PCSK9 RNAi Therapeutics. Kevin FitzGerald
|
|
- Derick Norton
- 6 years ago
- Views:
Transcription
1 PCSK9 RNAi Therapeutics Kevin FitzGerald
2 Presenter Disclosure Information PSCK9 RNAi Therapeutics The following relationships exist related to this presentation:» Kevin Fitzgerald and Alnylam team members: Holds stock options in Alnylam Pharmaceuticals» University of Texas Southwestern Medical Center: Engaged in research for Alnylam» Tekmira Pharmaceuticals/UBC Engaged in research for Alnylam Pharmaceuticals 2
3 RNAi Therapy for Hypercholesterolemia Rationale for PCSK9 Hypercholesterolemia/PCSK9 Well validated target» Gain and loss of function mutations Rodent and Human (gf) and (lf) mutations PCSK9 expressed in liver (delivery) Early clinical markers of activity possible (PCSK9, LDLc, ApoB) Alnylam PCSK9 program Discovery of pm active PCSK9 sirnas Formulations or conjugates for delivery Proof of concept» Multiple rodent models, NHP s Collaboration with UT Southwestern» Horton, Hobbs, Brown and Goldstein Liver VLDL Rem PCSK9 Pathway PCSK9 LDL receptor LDL VLDL Rem Peripheral cells LDL 3
4 RNAi Product Platform Turning sirnas into Drugs Bioinformatics, in vitro assays Phosphorothioate 2 OMe, 2 F Cholesterol, others Select» In silico design» In vitro assays Stabilize» Chemistry Deliver» Formulations» Conjugates Incorporate minimal number of modifications required for appropriate pharmaceutical properties 4
5 Target/GAPDH relative to control treated No Evidence of Off-Target Silencing by PCS-B Endogenous Genes at High Concentration of PCS-B2 in vitro (Hep3B, RNAiMax, 1uM) Control ORMDL2 BMP6 TAPT1 MYEF2 LOC RFT1 PCSK9 PCS-B2 PCS-B2 pm IC 50 5
6 Lack of PCS-B2 Cytokine Induction Panel of 7 Cytokines, IFN-, IP-10, IFN-, TNF, IL-6, IL-1ra, G-CSF (hpbmc) 13 Donors Medium Medium plus transfection reagent Neg Control sirna Control sirna1 Control sirna2 Control sirna3 PCS-B IFN- IP-10 IFN- TNF- IL-6 IL-1ra G-CSF 6
7 Viability relative to control PCS-B2 Has No Effect On Cell Proliferation In 4 Different Cell Lines (Hep3B, Cos7 Cells Example) Hep3B Day Neg-Ctrl (nm) Pos-Ctrl (nm) PCS-A1 (nm) PCS-A4 (nm) PCS-B2 (nm) 7
8 Lipid Nanoparticles for Systemic RNAi Multi-component lipid formulation» Cationic lipid» Structural lipid» PEG lipid» Cholesterol Highly efficient for liver delivery» Hepatocyte-specific gene silencing achieved Low surface charge Small uniform size particle <100 nm 8
9 Liver PCSK9 mrna and serum Tc levels* RNAi Silencing of PCSK9 in Rats 1.6 PCSK9 mrna Tc LNP-siRNA (mg/kg) Day 0 3 N=6/group PCSK9 mrna Total chol. LDLR * * * ** ** RACE (Liver) LNP-PCS-A2 LNP-Ctrl PBS 0 PBS LNP-Ctrl LNP-PCS-A2 (mg/kg) (mg/kg) P PBS LNP-Ctrl LNP-PCS-A2 PBS LDLR TFR Predicted PCR band Seq. Confirmed Lane Frank-Kamenetsky et. al., Proc. Natl Acad. Sci., Aug
10 Serum Tc level* Liver cholesterol and TG levels* RNAi Silencing of PCSK9 Decreases Total Cholesterol in Rats Duration and Lack of Fatty Liver LNP-siRNA 5mg/kg Day 0 N=6/group X Hepatic cholesterol and triglycerides Total serum cholesterol d3 Hepatic cholesterol Hepatic TG Days post-injection * P<.05 (ANOVA) at up to day 16 LNP-PCS-A2 LNP-Ctrl PBS LNP-Ctrl LNP-PCS-A2 (mg/kg) (mg/kg) Proc. Natl Acad. Sci., Aug
