Pharmacokinetic Determinants of Statin-Induced Myopathy
|
|
- Moses Russell
- 6 years ago
- Views:
Transcription
1 Pharmacokinetic Determinants of Statin-Induced Myopathy Rommel G. Tirona, B.Sc.Phm., Ph.D. Departments of Physiology & Pharmacology and Medicine The University of Western Ontario, London, Ontario, Canada ACS New Jersey Drug Metabolism Discussion Group Somerset, New Jersey Wednesday October 13, 21
2 Statins HMG-CoA reductase inhibitors Inhibit biosynthesis of cholesterol Highly effective for the treatment of hypercholesterolemia, a major risk factor for cardiovascular disease Lactone and hydroxyacid forms Varying in lipophilicity logp in red Tobert, Nat Rev Drug Discov 23
3 Statin-Associated Myopathy 3 million Americans on statin therapy Well tolerated Major complaint Myalgia Muscle pain/weakness Affects 5-15% of treated patients 3 million Americans experience skeletal muscle side effects Muscle effects range from myalgia to rhabdomyolysis
4 Proposed Mechanisms of Statin-Associated Myopathy STATIN HMG-CoA Mevalonate Necrosis Mitochondria Isoprenylation Geranylgeranylpyrophosphate Rab GTPase Atrophy Apoptosis Caspase 3/9 Activation
5 Risk Factors for Statin-Associated Myopathy Risk Factors Increased age Female sex Renal or hepatic impairment Hypothyroidism Small body frame and frailty Perioperative periods Statin Characteristics Dose Lipophilicity Potential for metabolic drug interactions Co-medications Other myotoxic drugs Metabolic inhibitors of CYP or UGT Jacobson, Am J Cardiol 26
6 Cytochrome P45 Polymorphisms Associate with Statin Disposition Fluvastatin Simvastatin Kirchheiner et al., Clin Pharmacol Ther 23. Kim et al., J Clin Pharmacol 27.
7 Hepatic Drug Transporters 2 (Ho and Kim, Clin Pharmacol Ther 25)
8 Uptake Transporters Organic anion transporting polypeptides (OATP) Organic anion transporter (OAT) Organic cation transporter (OCT) Sodium dependent tauocholate transporting polypeptide (NTCP) Peptide Transporter (PEPT) STATIN STATIN STATIN STATIN N
9 Rosuvastatin Uptake Transporters Rosuvastatin Uptake (% Vector-only Control) 2 1 Control OATP1A2 OATP2B1 OATP1B1 OATP1B3 NTCP ASBT OCT1 Ho et al., Gastroenterology 26
10 Hepatic Statin Uptake Transporters Transporter Simvastatin Acid Pravastatin Fluvastatin Atorvastatin Rosuvastatin Pitavastatin OATP1A OATP1B OATP1B OATP2B NTCP + + +
11 OATP1B1 Variants N151S R152K D462G C485F N13D P155T E156G D241N G488A V82A I353T L543W Extracellular L643F Intracellular F73L V174A P336R N432D D655G E667G Tirona et al., J Biol Chem 21
12 Allelic Frequencies of SLCO1B1 SNPs in Selected Populations SNP Frequency African American Caucasian American Finnish German Japanese South Asian c.388g>a (N13D) c.521t>c (V174A) Reference Tirona et al., 21 Tirona et al., 21 Niemi et al., 24 Mwinyi et al., 24 Nozawa et al., 22 Nishizato et al., 23 Jada et al., 27
13 Decreased Statin Transport by OATP1B1 Variants Percent OATP1B1*1a Activity Rosuvastatin * *1a *1b * A T G T A C G C *1a *1b *5 *15 Ho et al., Gastroenterology 26 Nozawa et al., Drug Metab Disp 25 Ho et al., Gastroenterology 26
14 Membrane Trafficking Defect in OATP1B1 521C Variant Total Cell Surface kda kda Anti-OATP1B A T A C *1a *5 Tirona et al., J Biol Chem 21
15 OATP1B1 Variants and Pravastatin Pharmacokinetics C H 3 CH3 HO O O HOOC H HO hydrophillic statin OATP1B1, OATP2B1 and NTCP substrate high liver distribution uptake rate-limited wide interindividual variability not metabolized H CH 3 OH Blood Time OATP 1B1 Hepatocyte Efflux Bile Decreased Activity Normal Activity Enhanced Activity (Hsiang et al., JBC 1999; Nakai et al., JPET 21 Kobayashi et al., JPET 23; Yamazaki et al., 1996/7; Neuvonen et al., 1998)
16 OATP1B1 521 Variants and Pravastatin Pharmacokinetics Pravastatin Concentration (ng/ml) C/C (N=2) T/C (N=17) T/T (N=88) T A T *1a *1a T G T *1b *1b C A C *5 *5 C G C *15 * Time (hr) Ho et al., Pharmacogenet Genomics 27
17 SLCO1B1 Haplotypes and Pravastatin Pharmacokinetics 2 Pravastatin AUC (ng hr/ml) A T G T A C G C *1a *1b *5 *15 AUC * 167* Ho et al., Pharmacogenet Ho et al., Pharmacogenetics Genomics (in press) 27
18 Factors Associated with Pravastatin Exposure Model covariates P-value R 2 (%) Gender < BSA < Assay sensitivity SLCO1B1 521T>C Race T>C/Race Gender/BSA/Assay sensitivity/521t>c/race < Ho et al., Pharmacogenet Ho et al., Pharmacogenetics Pharmacogenomics Genomics 28 (in press)
