Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points

Size: px
Start display at page:

Download "Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points"

Transcription

1 A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly modulated throughout the course of MERS CoV infec>on. B) Func>onal network analysis of 7 common kinases from the central intersec>on of (A). Network associated func>ons: Cellular movement, cell death and survival, cell cycle. Grey shading designates nodes that were conserved across all data sets. Non highlighted nodes were not found to be conserved across the data sets in this study but are predicted by IPA to form part of the pathway/network presented.

2 A. B. Supplementary Figure : Inhibitory Ac8vi8es of FDA Licensed Kinase Inhibitors Targe8ng ERK/MAPK or PIK/AKT Signaling Against MERS CoV Infec8on by Plaque Reduc8on Assay. Kinase inhibitors (0 μm) were added prior to ( hr) MERS CoV infec>on. Following infec>on and washing, media supplemented without (A) or with (B) fresh kinase inhibitors were added back to the cells. Results are presented as mean ± SD. The results represent three experimental repeats (mean ± SD, n=).

3 Supplemental Table : InnateDB Analysis of Temporal Kinome Datasets From MERS- CoV Infections A. Pathways modulated hr post-infection Upregulated Pathways: Pten dependent cell cycle arrest and apoptosis Focal adhesion Bacterial invasion of epithelial cells Direct p5 effectors Erk and pi- kinase are necessary for collagen binding in corneal epithelia Integrin signaling pathway Notch-mediated HES/HEY network Pathways in cancer AP- transcription factor network AndrogenReceptor Renal cell carcinoma EPHA forward signaling EPHB forward signaling HGF signaling pathway Hypoxia and p5 in the cardiovascular

4 system Integrin signaling pathway Nectin adhesion pathway Netrin-mediated signaling events PDGFR-alpha signaling pathway SHP signaling Vegf hypoxia and angiogenesis Signaling events mediated by Hepatocyte Growth Factor Receptor (c-met) Axon guidance Melanoma Wnt signaling pathway p75(ntr)-mediated signaling Fc-epsilon receptor I signaling in mast cells Regulation of actin cytoskeleton Amyotrophic lateral sclerosis (ALS) Ccr signaling in eosinophils Endocytosis Signaling events mediated by VEGFR and VEGFR

5 Down-Regulated Pathways: Glypican network The 4bb-dependent immune response Signal transduction through ilr Nfkb activation by nontypeable hemophilus influenzae ATR signaling pathway Regulation of Androgen receptor activity Tnf/stress related signaling Toll-like receptor pathway Keratinocyte differentiation TGF-beta signaling p5 pathway Cytokine-cytokine receptor interaction Osteoclast differentiation Chagas disease (American trypanosomiasis) IL- signaling pathway Toll-like receptor signaling pathway

6 B. Pathways modulated 6 hr post-infection Up-Regulated Pathways: Calcineurin-regulated NFAT-dependent transcription in lymphocytes GMCSF-mediated signaling events Beta integrin cell surface interactions Downstream signaling in naïve CD8+ T cells FOXM transcription factor network Trk receptor signaling mediated by the MAPK pathway Cytokine-cytokine receptor interaction Cyclins and cell cycle regulation Destabilization of mrna by KSRP Ras signaling in the CD4+ TCR pathway Down-Regulated Pathways: Downregulated of mta- in er-negative breast tumors 4

7 Adherens junction Calcium signaling pathway Stabilization and expansion of the E cadherin adherens junction Bacterial invasion of epithelial cells HGF signaling pathway Signaling mediated by p8-alpha and p beta SHP signaling Leptin C. Pathways modulated 4 hr post-infection Up-Regulated Pathways: Noncanonical Wnt signaling pathway Wnt Adherens junction MTOR signaling pathway Tight junction Wnt signaling pathway TGF-beta signaling pathway Tgf beta signaling pathway

8 Wnt signaling pathway Insulin receptor signaling Class I PIK signaling events mediated by Akt Regulation of nuclear SMAD/ signaling Down-Regulated Pathways: IL- signaling Leishmaniasis Stat signaling pathway p7 transcription factor network Interleukin-6 signaling Axon guidance Toxoplasmosis Regulation of actin dynamics for phagocytic cup formation Endogenous TLR signaling IL7-mediated signaling events IL ATM pathway Activation of Rac

9 IFN alpha signaling IL-0 signaling IL- signaling Il soluble receptor signaling pathway Interferon alpha/beta signaling Interferon gamma signaling No-dependent il- pathway in nk cells InnateDB is a publically available pathway analysis tool. Based on levels of differential expression or phosphorylation InnateDB is able to predict pathways that are consistent with the experimental data. Pathways are assigned a probability value (p) based on the number of proteins present for a particular pathway. It also provides the number of uploaded pathways associated with a particular pathway as well as the subset of individual proteins that are differentially phosphorylated. 8 9 Supplemental Table : Conserved Kinases Across all MERS-CoV Kinome Data Sets Molecule Name BRAF CHUK GNBL HIFA MET NFATC 7