11 Relative to PBS=1 PCSK9 mrna is down modulated in hcetp/hapob100 Transgenic Mice LDL particle number lowering Particle, nmol/l LNPX-PCS sirna (5mg/kg) Day 0 N=4/group 3 liver PCSK9 mrna NMR LipoProfile: LDL and HDL particle number 1.2 PCSK9/GAPDH Control PCS-A2 0 LDL HDL Control Total Particle Number LDL HDL PCS-A2 Total Particle Number 11
12 Plasma PCSK9 levels relative to pre-dose Serum LDLc relative to pre-dose RNAi Silencing of LDLc and PCSK9 Protein Non-Human Primates Acute and durable effects after a single 30 minute infusion PCSK9 plasma levels reduced by up to 70% of pre-dose levels Rapid reductions in LDL cholesterol levels by 40-60% ** = P<.01 *** = P< ** = P<.01 *** = P<.001 ** *** *** ** *** *** *** *** *** *** *** *** *** *** *** *** *** 0.5 *** *** *** PBS LNP-PCS-A2 LNP-PCS-B2 0 PBS LNP-PCS-A2 LNP-PCS-B2 Day Post-injection Day Post-injection Proc. Natl Acad. Sci., Aug
13 % Residual Factor VII LNP- formulated FVII sirna LNP Progress Efficacy Improvement Over Time serum FVII protein Day C DLinDMA DLinDAP 60 DLin-KC2-DMA-a DLin-KC2-DMA-b DLin-K-DMA 98N12-5(I) ED FVII sirna Dose (mg/kg) 13
14 Total Cholesterol Relative to PBS=1 relative to PBS= PCSK9/GAPDH Cholesterol Dose Sparing Paradigm and Multiple Injections LNP formulated PCS-A2 (mg/kg) PBS 3mg/kg bolus+ PBS once a week 3mg/kg bolus mg/kg per week days post initial bolus Initial 3mg/kg bolus Maintenance: 1 x wk Rats were bled one day prior to repeated dosing 14
15 relative to PBS=1 Dose Response in Rats PCS-A2 ED50 <0.1 mg/kg in Newer Formulations LNP E- formulated PCS-A2 sirna Day 0 3 liver PCSK9 mrna, total serum cholesterol PCSK9/GAPDH Cholesterol LNP E-formulated PCS-A2 sirna (mg/kg) 15
16 PCSK9 protein, ng/ml LDLc, mg/dl PCSK9 Gene Silencing with 2 nd Generation LNPs Primate Model ALN-PCS demonstrates potent efficacy in primates Employs 2 nd generation LNPs Rapid and durable dose-dependent reduction in PCSK9 protein PCSK9 silencing results in >50% reductions in LDLc LNP-control (1.00 mpk) 0.03 mpk 0.10 mpk 0.30 mpk 1.00 mpk sirna Dosing Day sirna Dosing Day 16
17 LNP-PCS-B2 Treatment with LNP-PCS-B2 Does Not Affect HDLc Levels NHP LNP-control (1.00 mpk) 0.03 mpk mpk 0.30 mpk 1.00 mpk
18 5 Different sirnas Formulated Nanoparticles Inhibit 5 Different Hepatic mrnas in Dose Dependent Manner Mice 72h Target mrna, relative to LNP12-Luc Control PCSK9 ED50, mg/kg ApoB FVII Xbp1 LNP-X-siRNAs Pool of SORT sirna mg/kg PNAS publication in press 18
19 Target mrna 10 Different Formulated sirnas in One Nanoparticle Inhibit 10 Different Hepatic mrnas Mice, 0.1mg/kg of each sirna, 48h 1.5 Luc Pool of PCSK9 FVII ApoB TTR Xbp1 SORT1 TTC39B Rab5c ITG 1 ApoC3 LNP-siRNA-Pool of 10 19
20 Summary PCSK9 Program RNAi therapeutic targeting PCSK9: Results in rapid, significant, and sustained lowering of LDLc levels, but not HDLc Lead molecules are active in all pre-clinical models tested:» pm and specific Rats» Total cholesterol lowering; RNAi based and LDLR mechanisms» <3 weeks duration on single dose» Steatosis free NHP study:» LDLc decreased ~40-60% with no effects on HDL cholesterol at doses >0.1mg/kg Dose sparing paradigms may be possible Combinations possible to treat metabolic syndrome» Up to ten targets in same formulation 20