19 OATP1B1 521T>C Polymorphism Differentially Affects Statin Pharmacokinetics Statin Relative Exposure Reference 521TT 521TC 521CC Pravastatin Ho et al., 27 Simvastatin Acid Pasanen et al., 26 Fluvastatin Pasanen et al., 26 Atorvastatin Pasanen et al., 27 Rosuvastatin Pasanen et al., 27 Pitavastatin Chung et al. 25
20 SLCO1B1 Genetics Associates with Skeletal Muscle Side Effects of Simvastatin Study of the Effectiveness of Additional Reductions in Cholesterol and Homocysteine (SEARCH) Niemi, Clin Pharmacol Ther 29 Link et al., NEJM 28
21 SLCO1B1 Genetics Associates with Skeletal Muscle Side Effects of Simvastatin STRENGTH (Statin Response Examined by Genetic Haplotype Markers) Study Statin Plasma Level (ng/ml) Voora et al., JACC 29
22 SLCO1B1 Genetics and Dose Recommendations (Niemi, Clin Pharmacol Ther, Nov 29)
23 mrna Copy Num kda D. mrna E. kda OATP1B3 Male OATP1B3 Female Variability in Hepatic OATP Expression OATP1B1 OATP1B3 OATP2B1 OATP1B1 Male OATP1B1 OATP1B3 OATP2B Human Liver Samples NTCP C. mrna Copy Number OATP1B1 Female 25 Female HL 14 HL 13 HL 114 HL 116 HL 127 HL 129 HL HL HL HL HL 14 HL HL HL 13 HL 136 HL 114 HL 38 HL 116 HL 111 HL 127 HL 135 HL 129 HL HL HL 14 HL 13 HL 131 HL HL 1 1 HL HL HL 134 HL 136 HL 123 HL HL HL 19 HL HL HL 118 HL 135 HL 132 HL HL 3 3 HL HL HL HL HL HL 1 1 HL HL HL HL HL HL HL HL HL HL HL HL 3 3 OATP1B1 OATP1B3 OATP2B1 71 D. mrna kda HL HL HL HL HL HL OATP1B3 Male HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL HL OATP1B3 Female HL HL HL HL 1 1 HL HL HL HL HL HL HL HL HL HL HL HL Ho et al., Gastroenterology 26
24 Variability in Hepatic OATP Expression Meyer zu Schwabedissen et al., Hepatology 21
25 Regulation of Transporters by the Bile-Acid Sensor, Farnesoid X Receptor Eloranta et al., Physiology 28
26 A Common Polymorphism in the Farnesoid X Receptor With Decreased In Vitro Activity Chromosome 12 FXR cdna E1 E2 E3 E4 E5 E6 E7 E8 E9 E1 E11 FXR ORF AF -1 DNA Binding Hinge Ligand Binding G-1T(*1B) C643T(*2) G646T(*3) FXR G-1T (*1B) M G S K M N L Exon 3 GAAAAATTTGGATGGGATCAAAAATGAATCTC +1 FXR Transcriptional Activity Control CDCA 2 mm * * SNP Exon Amino acid change Allele frequencies (%) European African Chinese Hispanic. G-1T(*1B) 3 non coding C643T (*2) 6 H215Y.7 G646T (*3) 6 A216S.5 C783T 7 N261N.5 C1341T 11 H447H.5 Marzolini et al., Mol Endocrinol 27 27
27 FXR*1b Polymorphism is Associated with Decreased Hepatic OATP mrna Expression Relative OATP1B1 Expression OATP1B1 OATP1B1 p =.2693 FXR*1B Relative OATP 1B3 Expression OATP1B3 p =.11 FXR*1B Marzolini et al., Mol Endocrinol 27 27
28 Efflux Transporters P-glycoprotein (P-gp) Multidrug Resistance Associated Proetin (MRP) Breast Cancer Resistance Protein (BCRP) Bile Salt Export Pump (BSEP) N STATIN STATIN STATIN STATIN
29 Hepatic Statin Efflux Transporters Transporter Simvastatin Acid Pravastatin Fluvastatin Atorvastatin Rosuvastatin Pitavastatin P-gp MRP BCRP BSEP +
30 ABCG2 (BCRP) 421C>A Polymorphisms Differentially Affect Statin Pharmacokinetics ABCG2 Caucasian African Asian c.421c>a Q141K Zhang et al., Clinica Chimica Acta 26 Keskitalo et al. Clin Pharmacol Ther 29 Keskitalo et al., Pharmacogenomics 29
31 ABCB1 (P-gp) Polymorphisms Differentially Affect Statin Pharmacokinetics Simvastatin Fluvastatin Pravastatin Simvastatin Acid Lovastatin Lovastatin Lactone Atorvastatin Atorvastatin Lactone Rosuvastatin 2677TT 893Ser 2677GG 893Ala Keskitalo et al., CPT 28 Keskitalo et al., Br J Clin Pharm 29
32 Statin Transporter Polymorphisms and Pharmacodynamics HMG-CoA Statins Uptake Mevalonate Efflux Blood Hepatocyte Cholesterol Bile
33 OATP1B1 521T>C Transporter Polymorphisms and Pharmacodynamics Statin (daily dose in mg) Number of Subjects Effect of SNP on Lipid Response Reference Several Statins (dose not controlled) Several Statins (dose not controlled) Pravastatin (4 mg) Pravastatin (mean 9.4 mg) Pravastatin (2 mg) Simvastatin (4 mg) 66 Reduced effect on LDL-C lowering 2735 Enhanced effect on HDL-C for AVA and FVA Tachibana-Iimori et al., Drug Metab Pharmacokinet 24 Thompson et al., Pharmacogenomics J No effect on lipids Igel et al., CPT Reduced effect on Tchol and LDL-C lowering at 56 days Takane et al., J Human Gen Reduced effect on Tchol Zhang et al., Br J Clin Pharmacol Reduced effect on LDL-C lowering Link et al., NEJM 28
34 Breast Cancer Resistance Protein (ABCG2) Polymorphisms and Pharmacodynamics Transporter (SNP) 421C>A Statin (dose in mg) Rosuvastatin (1 mg) Number of Subjects Effect of SNPs on Lipid Response 35 Enhanced effect on LDL-C Reference Tomlinson et al., CPT C>A Rosuvastatin 3 Enhanced effect on LDL-C Bailey et al., Circ Cardiovasc Genet 21
