Chelate & Europium Standard Product Number: AD0014 INTRODUCTION: Iodoacetamido-activated
More informationGlutathione S-Transferase Assay Kit
Glutathione S-Transferase Assay Kit Catalog Number KA1316 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More informationNOS Activity Assay Kit
NOS Activity Assay Kit Catalog Number KA1345 50 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay... 3 General Information... 4
More informationSignaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana
Biochemistry: Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana 38 CAMERON E. NIENABER ʻ04 Abstract Long recognized as essential plant nutrients and metabolites, inorganic and organic
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationSupporting Information
Supporting Information Gerasimenko et al..73/pnas.39 SI Materials and Methods Reagents used in this study include Fluo-4/Fura- (Invitrogen), thapsigargin (albiochem), collagenase (Worthington), palmitoleic
More informationFIRST BIOCHEMISTRY EXAM Tuesday 25/10/ MCQs. Location : 102, 105, 106, 301, 302
FIRST BIOCHEMISTRY EXAM Tuesday 25/10/2016 10-11 40 MCQs. Location : 102, 105, 106, 301, 302 The Behavior of Proteins: Enzymes, Mechanisms, and Control General theory of enzyme action, by Leonor Michaelis
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationCaution: For Laboratory Use. A product for research purposes only. Eu-W1024 ITC Chelate & Europium Standard. Product Number: AD0013
TECHNICAL DATA SHEET Lance Caution: For Laboratory Use. A product for research purposes only. Eu-W1024 ITC Chelate & Europium Standard Product Number: AD0013 INTRODUCTION: Fluorescent isothiocyanato-activated
More informationAn amino acid for a healthy heart
AOR CODE: AOR04054 Premium Arginine An amino acid for a healthy heart A natural nitric oxide precursor Protects the heart from high blood sugar levels Helps in cellular energy production Gluten Free Vegan
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationEvidence for an Alternative Glycolytic Pathway in Rapidly Proliferating Cells. Matthew G. Vander Heiden, et al. Science 2010
Evidence for an Alternative Glycolytic Pathway in Rapidly Proliferating Cells Matthew G. Vander Heiden, et al. Science 2010 Introduction The Warburg Effect Cancer cells metabolize glucose differently Primarily
More informationSyllabus for BASIC METABOLIC PRINCIPLES
Syllabus for BASIC METABOLIC PRINCIPLES The video lecture covers basic principles you will need to know for the lectures covering enzymes and metabolism in Principles of Metabolism and elsewhere in the
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationKit for assay of thioredoxin
FkTRX-02-V2 Kit for assay of thioredoxin The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationLuminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the
More informationData Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory
More informationParacrine Mechanisms in Adult Stem Cell Signaling and Therapy
Paracrine Mechanisms in Adult Stem Cell Signaling and Therapy Massimiliano Gnecchi, Zhiping Zhang, Aiguo Ni, Victor J. Dzau Circulation Research 2008 Nov 21;103(11):1204-19 Introduction(1) After AMI all
More informationSupplementary material: Materials and suppliers
Supplementary material: Materials and suppliers Electrophoresis consumables including tris-glycine, acrylamide, SDS buffer and Coomassie Brilliant Blue G-2 dye (CBB) were purchased from Ameresco (Solon,
More informationControl of ornithine decarboxylase activity in jute seeds by antizyme
J. Biosci., Vol. 15, Number 2, June 1990, pp. 83-91. Printed in India. Control of ornithine decarboxylase activity in jute seeds by antizyme MALABIKA PANDIT and BHARATI GHOSH Department of Botany, Bose
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationSupplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.
Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William
More informationChapter 7 Conclusions
VII-1 Chapter 7 Conclusions VII-2 The development of cell-based therapies ranging from well-established practices such as bone marrow transplant to next-generation strategies such as adoptive T-cell therapy
More informationSupplementary Material
Supplementary Material Nuclear import of purified HIV-1 Integrase. Integrase remains associated to the RTC throughout the infection process until provirus integration occurs and is therefore one likely
More information(PDGF), 9 ( -2 (FGF-2), SMO
Abstract An ethanol extract from shark muscle has been shown to have potent angiogenic activity when mixed together with olive oil in a ratio of 1part extract to 9 parts olive oil. This mixture has been
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationOxiSelect Human Oxidized LDL ELISA Kit (OxPL-LDL Quantitation)
Product Manual OxiSelect Human Oxidized LDL ELISA Kit (OxPL-LDL Quantitation) Catalog Number STA-358 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lipoproteins are submicroscopic
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2005 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2005) offered
More informationGENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC
Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski
More informationThe dynamic regulation of blood vessel caliber
INVITED BASIC SCIENCE REVIEW The dynamic regulation of blood vessel caliber Colleen M. Brophy, MD, Augusta, Ga BACKGROUND The flow of blood to organs is regulated by changes in the diameter of the blood
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationDiscussion of Prism modules and predicted interactions (Fig. 4)
SUPPLEMENTARY NOTES Discussion of Prism modules and predicted interactions (Fig. 4) a. Interactions of the TCA-cycle, respiratory chain, and ATP synthetase with the amino acid biosynthesis modules. Given
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationPhosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationActivation of Mitochondrial Glycerol 3-Phosphate Dehydrogenase by Cadmium Ions
Gen. Physiol. Biophys. (1985), 4, 29 34 29 Activation of Mitochondrial Glycerol 3-Phosphate Dehydrogenase by Cadmium Ions H. RAUCHOVÁ, P. P. KAUL* and Z. DRAHOTA Institute of Physiology, Czechoslovak Academy
More informationLANCE Eu-W1024 ITC Chelate & Europium Standard AD0013 Development grade
AD0017P-4 (en) 1 LANCE Eu-W1024 ITC Chelate & Europium Standard AD0013 Development grade INTRODUCTION Fluorescent isothiocyanato-activated (ITC-activated) Eu-W1024 chelate is optimized for labelling proteins
More informationPutrescine Lyndsay Grover Biotechnology Technician - Health CHEM April 4 th 2011
Putrescine Lyndsay Grover Biotechnology Technician - Health CHEM 10002 April 4 th 2011 Introduction Putrescine is found in living and dead organisms due to the breakdown of amino acids and is the main
More informationrenoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
More informationProduct Manual. Human LDLR ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures
Product Manual Human LDLR ELISA Kit Catalog Number STA-386 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is an essential component of cellular membranes,
More informationsupplementary information
Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated
More informationDoctor of Philosophy
Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of
More informationIntroduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats
Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium
More informationIntegration Of Metabolism
Integration Of Metabolism Metabolism Consist of Highly Interconnected Pathways The basic strategy of catabolic metabolism is to form ATP, NADPH, and building blocks for biosyntheses. 1. ATP is the universal
More informationNITROGEN METABOLISM An Overview
1 University of Papua New Guinea School of Medicine and Health Sciences Division of Basic Medical Sciences Discipline of Biochemistry and Molecular Biology PBL Seminar & Health Sciences NITROGEN METABOLISM
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More informationEndotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation
Endotoxin Induces Toll-Like Receptor 4 Expression in Vascular Cells: A Novel Mechanism Involved in Vascular Inflammation Introduction Feng-Yen Lin, Ph.D. 1, and Shing-Jong Lin, M.D., PhD. 2, 1 Department
More informationSupporting Information for:
Supporting Information for: Methylerythritol Cyclodiphosphate (MEcPP) in Deoxyxylulose Phosphate Pathway: Synthesis from an Epoxide and Mechanisms Youli Xiao, a Rodney L. Nyland II, b Caren L. Freel Meyers
More informationM.Sc. III Semester Biotechnology End Semester Examination, 2013 Model Answer LBTM: 302 Advanced Immunology
Code : AS-2246 M.Sc. III Semester Biotechnology End Semester Examination, 2013 Model Answer LBTM: 302 Advanced Immunology A. Select one correct option for each of the following questions:- 2X10=10 1. (b)
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationTRANSPORT OF AMINO ACIDS IN INTACT 3T3 AND SV3T3 CELLS. Binding Activity for Leucine in Membrane Preparations of Ehrlich Ascites Tumor Cells
Journal of Supramolecular Structure 4:441 (401)-447 (407) (1976) TRANSPORT OF AMINO ACIDS IN INTACT 3T3 AND SV3T3 CELLS. Binding Activity for Leucine in Membrane Preparations of Ehrlich Ascites Tumor Cells
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationPublished on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.