21 ALN-PCS Team Alnylam Pharmaceuticals M. Frank-Kamenetsky T. Racie L. Qin A. Akinc V. Sharma L. Nechev S. Shulga-Morskaya K. Mills S. Millstein J. Wong T. Lei R. Duncan G. Wang R. Kallanthottathil M. Maier C. Gamba-Vitalo M. Kretschmer M. Jayaraman R. Myers K. Charisse M. Manoharan V. Kotelianski A. de Fougerolles University of Texas SW J. Horton A. Grefhorst N. Anderson Tekmira S. Semple A. Lee L. Jeffs E. Yaworski P. Lutwyche I. MacLachlan MIT Dan Anderson 21
AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics. March 1, 2012 Akin Akinc, PhD
AsiaTIDES 2012: Formulation and Delivery of Peptides and Oligonucleotides Strategies for Delivery of RNAi Therapeutics March 1, 2012 Akin Akinc, PhD Lead Selection Alnylam RNAi Product Platform Turning
More informationALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results
ALN-PCSsc, an RNAi Investigational Agent That Inhibits PCSK9 Synthesis With the Potential for Effective Bi-Annual Dosing: Interim Results Kevin Fitzgerald, PhD Co-authors: Amy Simon 1, Suellen White 1,
More information2011 ASH Annual Meeting Targeting the Hepcidin Pathway with RNAi Therapeutics for the Treatment of Anemia. December 12, 2011
211 ASH Annual Meeting Targeting the Hepcidin Pathway with RNAi Therapeutics for the Treatment of Anemia December 12, 211 Hepcidin is Central Regulator of Iron Homeostasis Hepcidin is liver-expressed,
More information2013 OTS Annual Meeting Pre-clinical Development of ALN-AS1 RNAi Therapeutic for the Treatment of Acute Intermittent Porphyria.
2013 OTS Annual Meeting Pre-clinical Development of ALN-AS1 RNAi Therapeutic for the Treatment of Acute Intermittent Porphyria October 8, 2013 Acute Intermittent Porphyria (AIP) Program Unmet Need and
More informationStacey Melquist #AHA16
Targeting apolipoprotein(a) with a novel RNAi delivery platform as a prophylactic treatment to reduce risk of cardiovascular events in individuals with elevated lipoprotein(a) Monday, November 14, 2016
More informationPhase 1 Trial of ALN-VSP in Cancers Involving the Liver. Annual Meeting of the Controlled Release Society August 2, 2011
Phase 1 Trial of ALN-VSP in Cancers Involving the Liver Annual Meeting of the Controlled Release Society August 2, 2011 Agenda ALN-VSP: Background Phase 1 Trial Study Design Safety Data Tumor Response
More informationINTERNAL MEDICINE - PEDIATRICS
Rev. Med. Chir. Soc. Med. Nat., Iaşi 2016 vol. 120, no. 2 INTERNAL MEDICINE - PEDIATRICS UPDATES NEW CLASS OF DRUGS: THERAPEUTIC RNAi INHIBITION OF PCSK9 AS A SPECIFIC LDL-C LOWERING THERAPY A.L. Strat
More informationRobust Antiviral Activity in Chronic HBV Infected Chimpanzees by RNAi Treatment
Robust Antiviral Activity in Chronic HBV Infected Chimpanzees by RNAi Treatment Laura Sepp-Lorenzino, Daniel Freedman, Andrew Sprague, Martin Maier, Vasant Jadhav, Satya Kuchimanchi, Natalie Keirstead,
More informationDigestive Disease Week RNAi Therapeutics Ameliorate Liver Disease Associated with Alpha-1 Antitrypsin Deficiency. May 6, 2014 Alfica Sehgal
Digestive Disease Week RNAi Therapeutics Ameliorate Liver Disease Associated with Alpha-1 Antitrypsin Deficiency May 6, 2014 Alfica Sehgal Alpha-1 Antitrypsin (AAT) AAT is a serine proteinase inhibitor
More informationDevelopment of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
More informationAlnylam RNAi Roundtable. May 13, 2011
Alnylam RNAi Roundtable May 13, 2011 Agenda & Introductions Welcome Cynthia Clayton» Senior Director, Investor Relations and Corporate Communications Program Overview Akshay Vaishnaw, M.D., Ph.D. (Moderator)»