35 What about skeletal muscle distribution of statins?
36 Tissue Distribution of Rosuvastatin in the Mouse [ 3 H]Rosuvastatin 1mg/kg IV Mouse Tissue/Plasma Ratio Liver Kidney Brain Testis Heart Quadriceps Gastrocnemius EDL.1
37 A B Drug Transporter Expression in Human MRP1 mrna (Relative Expression) MRP5 mrna (Relative Expression) MRP1 MRP5 Skeletal Muscle HSMM Liver Kidney Small Intestine MRP2mRNA (Relative Expression) OATP2B1 mrna (Relative Expression) Skeletal Muscle HSMM MRP2 OATP2B1 Liver Kidney Small Intestine Skeletal Muscle MRP4 mrna (Relative Expression) BCRP mrna (Relative Expression) Skeletal Muscle HSMM MRP4 BCRP Liver Kidney Small Intestine Knauer et al., Circ Res 21
38 OATP2B1 in Skeletal Muscle Transports Statins Rosuvastatin Uptake (fmol/mg protein) Atorvastatin Uptake (fmol/mg protein) Sk. Muscle Liver Intestine Kidney Vector Control ** *** OATP2B1 + * ** ** * *** *** *** OATP1B1 OATP1B3 OATP1A2 OAT ** ** roatp1b Rosuvastatin Uptake (fmol/mg protein) Atorvastatin Uptake (fmol/mg protein) DMSO DMSO Vector Control ** ** * ** OATP2B1 ** ** *** *** *** ** ** ** * * Cerivastatin Gemfibrozil Gemfibrozil-Glu Fenofibrate Rifampin Glyburide Cyclosporine A Knauer et al., Circ Res 21
39 Novel Statin Efflux Transporters in Skeletal Muscle Knauer et al., Circ Res 21
40 OATP2B1 and MRP1 Modulate Statin Accumulation in Cultured Human Skeletal Myotubes Knauer et al., Circ Res 21
41 OATP2B1 and MRP1 Modulate Statin Toxicity in Cultured Skeletal Myotubes 1 * 1 ATP Level (% Control) ATP Level (% Control) * * * Formazan Formation (% Control) 1 1 Rosuvastatin (mm) 1 * Rosuvastatin (mm) Formazan Formation (% Control) Atorvastatin (mm) * * 1 1 Atorvastatin (mm) * Caspase 3/7 Activation (% Control) *** *** ** * 1 1 Rosuvastatin (mm) Caspase 3/7 Activation (% Control) Ad-LacZ Ad-MRP1 Ad-OATP2B ** * ** 1 1 Atorvastatin (mm) Ad-OATP2B1 + Ad-MRP1 Knauer et al., Circ Res 21
42 Liver - Skeletal Muscle Transporter Axis And Statin Therapeutic Window % Population Reaching Outcome LDL-C Hepatic Transporters SLCO1B1 SNP ABCG2 SNP Myopathy Sk. Muscle Transporters SLCO2B1 SNP ABCC1 SNP Plasma Statin Concentration
43 Acknowledgments Michael Knauer Henriette Meyer zu Schwabedissen Neha Khandekar Catia Marzolini Guillermo Gervasini Wooin Lee Marianne DeGorter Brad Urquhart Brenda Leake Chris Lemke Richard Kim Ute Schwarz Richard Ho Erin Schuetz John Schuetz
44 Ethnic Difference in Rosuvastatin Pharmacokinetics
45 P-glycoprotein (ABCB1) Polymorphisms and Pharmacodynamics SNPs 2677G and 3435C 2677G>T Statin (daily dose in mg) Atorvastatin (1 mg) Atorvastatin (1 mg) Number of Subjects Effect of SNPs on Lipid Response 344 Reduced effect on LDL-C in women 192 Reduced effect on LDL-C Reference Kajinami et al., Am J Cardiol 24 Thompson et al., Pharmacogenomics J G>T/A Simvastatin (2 mg) 116 Increased LDL-C response Fiegenbaum et al., CPT 25 4 allele haplotype Fluvastatin (4 mg) 76 Increased LDL-C response Bercovich et al., Atherosclerosis G>T/A Pravastatin (4 mg) ~ 7 Reduced effect on LDL-C Mega et al., ATVB 29
Clinical Implications of Pharmacogenetic Variation on the Effects of Statins
REVIEW ARTICLE Drug Saf 2011; 34 (1): 1-19 0114-5916/11/0001-0001/$49.95/0 ª 2011 Adis Data Information BV. All rights reserved. Clinical Implications of Pharmacogenetic Variation on the Effects of Statins
More informationRISK FACTORS AND DRUG TO STATIN-INDUCED MYOPATHY
RISK FACTORS AND DRUG INTERACTION PREDISPOSING TO STATIN-INDUCED MYOPATHY Assist. Prof. Dr. Verawan Uchaipichat Clinical Pharmacy Department Khon Kaen University Advanced Pharmacotherapy 2012 Updated d
More informationThe Role of Drug Transporters in Statin-Induced Myopathy
Western University Scholarship@Western Electronic Thesis and Dissertation Repository December 2012 The Role of Drug Transporters in Statin-Induced Myopathy Michael J. Knauer The University of Western Ontario
More informationUniv.-Doz. Prof. Dr. W. Renner
Pharmacogenetics of statin-inducedinduced myopathies Wilfried Renner Medical University Graz Clinical Institute of Medical and Chemical Laboratory Diagnostics It started with a fungus 1973: Isolation of
More informationSLCO1B1 Pharmacogenetic Competency
SLCO1B1 Pharmacogenetic Competency Updated on 6/2015 Pre-test Question # 1 Which of the following is not currently a recognized SLCO1B1 phenotype? a) Low function b) Normal function c) Intermediate function
More informationFundamentals of Membrane Transporters and their Role in In Vivo PK/PD of Drugs
Fundamentals of Membrane Transporters and their Role in In Vivo PK/PD of Drugs Jash Unadkat, Ph.D. Department of Pharmaceutics University of Washington Seattle, WA 98195 http://depts.washington.edu/pceut/faculty_research/faculty_members/unadkat_jashvant.html
More informationDifferent Effects of SLCO1B1 Polymorphism on the Pharmacokinetics of Atorvastatin and Rosuvastatin
nature publishing group Different Effects of SLCO1B1 Polymorphism on the Pharmacokinetics of Atorvastatin and Rosuvastatin MK Pasanen 1, H Fredrikson 1, PJ Neuvonen 1 and M Niemi 1 Thirty-two healthy volunteers
More informationDeterminants of Drug Disposition
Drug Transporters: In Vitro and Knockout Model Systems, Pharmacogenomics, and Clinical Relevance Richard B. Kim MD, FRCP(C) Professor & Chair, Division of Clinical Pharmacology Director, Centre for Clinical
More informationApplication of a Physiologically Based Pharmacokinetic Model to Predict OATP1B1-Related Variability in Pharmacodynamics of Rosuvastatin
Original Article Citation: CPT Pharmacometrics Syst. Pharmacol. (), e; doi:./psp.. ASCPT All rights reserved -/ Application of a Physiologically Based Pharmacokinetic Model to Predict OATPB-Related Variability
More informationFalk Symposium 156: Genetics in Liver Disease. Pharmacogenetics. Gerd Kullak-Ublick
Falk Symposium 156: Genetics in Liver Disease Pharmacogenetics Gerd Kullak-Ublick Division of Clinical Pharmacology and Toxicology Department of Internal Medicine University Hospital Zurich Freiburg, 8.