More informationSupplementary Data. Supplementary Materials and Methods Measurement of NO formation by ozone-based chemiluminescence. Supplementary References
Supplementary Data Supplementary Materials and Methods Measurement of NO formation by ozone-based chemiluminescence Nitric oxide (NO) production was measured by ozonebased chemiluminescence using a Sievers
More informationEffects of methionine-containing dipeptides on α s1 casein expression in bovine mammary epithelial cells *
Journal of Animal and Feed Sciences, 16, Suppl. 2, 2007, 325 329 Effects of methionine-containing dipeptides on α s1 casein expression in bovine mammary epithelial cells * H.H. Wu 1, J.Y. Yang 1,2, K.
More informationHepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
More informationImmunoTools special Award 2014
ImmunoTools special Award 2014 Davide Ferrari, PhD University of Ferrara, Department of Morphology, Surgery and Experimental Medicine. Section of Pathology, Oncology and Exper. Biology via L. Borsari 46,
More informationH 2 S: Synthesis and functions
H 2 S: Synthesis and functions 1 Signaling gas molecules: O 2, NO and CO Then, H 2 S - Fourth singling gas molecule after O 2, NO and CO 2 Nothing Rotten About Hydrogen Sulfide s Medical Promise Science
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationPFK Activity Assay Kit (Colorimetric)
PFK Activity Assay Kit (Colorimetric) Catalog Number KA3761 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationMaterials and Methods , The two-hybrid principle.
The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there
More informationHIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates
HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION EXPERIMENTAL PROCEDURES Tryptic digestion protection experiments - PCSK9 with Ab-3D5 (1:1 molar ratio) in 50 mm Tris, ph 8.0, 150 mm NaCl was incubated overnight at 4 o C. The
More informationMEK1 Assay Kit 1 Catalog # Lot # 16875
MEK1 Assay Kit 1 Kit Components Assay Dilution Buffer (ADB), Catalog # 20-108. Three vials, each containing 1.0ml of assay dilution buffer (20mM MOPS, ph 7.2, 25mM ß-glycerol phosphate, 5mM EGTA, 1mM sodium
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationPAF Acetylhydrolase Assay Kit
PAF Acetylhydrolase Assay Kit Catalog Number KA1354 96 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay... 3 General
More information9607 Dr. Perry Road Suite 103. Ijamsville, MD Tel: (301) Fax: (301) Ultrasensitive Samoa Human IL-33 Immunoassay
AssayGate, Inc. 9607 Dr. Perry Road Suite 103. Ijamsville, MD 21754. Tel: (301)874-0988. Fax: (301)560-8288. Ultrasensitive Samoa Human IL-33 Immunoassay INTRODUCTION Interleukin-33 (IL-33), a cytokine
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationMammalian Membrane Protein Extraction Kit
Mammalian Membrane Protein Extraction Kit Catalog number: AR0155 Boster s Mammalian Membrane Protein Extraction Kit is a simple, rapid and reproducible method to prepare cellular protein fractions highly
More informationRelationship between serum glutathione peroxidase-1activity with endothelial dysfunction level in patients with coronary artery diseases
Relationship between serum glutathione peroxidase-1activity with endothelial dysfunction level in patients with coronary artery diseases Introduction Reactive oxygen species (ROS),such as superoxide and
More informationNature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
More informationTarget Protein Antibody name Product number Manufacturer Species Epitope Dilution Aggrecan Anti-aggrecan AB1031 EMD Millipore Corp Rabbit
Family history Hypertension/ Maximum Degree of aortic Bicuspid Disease Age/Sex Diagnosed CTD of aortic disease Treated aortic insufficiency/stenosis aortic Aneurysm 63/M No Yes Yes/Yes diameter 59mm 1-2+/None
More informationAnnexure III SOLUTIONS AND REAGENTS
Annexure III SOLUTIONS AND REAGENTS A. STOCK SOLUTIONS FOR DNA ISOLATION 0.5M Ethylene-diamine tetra acetic acid (EDTA) (ph=8.0) 1M Tris-Cl (ph=8.0) 5M NaCl solution Red cell lysis buffer (10X) White cell
More informationCOURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12
COURSE: Medical Microbiology, MBIM 650/720 - Fall 2008 TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 FACULTY: Dr. Mayer Office: Bldg. #1, Rm B32 Phone: 733-3281 Email: MAYER@MED.SC.EDU
More informationProcaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
More information