More informationKevin Fitzgerald, PhD
A Subcutaneously Administered Investigational RNAi Therapeutic (ALN-PCSsc), Targeting PCSK9 for the Treatment of Hypercholesterolemia: Initial Phase 1 Study Results Kevin Fitzgerald, PhD Co-authors: Amy
More informationTKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection
TKM-HBV RNAi Therapeutic for Chronic Hepatitis B Infection Amy Lee, Arbutus Biopharma DIA/FDA Oligonucleotide-Based Therapeutics Conference September 9 Washington, DC Disclaimer The views and opinions
More informationXiaoping (Amy) Zhang, Varun Goel, Husain Attarwala, and Gabriel Robbie. Alnylam Pharmaceuticals, Cambridge, USA
Patisiran Pharmacokinetics (PK), Pharmacodynamics (PD), and Exposure-Response (E-R) Relationship in Patients with Hereditary Transthyretin-Mediated (hattr) Amyloidosis Xiaoping (Amy) Zhang, Varun Goel,
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationVarun Goel 1, Nathalie H Gosselin 2, Claudia Jomphe 2, Husain Attarwala 1, Xiaoping (Amy) Zhang 1, JF Marier 2, Gabriel Robbie 1
Population Pharmacokinetic (PK) / Pharmacodynamic (PD) Model of Serum Transthyretin (TTR) Following Patisiran Administration in Healthy Volunteers and Patients with Hereditary TTR-Mediated (hattr) Amyloidosis
More informationR&D Webinar: Product Pipeline Update
R&D Webinar: Product Pipeline Update Dr. Mark Murray, President & CEO Dr. Mark Kowalski, Chief Medical Officer Dr. Ian MacLachlan, Chief Scientific Officer Ian Mortimer, Executive Vice President Bruce
More informationCurrent Status and Future Directions
Delivery Roundtable Current Status and Future Directions June 25, 2009 Agenda RAi and the Role for Delivery Direct RAi Systemic RAi Future Strategies 5 RA Interference Synthetic sira dsra Cleavage dicer
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationSupplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al.
Supplementary Information: Figures 1-6 and Table 1 RNAi-Mediated Gene Silencing in Non-Human Primate Zimmermann, T.S. et al. a. 12 14 Relative apob mrna (%) 8 6 4 2 Relative apob mrna (%) 12 8 6 4 2 5
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationJuxtapid. Juxtapid (lomitapide) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)
More informationKynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: December 2, 2016 Kynamro Description Kynamro (mipomersen)
More informationPCSK9 Inhibition: From Genetics to Patients
PCSK9 Inhibition: From Genetics to Patients John Chapman BSc, Ph.D., D.Sc., FESC Research Professor, University of Pierre and Marie Curie Director Emeritus, INSERM Dyslipidemia and Atherosclerosis Research
More informationCurrent Cholesterol Guidelines and Treatment of Residual Risk COPYRIGHT. J. Peter Oettgen, MD
Current Cholesterol Guidelines and Treatment of Residual Risk J. Peter Oettgen, MD Associate Professor of Medicine Harvard Medical School Director, Preventive Cardiology Beth Israel Deaconess Medical Center
More informationEfficacy, Safety and Tolerability of 150 mg Q2W Dose of the PCSK9 mab REGN727/SAR236553: Data from Three Phase 2 Studies
Efficacy, Safety and Tolerability of 150 mg Q2W Dose of the PCSK9 mab REGN727/SAR236553: Data from Three Phase 2 Studies Michael J. Koren, 1 Evan A. Stein, 2 Eli M. Roth, 3 James M. McKenney, 4 Dan Gipe,