More informationEvaluation of Food Effects on the Oral Pharmacokinetics of Rosuvastatin
Western University Scholarship@Western Electronic Thesis and Dissertation Repository June 2016 Evaluation of Food Effects on the Oral Pharmacokinetics of Rosuvastatin Cheynne C. McLean The University of
More informationDRUG-DRUG INTERACTIONS OF GLECAPREVIR AND PIBRENTASVIR WITH PRAVASTATIN, ROSUVASTATIN, OR DABIGATRAN ETEXILATE
DRUG-DRUG INTERACTIONS OF GLECAPREVIR AND PIBRENTASVIR WITH PRAVASTATIN, ROSUVASTATIN, OR DABIGATRAN ETEXILATE Matthew P. Kosloski, Weihan Zhao, Hong Li, Stanley Subhead Wang, Calibri Joaquin 14pt, Valdes,
More informationT Eley, Y-H Han, S-P Huang, B He, W Li, W Bedford, M Stonier, D Gardiner, K Sims, P Balimane, D Rodrigues, RJ Bertz
IN VIVO AND IN VITRO ASSESSMENT OF ASUNAPREVIR (ASV; BMS-650032) AS AN INHIBITOR AND SUBSTRATE OF ORGANIC ANION TRANSPORT POLYPEPTIDE (OATP) TRANSPORTERS IN HEALTHY VOLUNTEERS T Eley, Y-H Han, S-P Huang,
More informationManagement of Post-transplant hyperlipidemia
Management of Post-transplant hyperlipidemia B. Gisella Carranza Leon, MD Assistant Professor of Medicine Lipid Clinic - Vanderbilt Heart and Vascular Institute Division of Diabetes, Endocrinology and
More informationComplexities of Hepatic Drug Transport: How Do We Sort It All Out?
Complexities of Hepatic Drug Transport: How Do We Sort It All Out? Keith A. Hoffmaster Pfizer Research Technology Center Cambridge, MA NEDMDG 2005 Summer Symposium 06.08.2005 The Challenge Intestinal uptake
More informationObjectives Making CYP450, Drug Interactions, & Pharmacogenetics Easy
Objectives Making, Drug Interactions, & Pharmacogenetics Easy Anthony J. Busti, MD, PharmD, FNLA, FAHA Describe the differences between phase I and phase II metabolic pathways. Identify the most common
More informationMycophénolate mofétil
Mycophénolate mofétil O OH CH 3 O O-desmethyl O glucosides OH CH 3 OCH 3 CH 3 CYP 3A UGT2B7 C O HO O HO AcMPAG (acyl-glucuronide) ACTIF TOXIQUE O O CH 3 OCH 3 Mycophenolate (MPA) OH COOH UGT enzymes COOH
More informationInvestigating Transporter-Mediated Drug-Drug Interactions Using a Physiologically Based Pharmacokinetic Model of Rosuvastatin
Citation: CPT Pharmacometrics Syst. Pharmacol. (2017) 6, 228 238; VC 2017 ASCPT All rights reserved doi:10.1002/psp4.12168 ORIGINAL ARTICLE Investigating Transporter-Mediated Drug-Drug Interactions Using
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationA mong the 20 leading prescription
Safety and Statins: Pharmacologic and Clinical Perspectives Michael B. Bottorff, PharmD A mong the 20 leading prescription drugs in the United States, 3 agents atorvastatin (Lipitor), simvastatin (Zocor),
More informationTransporters DDI-2018
Transporters DDI-2018 Mark S. Warren, Ph.D. June 16, 2018 Senior Director of Assay Services DDI-2018: 21 st Conference on DDIs FDA guidance documents: A 21 year history 1997 2006 2012 2017 Each year, large
More informationEvaluation of Proposed In Vivo Probe Substrates and Inhibitors for Phenotyping Transporter Activity in Humans
Supplement Article Evaluation of Proposed In Vivo Probe Substrates and Inhibitors for Phenotyping Transporter Activity in Humans The Journal of Clinical Pharmacology (2016), 56(S7) S82 S98 C 2016, The
More informationMolecular Medicine. Human Skeletal Muscle Drug Transporters Determine Local Exposure and Toxicity of Statins
Molecular Medicine Human Skeletal Muscle Drug Transporters Determine Local Exposure and Toxicity of Statins Michael J. Knauer, Bradley L. Urquhart, Henriette E. Meyer zu Schwabedissen, Ute I. Schwarz,
More informationFood Effect on Rosuvastatin Disposition and Low-Density Lipoprotein Cholesterol
Food Effect on Rosuvastatin Disposition and Low-Density Lipoprotein Cholesterol Cheynne C. McLean 1,2, Wendy A. Teft 1, Bridget L. Morse 1, Steven E. Gryn 1, Robert A. Hegele 3 and Richard B. Kim 1,2 ARTICLE
More informationPharmacogenomics and Pharmacokinetics ^
Pharmacogenomics and Pharmacokinetics ^ avid F. Kisor, B.S., Pharm.. Profeor of Pharmacokinetics epartment of Pharmaceutical and Biomedical Sciences Raabe College of Pharmacy Ohio Northern University Learning
More informationOriginal paper. Abstract. Abdullah S. Asia 1*, Al-Mahdi A. Modar 2, Hadi M. Ali 3
Original paper Frequency Of Potential Adverse Effects Of A Semisynthetic Statin (Simvastatin) Compared To A Synthetic Statin (Atorvastatin) Used To Reduce Cardiovascular Risk For Patients In Basra 1*,
More informationStable transfected HEK293-OATP cells for transporter analysis A model system for the assay of drug uptake.