More informationLiposome Mediated Delivery of sirna to Hepatic Stellate Cells Alfica Sehgal, Mohammad Zafari, Boris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz
Liposome Mediated Delivery of sirn to Hepatic Stellate ells lfica Sehgal, Mohammad Zafari, oris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz Shaikh, Martin Maier, Jonathan O Shea, Lauren Speciner,
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationSupplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
More informationKynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro
More informationThe Evolution of sirna Therapeutics Targeting HBV at Arrowhead Pharmaceuticals. Sept 25, 2018
The Evolution of sirna Therapeutics Targeting HBV at Arrowhead Pharmaceuticals Sept 25, 2018 Disclosures I am an employee and shareholder in Arrowhead Pharmaceuticals, Inc. Safe Harbor Statement This presentation
More informationPCSK9 Inhibitors Current Status
PCSK9 Inhibitors Current Status Ryan T. Whitney, MD FACC Bryan Heart Spring Conference 2016 Disclosures, Conflicts, and Nefarious Connections I own no stock in the companies mentioned in this talk. I am
More informationInhibition of PCSK9: The Birth of a New Therapy
Inhibition of PCSK9: The Birth of a New Therapy Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Disclosures Dr. Kastelein
More informationRNAi Therapy for Chronic HBV Infection
RNAi Therapy for Chronic HBV Infection Bill Symonds, PharmD Chief Development Officer October 2017 NASDAQ: ABUS www.arbutusbio.com Forward Looking Statements This presentation contains forward-looking
More informationFocus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013
Focus on FH (Familial Hypercholesterolemia) Joshua W. Knowles, MD PhD for PCNA May, 2013 Conflicts CMO for The FH Foundation Pre-talk quiz What is cascade screening? 1. screening all family members 2.
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More informationBeyond HDL: new therapeutic targets
Rome Cardiology Forum 2014 An ESC Update Programme in Cardiology Rome, 29-31 2014 Beyond HDL: new therapeutic targets Marcello Arca, MD Dipartimento di Medicina Interna e Specialità Mediche UOS Centro
More informationInfluence of Polyethylene Glycol Lipid Desorption Rates on Pharmacokinetics and Pharmacodynamics of sirna Lipid Nanoparticles
Citation: Molecular Therapy Nucleic Acids (21) 2, e19; doi:1.18/mtna.21.66 21 The American Society of Gene & Cell Therapy All rights reserved 2162-251/12 www.nature.com/mtna Influence of Polyethylene Glycol
More informationa. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
More informationRNA Interference: A New Tool in the Toolbox for Treatment of HBV. Discovery On Target Senior Director, Research 25 September 2017
RNA Interference: A New Tool in the Toolbox for Treatment of HBV Amy Lee Discovery On Target Senior Director, Research 25 September 2017 Arbutus Biopharma Boston, MA NASDAQ: ABUS www.arbutusbio.com Chronic
More informationPCSK9 Inhibitors Current Status
PCSK9 Inhibitors Current Status Ryan T. Whitney, MD FACC Bryan Heart Fall Conference 2015 Disclosures, Conflicts, and Nefarious Connections I own no stock in the companies mentioned in this talk. I am
More informationLDL Uptake Cell-Based Assay Kit
LDL Uptake Cell-Based Assay Kit Catalog Number KA1327 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationCholesterol; what are the future lipid targets?