Stable transfected HEK293-OATP cells for transporter analysis A model system for the assay of drug uptake. PRIMACYT Cell Culture Technology GmbH, Hagenower Str. 73, D-19061 Schwerin, Germany E-mail: info@primacyt.com,
More informationStrategy on Drug Transporter Investigation Why, How, Which & When. Jasminder Sahi
Strategy on Drug Transporter Investigation Why, How, Which & When Jasminder Sahi Intestine Drug Absorption PEPT1 OATPs MCTs AE2 Epithelial Cell MCTs MRP3 Liver Excretion via Liver Kidney MRPs OATPs N PT1
More informationPharmacology Challenges: Managing Statin Myalgia
Clinical Case: RM is a 50 year-old African American woman with a past medical history of type diabetes, dyslipidemia, hypertension and peripheral arterial disease. She had been prescribed simvastatin 80
More informationThe importance of pharmacogenetics in the treatment of epilepsy
The importance of pharmacogenetics in the treatment of epilepsy Öner Süzer and Esat Eşkazan İstanbul University, Cerrahpaşa Faculty of Medicine, Department of Pharmacology and Clinical Pharmacology Introduction
More informationRole of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):
Role of metabolism in Drug-Induced Liver Injury (DILI) Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 Drug Metab Rev. 2007;39(1):159-234 A schematic representation of the most relevant
More informationJournal of. Cardiology and Therapy. Role of Pharmacogenetics on Response to Statins: A Genotypebased Approach to Statin Therapy Outcome ABSTRACT
Journal of Cardiology and Therapy Online Submissions: http://www.ghrnet.org/index./jct/ doi:10.6051/j.issn.2309-6861.2014.01.35 Journal of Cardiol Ther 2014 July 10 1(6): 111-120 ISSN 2309-6861(print),
More informationGenetics and Genomics: Influence on Individualization of Medication Regimes
Genetics and Genomics: Influence on Individualization of Medication Regimes Joseph S Bertino Jr., Pharm.D., FCCP Schenectady, NY USA Goals and Objectives To discuss pharmacogenetics and pharmacogenomics
More informationCholesterol Management Roy Gandolfi, MD
Cholesterol Management 2017 Roy Gandolfi, MD Goals Interpreting cholesterol guidelines Cholesterol treatment in diabetics Statin use and side effects therapy Reporting- Comparison data among physicians
More informationRecent experiences to review data from MRCTs and progress of research on ethnic factors. Dr Yoshiaki Uyama
Recent experiences to review data from MRCTs and progress of research on ethnic factors Dr Yoshiaki Uyama (PMDA) Visiting Professor, Graduate School of Advanced Clinical Science, Chiba University Visiting
More informationCOMPARISON OF THREE IN VITRO MODELS EXPRESSING THE MEMBRANE DRUG TRANSPORTER OATP1B1
Master thesis submitted for the degree Candidata pharmaciae COMPARISON OF THREE IN VITRO MODELS EXPRESSING THE MEMBRANE DRUG TRANSPORTER OATP1B1 Maria Ulvestad Department of Pharmaceutical Biosciences,
More informationAnti Hyperlipidemic Drugs. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia
Anti Hyperlipidemic Drugs Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Lipoproteins Macromolecular complexes in the blood that transport lipids Apolipoproteins
More informationpolymorphism on repaglinide pharmacokinetics persists over a wide dose range
British Journal of Clinical Pharmacology DOI:./j.365-5.8.387.x The effect of SLCOB polymorphism on repaglinide pharmacokinetics persists over a wide dose range Annikka Kalliokoski, Mikko Neuvonen, Pertti
More informationVariability Due to Genetic Differences
1 Variability Due to Genetic Differences Nick Holford Dept Pharmacology & Clinical Pharmacology University of Auckland 2 Objectives Understand how between individual variation may contribute to :» drug
More informationPharmacovigilance in Clinical Trials
Second Annual Symposium on Pharmacovigilance,, Hong Kong, 4 March 2011 Pharmacovigilance in Clinical Trials Brian Tomlinson Professor of Medicine and Therapeutics Division of Clinical Pharmacology Department
More information2/28/2010. Pharmacogenomics and the Asian Population. Limited efficacy/response to drugs already on the market
Pharmacogenomics and the Asian Population Majority are medication related Alan H.B. Wu, Ph.D. Professor, Laboratory Medicine, UCSF Section Chief, Clinical Chemistry, February 27, 20 Limited efficacy/response
More informationHenriette E Meyer zu Schwabedissen 1, Werner Siegmund 2, Heyo K Kroemer 3 and Jens D Rollnik 4*
Meyer zu Schwabedissen et al. BMC Research Notes 2014, 7:688 CASE REPORT Open Access Creatine kinase elevation caused by a combination of fluvastatin and telmisartan in a patient heterozygous for the CYP2C9*3
More informationScientific conclusions
Annex II Scientific conclusions and grounds for amendment of the summary of product characteristics, labelling and package leaflet presented by the European Medicines Agency 24 Scientific conclusions Overall
More informationEffects of gemfibrozil and rifampicin on the pharmacokinetics of HMG-CoA reductase inhibitors
Effects of gemfibrozil and rifampicin on the pharmacokinetics of HMG-CoA reductase inhibitors Department of Clinical Pharmacology University of Helsinki Finland Effects of gemfibrozil and rifampicin on
More informationPathophysiology of Bile Secretion
Pathophysiology of Bile Secretion Martin C. Carey, D.Sc., M.D. Division of Gastroenterology, Brigham and Women s Hospital and Department of Medicine, Harvard Medical School Boston, MA, U.S.A. Functions
More informationAntihyperlipidemic drugs
Antihyperlipidemic drugs The clinically important lipoproteins are LDL low density lipoprotein, VLDL very low density lipoprotein, HDL high density lipoprotein. Hyperlipidemia may caused 1. by individual