Cholesterol; what are the future lipid targets? lipidologist out-of-business in 5-10 years? G.Kees Hovingh dept of vascular medicine, Academic Medical Center g.k.hovingh@amc.uva.nl Disclosure - Consultant
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationLow-density lipoprotein as the key factor in atherogenesis too high, too long, or both
Low-density lipoprotein as the key factor in atherogenesis too high, too long, or both Lluís Masana Vascular Medicine and Metabolism Unit. Sant Joan University Hospital. IISPV. CIBERDEM Rovira i Virgili
More informationRXi Pharmaceuticals. Immuno-Oncology World Frontiers Conference. January 23, 2018 NASDAQ: RXII. Property of RXi Pharmaceuticals
RXi Pharmaceuticals Immuno-Oncology World Frontiers Conference January 23, 2018 NASDAQ: RXII Forward Looking Statements This presentation contains forward-looking statements within the meaning of the Private
More informationIONIS-ANGPTL3-L, an antisense inhibitor to
IIS-AGPTL3-L Rx, an antisense inhibitor to angiopoietin-like protein 3 [AGPTL3] reduces plasma AGPTL3 and lipids in healthy volunteers with elevated triglycerides Teresa A. Brandt 1, Li-Jung Tai 1, Joseph
More informationPK and PD Properties of Antisense Oligonucleotides: Bridging Nonclinical to Clinical
PK and PD Properties of Antisense ligonucleotides: Bridging Nonclinical to Clinical Rosie Z. Yu, Ph.D. Pharmacokinetics & Clinical Pharmacology Isis Pharmaceuticals, Inc. Carlsbad, CA USA 2 Antisense Mechanism
More informationALN-HBV. Laura Sepp-Lorenzino November 11, Alnylam Pharmaceuticals, Inc.
ALN-HBV Laura Sepp-Lorenzino November 11, 2016 2016 Alnylam Pharmaceuticals, Inc. 1 N-Acetyl Galactosamine (GalNAc) sirna Conjugates Subcutaneous Investigational RNAi Therapeutics 5 -sense 5 -AS ASGPR
More informationBringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health
Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationDose-dependent effects of sirna-mediated inhibition of SCAP on PCSK9, LDLR and
Dose-dependent effects of sirna-mediated inhibition of SCAP on PCSK9, LDLR and plasma lipids in mouse and rhesus monkey Kristian K. Jensen 1, 8*, Marija Tadin-Strapps 2*, Sheng-ping Wang 1, James Hubert
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationComprehensive Treatment for Dyslipidemias. Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium
Comprehensive Treatment for Dyslipidemias Eric L. Pacini, MD Oregon Cardiology 2012 Cardiovascular Symposium Primary Prevention 41 y/o healthy male No Medications Normal BP, Glucose and BMI Social History:
More informationN-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP
Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA
More informationSpherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin
Spherical Nucleic Acids For Advanced Wound Healing Applications Chad A. Mirkin Departments of Chemistry, Infectious Disease, Materials Science & Engineering, Chemical & Biological Engineering, and Biomedical
More informationZuhier Awan, MD, PhD, FRCPC
Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier
More informationDevelopment of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer
Development of a Novel IL-12 DNA-based Immunotherapy in Combination with Chemotherapy for Treatment of Advanced Ovarian Cancer Khursheed Anwer, Ph.D. Executive Vice President and CSO Molecular Medicine
More informationA Phase 3 Study of Lomitapide, a Microsomal Triglyceride Transfer Protein (MTP) Inhibitor, in Patients with Homozygous Familial Hypercholesterolemia
A Phase 3 Study of Lomitapide, a Microsomal Triglyceride Transfer Protein (MTP) Inhibitor, in Patients with Homozygous Familial Hypercholesterolemia Marina Cuchel, MD, PhD University of Pennsylvania, Philadelphia,
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationProblem patients in primary care Patient 4: Peripheral artery disease
Problem patients in primary care Patient 4: Peripheral artery disease Dr Terry McCormack Hambleton Richmond Whitby Clinical Commissioning Group Research Lead 01/05/2014 Delivering clinical research to
More informationLipidaholics Anonymous Case 2012;13:(1);284 Explaining the unexplainable LDL- P
1 Lipidaholics Anonymous Case 2012;13:(1);284 Explaining the unexplainable LDL- P A respected cardiologist contacted me about the following dilemma. He has a primary prevention case which is a woman with
More informationBCH 447. Triglyceride Determination in Serum
BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed
More informationAdvances in Lipid Nanoparticles for sirna Delivery
Pharmaceutics 2013, 5, 498-507; doi:10.3390/pharmaceutics5030498 OPEN ACCESS pharmaceutics ISSN 1999-4923 www.mdpi.com/journal/pharmaceutics Review Advances in Lipid Nanoparticles for sirna Delivery Yuen
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationDisclosure. This study was sponsored by Pfizer, Inc. All authors are employees of Pfizer, Inc. with ownership of stock in Pfizer, Inc.