More informationIn vitro substrate-dependent inhibition of OATP1B1 and its impact on DDI prediction
SSX 3 rd Annual Conference (Oct 11, 2018) In vitro substrate-dependent inhibition of OATP1B1 and its impact on DDI prediction Yoshitane Nozaki, PhD DMPK Tsukuba Organic Anion Transporting Polypeptide (OATP)
More information1 DOS CME Course 2011
Statin Myopathy February 23, 2011 Jinny Tavee, MD Associate Professor Neurological Institute Cleveland Clinic Foundation 1 Case 1 50 y/o woman with hyperlipidemia presents with one year history of deep
More informationMechanism of Statin-Induced Rhabdomyolysis
J Pharmacol Sci 123, 289 294 (2013) Journal of Pharmacological Sciences The Japanese Pharmacological Society Current Perspective Mechanism of Statin-Induced Rhabdomyolysis Kazuho Sakamoto 1, * and Junko
More informationStatin intolerance. Pr Franck Boccara, MD, PhD Cardiologie, INSERM UMRS938 CHU St Antoine, UPMC, Paris, France
Statin intolerance Pr Franck Boccara, MD, PhD Cardiologie, INSERM UMRS938 CHU St Antoine, UPMC, Paris, France Disclosure Statement of Financial Interest I currently have, or have had over the last two
More informationMechanisms and assessment of statin-related muscular adverse effects
British Journal of Clinical Pharmacology DOI:10.1111/bcp.12360 Mechanisms and assessment of statin-related muscular adverse effects Dirk Moßhammer, 1 Elke Schaeffeler, 3,4 Matthias Schwab 2,3,4 & Klaus
More informationErik Mogalian, Polina German, Chris Yang, Lisa Moorehead, Diana Brainard, John McNally, Jennifer Cuvin, Anita Mathias
Evaluation of Transporter and Cytochrome P450-Mediated Drug-Drug Interactions Between Pan-Genotypic HCV NS5A Inhibitor GS-5816 and Phenotypic Probe Drugs Erik Mogalian, Polina German, Chris Yang, Lisa
More informationEffects of grapefruit juice on pharmacokinetics of atorvastatin and pravastatin in Japanese
et al. British Journal of Clinical Pharmacology DOI:.46/j.365-5.3.3.x Effects of grapefruit juice on pharmacokinetics of atorvastatin and pravastatin in Japanese Ichiro Fukazawa, Naoki Uchida, Eiji Uchida
More informationCryo Characterization Report (CCR)
Human Cryopreserved Hepatocytes Lot number: HUM4061B Date: October 19, 2014 Cryo Characterization Report (CCR) Lot Overview Qualification Catalog Number Quantity Cryopreserved human hepatocytes, Qualyst
More informationStatin Intolerance. Jason Evanchan DO, FACC April 20 th, 2018
Statin Intolerance 2 nd Annual CV Course for Trainees and Early Career Physicians: Current Concepts in the Diagnosis and Management of Coronary Artery Disease Jason Evanchan DO, FACC April 20 th, 2018
More informationCauses and Consequences of Variability in Drug Transporter Activity in Pediatric Drug Therapy
Supplement Article Causes and Consequences of Variability in Drug Transporter Activity in Pediatric Drug Therapy The Journal of Clinical Pharmacology (2016), 56(S7) S173 S192 C 2016, The American College
More information1.* Dosage. A. Adults
3-Hydroxy-3-Methylglutaryl Coenzyme A (HMG-CoA) Reductase Inhibitors [Developed, November 1994; Revised, October 1996; September 1997; September 1998; October 1999; November 1999; August 2000; September
More informationDrug Class Review HMG-CoA Reductase Inhibitors (Statins) and Fixed-dose Combination Products Containing a Statin
Drug Class Review HMG-CoA Reductase Inhibitors (Statins) and Fixed-dose Combination Products Containing a Statin Final Report Update 5 November 2009 This report reviews information about the comparative
More informationTill David och Calle
Till David och Calle List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals assigned below. I II III Bergman, E., Forsell, P., Tevell, A.,
More informationAssociation between SLCO1B1 521 T C and 388 A G Polymorphisms and Statins Effectiveness: A Meta-Analysis
796 Original Article Association between SLCO1B1 51 T C and 388 A G Polymorphisms and Statins Effectiveness: A Meta-Analysis Rong Dai 1, Jing Feng 1, Yang Wang 1, Yuan Yang, Changkai Deng 3, Xiaojun Tang
More informationNew opportunities for targeting. multiple lipid pathways. Michel FARNIER, DIJON, FRANCE
New opportunities for targeting multiple lipid pathways Michel FARNIER, DIJN, FRANCE Lipid lowering drug therapy 60s and 70s - nicotinic acid -resins 70s to 90s - fibrates the 90s - statins Coronary heart
More informationCO-ADMINISTRATION WITH GRAZOPREVIR AND ELBASVIR HAS NO EFFECT ON PRAVASTATIN EXPOSURE BUT INCREASES ROSUVASTATIN EXPOSURE IN HEALTHY SUBJECTS
CO-ADMINISTRATION WITH GRAZOPREVIR AND ELBASVIR HAS NO EFFECT ON PRAVASTATIN EXPOSURE BUT INCREASES ROSUVASTATIN EXPOSURE IN HEALTHY SUBJECTS Luzelena Caro 1, William L. Marshall 1, Hwa-Ping Feng 1, Zifang
More informationPharmacologic Characteristics of Statins
Clin. Cardiol. Vol. 26 (Suppl. III), III-32 III-38 (2003) Pharmacologic Characteristics of Statins JAMES M. MCKENNEY, PHARM.D. National Clinical Research, Inc., and School of Pharmacy, Virginia Commonwealth
More informationUse of in vitro cell assays and noninvasive imaging techniques to reduce animal experiments in drug development
Use of in vitro cell assays and noninvasive imaging techniques to reduce animal experiments in drug development J. Jia, M. Keiser, S. Oswald, W. Siegmund Department of Clinical Pharmacology, Ernst-Moritz-Arndt
More informationGenetics of Arterial and Venous Thrombosis: Clinical Aspects and a Look to the Future
Genetics of Arterial and Venous Thrombosis: Clinical Aspects and a Look to the Future Paul M Ridker, MD Eugene Braunwald Professor of Medicine Harvard Medical School Director, Center for Cardiovascular
More informationManthena V. Varma, PhD 1 and Ayman F. El-Kattan, PhD 2
Supplement Article Transporter-Enzyme Interplay: Deconvoluting Effects of Hepatic Transporters and Enzymes on Drug Disposition Using Static and Dynamic Mechanistic Models The Journal of Clinical Pharmacology
More informationSimvastatin 40 mg equivalent
Simvastatin 40 mg equivalent medications equivalent to Simvastatin is available on the Drugs.com website. Simvastatin (Zocor ): 10 mg : Equivalent Dosages - 3: Atorvastatin (Lipitor. 40 mg : Equivalent
More informationEP A1 (19) (11) EP A1. (12) EUROPEAN PATENT APPLICATION published in accordance with Art. 153(4) EPC
(19) (12) EUROPEAN PATENT APPLICATION published in accordance with Art. 13(4) EPC (11) EP 2 07 001 A1 (43) Date of publication: 01.07.2009 Bulletin 2009/27 (21) Application number: 07834499.1 (22) Date
More informationDRUG METABOLISM AND PHARMACOKINETICS (DMPK) Lena Gustavsson, H. Lundbeck A/S, November 2015
DRUG METABOLISM AND PHARMACOKINETICS (DMPK), H. Lundbeck A/S, LEGU@lundbeck.com November 2015 DMPK in Drug Discovery and Development Agenda Introduction Optimizing pharmacokinetic properties Absorption
More informationEvan A. Stein 1, David Sullivan 2, Anders G. Olsson 3, Rob Scott 4, Jae B. Kim 4, Allen Xue 4, Thomas Liu 4, Scott M. Wasserman 4
Goal Achievement after Utilizing an Anti-PCSK9 Antibody in Statin-Intolerant Subjects (GAUSS): Results from a Randomized, Double-blind, Placebo and Ezetimibe Controlled Study Evan A. Stein 1, David Sullivan
More informationSee Important Reminder at the end of this policy for important regulatory and legal information.
Clinical Policy: Reference Number: CP.HNMC.05 Effective Date: 11.16.16 Last Review Date: 11.17 Line of Business: Medicaid Medi-Cal Revision Log See Important Reminder at the end of this policy for important
More informationBuilding innovative drug discovery alliances. Hepatic uptake and drug disposition o in vitro and in silico approaches
Building innovative drug discovery alliances Hepatic uptake and drug disposition o in vitro and in silico approaches Dr Beth Williamson Evotec AG, 2017 Outline Importance of predicting clearance In vitro
More informationTreating Hyperlipidemias in Adults. Lisa R. Tannock MD Division of Endocrinology and Molecular Medicine, University of Kentucky Lexington KY VAMC
Treating Hyperlipidemias in Adults Lisa R. Tannock MD Division of Endocrinology and Molecular Medicine, University of Kentucky Lexington KY VAMC Disclosures Conflicts: None Talk will address off-label
More informationLipid Guidelines Who, What, and How Low. Anita Ralstin, MS, CNP Next Step Health Consultant, LLC New Mexico Heart Institute
Lipid Guidelines Who, What, and How Low Anita Ralstin, MS, CNP Next Step Health Consultant, LLC New Mexico Heart Institute Disclosures! None Objectives! List factors used in screening for dyslipidemia
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Lipid disorders: Disorders of lipid metabolism are manifest by elevation of the plasma concentrations of the various lipid and lipoprotein fractions (total and LDL cholesterol,
More informationMODULE PHARMACOKINETICS WRITTEN SUMMARY
MODULE 2.6.4. PHARMACOKINETICS WRITTEN SUMMARY m2.6.4. Pharmacokinetics Written Summary 2013N179518_00 TABLE OF CONTENTS PAGE 1. BRIEF SUMMARY...4 2. METHODS OF ANALYSIS...5 3. ABSORPTION...6 4. DISTRIBUTION...7
More informationDrug Interactions Keeping it all Straight. Peter Lin MD CCFP Director Primary Care Initiatives Canadian Heart Research Centre
Drug Interactions Keeping it all Straight Peter Lin MD CCFP Director Primary Care Initiatives Canadian Heart Research Centre Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document
More informationTransporters and Drug-Drug Interactions: Important Determinants of Drug Disposition and Effects s
Supplemental Material can be found at: /content/suppl/2013/05/23/65.3.944.dc1.html 1521-0081/65/3/944 966$25.00 http://dx.doi.org/10.1124/pr.113.007518 PHARMACOLOGICAL REVIEWS Pharmacol Rev 65:944 966,
More informationHow to Handle Statin Intolerance in the High Risk Patient
How to Handle Statin Intolerance in the High Risk Patient Thomas D. Conley, MD FACC FSCAI Disclosures: None 1 Definition of High Risk Primary Prevention ASCVD Risk Calculator Adults >21 yrs, LDL 190 mg/dl
More informationDrugs for Dyslipidemias
Drugs for Dyslipidemias HMG CoA reductase inhibitors (statins): atorvastatin, lovastatin, pravastatin, simvastatin Bile acid-binding resins: cholestyramine, colestipol, colesevelam Fibric acid derivatives
More informationPharmacologic Considerations when using DAAs in Cirrhosis
Pharmacologic Considerations when using DAAs in Cirrhosis Jennifer J. Kiser, PharmD Assistant Professor University of Colorado Denver 1 st International Workshop on the Optimal Use of DAAs in Liver Transplant
More informationLipid Therapy: Statins and Beyond. Ivan Anderson, MD RIHVH Cardiology
Lipid Therapy: Statins and Beyond Ivan Anderson, MD RIHVH Cardiology Outline The cholesterol hypothesis and lipid metabolism The Guidelines 4 Groups that Benefit from Lipid therapy Initiation and monitoring
More informationMOLINA HEALTHCARE OF CALIFORNIA
MOLINA HEALTHCARE OF CALIFORNIA HIGH BLOOD CHOLESTEROL IN ADULTS GUIDELINE Molina Healthcare of California has adopted the Third Report of the National Cholesterol Education Program (NCEP) Expert Panel
More informationSanger Heart & Vascular Institute Symposium 2015
Sanger Heart & Vascular Institute Symposium 2015 Cardiovascular Update For Primary Care Physicians William E. Downey, MD FACC FSCAI Medical Director, Interventional Cardiology Sanger Heart & Vascular Institute
More informationAspectos diferenciales entre estatinas y su aproximación a la práctica clínica
Aspectos diferenciales entre estatinas y su aproximación a la práctica clínica Lluís Masana Marín Unitat de Medicina Vascular i Metabolisme Servei de Medicina Interna Hospital Universitari Sant Joan IISPV.