Disclosure This study was sponsored by Pfizer, Inc. All authors are employees of Pfizer, Inc. with ownership of stock in Pfizer, Inc. Effects of 12 Weeks of Treatment with RN316 (PF-04950615), a Humanized
More informationLDL Uptake Cell-Based Assay Kit
LDL Uptake Cell-Based Assay Kit Item No. 10011125 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationPCSK9 inhibition across a wide spectrum of patients: One size fits all?
PCSK9 inhibition across a wide spectrum of patients: One size fits all? PACE ESC Barcelona 2017 G.K. Hovingh MD PhD MBA dept of vascular medicine Academic Medical Center the Netherlands g.k.hovingh@amc.uva.nl
More informationInclisiran lowers LDL-C and PCSK9 irrespective of diabetes status without worsening glycemia
ORION-1 Trial Inclisiran lowers LDL-C and PCSK9 irrespective of diabetes status without worsening glycemia Lawrence A Leiter, MD, FRCPC, FACP, FACE, FAHA St Michael s Hospital, Toronto 1 Presented on behalf
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationLDL Uptake Flow Cytometry Assay Kit
LDL Uptake Flow Cytometry Assay Kit Item No. 601470 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
More informationUNIVERSITA DI PISA CHIMICA E TECNOLOGIE FARMACEUTICHE FAMILIAL HYPERCHOLESTEROLEMIA DIPARTIMENTO DI FARMACIA GENETIC CAUSES AND THERAPY
UNIVERSITA DI PISA DIPARTIMENTO DI FARMACIA CHIMICA E TECNOLOGIE FARMACEUTICHE CORSO DI BASI BIOCHIMICHE DELL AZIONE DEI FARMACI FAMILIAL HYPERCHOLESTEROLEMIA GENETIC CAUSES AND THERAPY ERIKA ROSARIA PACCIOLLA
More informationDicerna Pharmaceuticals Overview. Delivering RNAi-Based Breakthrough Therapies
Pharmaceuticals Overview Delivering RNAi-Based Breakthrough Therapies Forward-Looking Statements This information may contain projections and other forward looking statements regarding future events, including
More informationThe Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia
The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano
More informationCurrent Challenges in CardioMetabolic Testing. Kenneth French, Director of Clinical Operations
Current Challenges in CardioMetabolic Testing Kenneth French, Director of Clinical Operations Disclosers Employee at VAP Diagnostics Laboratory Outline Cardiometabolic Disease: Current Challenges and Methodology
More informationAAOCS 10 th Biennial Conference Barossa Valley, September Presenter: Petter-Arnt Hals MSc PhD Co-authors: Nils Hoem, Xiaoli Wang, Yong-Fu Xiao
Effects of a purified, omega-3 rich krill oil phospholipid on cardiovascular disease risk factors and fatty acid composition of erythrocyte membranes in non-human primates AAOCS 10 th Biennial Conference
More informationModern Lipid Management:
Modern Lipid Management: New Drugs, New Targets, New Hope Kirk U. Knowlton, M.D Director of Cardiovascular Research Co Chief of Cardiology Why lower LDL C in those without evidence of CAD (primary prevention)
More informationEvaluation of Lipid Profile In Liver Cancer
Evaluation of Lipid Profile In Liver Cancer O.C Ojo * and M.F Asaolu Department of Biochemistry, Ekiti State University, Ado-Ekiti, Nigeria *e-mail: talkojotj@yahoo.com Abstract The lipid profile of ten
More informationTest Definition: FNMR2 NMR LipoProfile w/ir Markers
Reporting Title: Performing Location: Labcorp Burlington Specimen Requirements: Submit only one of the following specimens: Serum Draw blood in a plain red-top tube(s). (Serum gel tube is not acceptable.)
More informationSupplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
More informationRational design of cationic lipids for sirna delivery
ational design of cationic lipids for sina delivery Sean C Semple 1,6, Akin Akinc 2,6, Jianxin Chen 1,5, Ammen P Sandhu 1, Barbara L Mui 1,5, Connie K Cho 1, Dinah W Y Sah 2, Derrick Stebbing 1, Erin J
More informationPCSK9 and its Role in LDL Receptor Regulation Muscat, Oman - 9 February 2019
PCSK9 and its Role in LDL Receptor Regulation Muscat, Oman - 9 February 2019 Professor Gilles Lambert, PhD LaboratoireInserm U1188 Universitéde la Réunion Faculté de Médecine Saint Denis de la Réunion,
More informationMipomersen (ISIS ) Page 2 of 1979 Clinical Study Report ISIS CS3
(ISIS 301012) Page 2 of 1979 2 SYNOPSIS ISIS 301012-CS3 synopsis Page 1 Title of Study: A Phase 2, Randomized, Double-Blind, Placebo-Controlled Study to Assess the Safety, Tolerability, Pharmacokinetics,
More informationImpact of a 1- or 2-dose starting regimen of inclisiran, a novel sirna inhibitor to PCSK9 on time averaged LDL-C reductions over 1 year
ORION-1 Impact of a 1- or 2-dose starting regimen of inclisiran, a novel sirna inhibitor to PCSK9 on time averaged LDL-C reductions over 1 year Kausik K Ray, Ulf Landmesser, Lawrence A Leiter, David Kallend,
More informationClinical Policy: Lomitapide (Juxtapid) Reference Number: ERX.SPA.170 Effective Date:
Clinical Policy: (Juxtapid) Reference Number: ERX.SPA.170 Effective Date: 01.11.17 Last Review Date: 11.17 Revision Log See Important Reminder at the end of this policy for important regulatory and legal
More informationNovel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation:
Novel Approach to the Potential Treatment of Patients with B-Cell Lymphomas Harboring the MYD88 L265P Mutation: Combination Treatment with TLR Antagonist and Rituximab D. Wang, W. Jiang, T. Sullivan, L.
More informationRNAi Roundtable: ALN-PCSsc for the Treatment of Hypercholesterolemia. August 14, 2014
RNAi Roundtable: ALN-PCSsc for the Treatment of Hypercholesterolemia August 14, 2014 Welcome Cynthia Clayton Vice President, Investor Relations and Corporate Communications Introduction Akshay Vaishnaw,
More informationNYSE AMER: MTNB. MAT9001 OVERVIEW. September 2018
NYSE AMER: MTNB www.matinasbiopharma.com MAT9001 OVERVIEW September 2018 1 Forward Looking Statement This presentation contains "forward-looking statements" within the meaning of the Private Securities
More informationNovel HDL Targeted Therapies: The Search Continues Assoc. Prof. K.Kostner,, Univ. of Qld, Brisbane
Novel HDL Targeted Therapies: The Search Continues Assoc. Prof. K.Kostner,, Univ. of Qld, Brisbane Kostner, 2007 2008 LDL Target depends on your level of Risk Acute Plaque Rupture ACS (UA/NSTEMI/STEMI)
More informationSeparation of HDL Particles by Immunoprecipitation
Sun Diagnostics, LLC Separation of HDL Particles by Immunoprecipitation Rae-Anne Nguyen and John H. Contois 13 Introduction We all know that HDL cholesterol concentration is inversely associated with coronary
More informationSupplementary Figure 1
Supplementary Figure 1 Constitutive EGFR signaling does not activate canonical EGFR signals (a) U251EGFRInd cells with or without tetracycline exposure (24h, 1µg/ml) were treated with EGF for 15 minutes
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationAlirocumab Treatment Effect Did Not Differ Between Patients With and Without Low HDL-C or High Triglyceride Levels in Phase 3 trials
Alirocumab Treatment Effect Did Not Differ Between Patients With and Without Low HDL-C or High Triglyceride Levels in Phase 3 trials G. Kees Hovingh, 1 Richard Ceska, 2 Michael Louie, 3 Pascal Minini,
More information