More informationDyslipidemia and HIV NORTHWEST AIDS EDUCATION AND TRAINING CENTER
NORTHWEST AIDS EDUCATION AND TRAINING CENTER Dyslipidemia and HIV Heidi Crane, MD, MPH Madison Metabolic Clinic Associate Professor UW Department of Medicine Presentation prepared by: Heidi Crane, MD,
More informationT REV 21. See 17 for PATIENT COUNSELING INFORMATION and FDA-approved patient labeling. Revised: 07/2009
HIGHLIGHTS OF PRESCRIBING INFORMATION These highlights do not include all the information needed to use ZETIA safely and effectively. See full prescribing information for ZETIA. ZETIA (ezetimibe) Tablets
More information4/24/15. AHA/ACC 2013 Guideline Key Points
Review of the ACC/AHA 2013 Guidelines Anita Ralstin, MS, CNS, CNP Next Step Health Consultant, LLC 1! Discuss the rationale for the change in lipid guidelines and how that affects the decision to implement
More informationPHARMACOKINETICS AND DRUG DISPOSITION
PHARMACOKINETICS AND DRUG DISPOSITION Exposure of atorvastatin is unchanged but lactone and acid metabolites are increased several-fold in patients with atorvastatin-induced myopathy Background: The most
More informationEVALUATION OF DRUG-DRUG INTERACTION POTENTIAL BETWEEN SACUBITRIL/VALSARTAN (LCZ696) AND STATINS USING A PHYSIOLOGICALLY- BASED PHARMACOKINETIC MODEL
Drug metabolism and Pharmacokinetics/PK Sciences EVALUATIN F DRUG-DRUG INTERACTIN PTENTIAL BETWEEN SACUBITRIL/VALSARTAN (LCZ696) AND STATINS USING A PHYSILGICALLY- BASED PHARMACKINETIC MDEL Imad Hanna,
More informationDiabetes Care Publish Ahead of Print, published online December 10, 2009
Diabetes Care Publish Ahead of Print, published online December 10, 2009 TNF-α-C-857T polymorphism, LDL-cho & statins Association of the TNF-α-C-857T Polymorphism with Resistance to the Cholesterol-Lowering
More informationRegulation of the cell surface expression and transport capacity of BSEP by small chemical molecules
Regulation of the cell surface expression and transport capacity of by small chemical molecules Hisamitsu Hayashi and Yuichi Sugiyama Dept. of Molecular Pharmacokinetics, Graduate School of Pharmaceutical
More informationConstitutive Regulation of P450s by Endocrine Factors
References: Constitutive Regulation of P450s by Endocrine Factors Meyer UA. Endo-xenobiotic crosstalk and the regulation of cytochromes P450. Drug Metab Rev 39:639-46, 2007. Waxman DJ and O Connor C. Growth
More informationROSULIP. Composition Rosulip 10 mg Each tablet contains 10 mg Rosuvastatin (as calcium).
ROSULIP Composition Rosulip 10 mg Each tablet contains 10 mg Rosuvastatin (as calcium). Tablets Rosulip 20 mg Each tablet contains 20 mg Rosuvastatin (as calcium). Action Rosuvastatin is a selective and
More informationDisclosures. How do statins work? Statin Pharmacokinetics 9/12/2013 THERAPEUTIC INTERVENTIONS FOR STATIN INTOLERANT PATIENTS
Disclosures Speakers Bureau- LipoScience Inc. THERAPEUTIC INTERVENTIONS FOR STATIN INTOLERANT PATIENTS Casey Elkins, DNP, NP-C, CLS How do statins work? Bays H, Stein EA. Expert Opin Pharmacother. 2003;4(11):1901-1938.
More informationExploiting BDDCS and the Role of Transporters
Exploiting BDDCS and the Role of Transporters (Therapeutic benefit of scientific knowledge of biological transporters, understanding the clinical relevant effects of active transport on oral drug absorption)
More informationPharmacologic Considerations of HCV Treatment. Autumn Zuckerman, PharmD, BCPS, AAHIVP
Pharmacologic Considerations of HCV Treatment Autumn Zuckerman, PharmD, BCPS, AAHIVP Objectives Review pharmacokinetic properties of currently utilized Hepatitis C medications Review drug interactions
More informationLipid Panel Management Refresher Course for the Family Physician
Lipid Panel Management Refresher Course for the Family Physician Objectives Understand the evidence that was evaluated to develop the 2013 ACC/AHA guidelines Discuss the utility and accuracy of the new
More informationInhibition of Human Hepatic Bile Acid Transporters as Contributing Factors to Drug-Induced Liver Injury
Inhibition of Human Hepatic Bile Acid Transporters as Contributing Factors to Drug-Induced Liver Injury Kenneth R. Brouwer, Ph.D., RPh Chief Scientific Officer DDI Meeting June 2017 Seattle, Washington
More informationHepatic Transporter Proteins involved in Bile Formation
Bile salt synthesis Hepatic Transporter Proteins involved in Bile Formation Basolateral membrane transporter proteins fx: NTCP uptake of bile salts OATP bulky organic anions Canalicular membrane transporter
More information