10 PAK PIKR PRKAA SMAD STAT STMN VIM YWHAZ

Additional file 2 List of pathway from PID

Additional file 2 List of pathway from PID Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent

More information

Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers

Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation

More information

Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of

Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of 1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars

More information

# of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2. Pathway

# of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2. Pathway Supplementary Table 9. Pathways and biological processes associated with transcripts specific to SEB in both the pre- and post- RASP leukocytes (transcripts included in the Reactome Function Interaction

More information

Pathway Map Reference Guide

Pathway Map Reference Guide Pathway Map Reference Guide Focus Attention-grabber Your Pathway The most popular cell signaling pathways Sample & Assay Technologies Table of contents AKT Signaling 4 camp Signaling 5 Cellular Apoptosis

More information

Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia

Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia Supplementary Table 1. Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia Pathway Enrichment Score (-log10[p value]) p-value genes Glycosaminoglycan degradation

More information

Antigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS

Antigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS 1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009

T Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009 T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells

More information

Immune response to infection

Immune response to infection Immune response to infection Dr. Sandra Nitsche (Sandra.Nitsche@rub.de ) 20.06.2018 1 Course of acute infection Typical acute infection that is cleared by an adaptive immune reaction 1. invasion of pathogen

More information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information

Supplementary Material. Part I: Sample Information. Part II: Pathway Information Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

T Lymphocyte Activation and Costimulation. FOCiS. Lecture outline

T Lymphocyte Activation and Costimulation. FOCiS. Lecture outline 1 T Lymphocyte Activation and Costimulation Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline T cell activation Costimulation, the B7:CD28 family Inhibitory receptors of T cells Targeting costimulators for

More information

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt

Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt

More information

Lecture 7: Signaling Through Lymphocyte Receptors

Lecture 7: Signaling Through Lymphocyte Receptors Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

More information

GFP Assays

GFP Assays GFP Assays 2009-07-03 GFP Assays Akt1 SMAD2 STAT3 NFAT-C1 MAPKAP-k2 Rac-1 PLCδ PH domain FYVE G2M CCPM Cell survival, proliferation, apoptosis, insulin response pathways TGF-beta signalling, growth, differentiation,

More information

Supplementary figures

Supplementary figures Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second

More information

Lecture 9: T-cell Mediated Immunity

Lecture 9: T-cell Mediated Immunity Lecture 9: T-cell Mediated Immunity Questions to Consider How do T cells know where to go? Questions to Consider How do T cells know where to go? How does antigen get targeted to a T cell expressing the

More information

Table S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in

More information

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Time course of immune response

Time course of immune response Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response

More information

T cell-mediated immunity

T cell-mediated immunity T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating

More information

The g c Family of Cytokines Prof. Warren J. Leonard M.D.

The g c Family of Cytokines Prof. Warren J. Leonard M.D. The Family of Cytokines Chief, Laboratory of Molecular Immunology Director, Immunology Center National Heart, Lung, and Blood Institute National Institutes of Health Department of Health and Human Services

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/7/303/303ra139/dc1 Supplementary Materials for Magnetic resonance image features identify glioblastoma phenotypic subtypes with distinct molecular

More information

Effector T Cells and

Effector T Cells and 1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New

More information

T Cell Activation, Costimulation and Regulation

T Cell Activation, Costimulation and Regulation 1 T Cell Activation, Costimulation and Regulation Abul K. Abbas, MD University of California San Francisco 2 Lecture outline T cell antigen recognition and activation Costimulation, the B7:CD28 family

More information

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

More information

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION

Scott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 11 T-Cell Activation, Differentiation, and Memory Copyright 2013 by W. H. Freeman and

More information

Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells

Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells ICI Basic Immunology course Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells Abul K. Abbas, MD UCSF Stages in the development of T cell responses: induction

More information

CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM

CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CD43: the molecule and its signaling capacities favors a Th1 differentiation pattern and contributes

More information

INTRACELLULAR SIGNALLING

INTRACELLULAR SIGNALLING INTRACELLULAR SIGNALLING R. Benacka,, MD, PhD Department of Pathophysiology Medical faculty, Safarik University 1. Long distance chemo A. Receptors without enzymatic activity c-amp IP3- dependent c-gmp/no

More information

IL-24 AND ITS ROLE IN WOUND HEALING

IL-24 AND ITS ROLE IN WOUND HEALING IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor

More information

The Antiviral Potential of ERK/MAPK and PI3K/AKT/mTOR Signaling Modulation for MERS-CoV Infection as Identified by Temporal Kinome Analysis

The Antiviral Potential of ERK/MAPK and PI3K/AKT/mTOR Signaling Modulation for MERS-CoV Infection as Identified by Temporal Kinome Analysis AAC Accepts, published online ahead of print on 8 December 2014 Antimicrob. Agents Chemother. doi:10.1128/aac.03659-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5

More information

TCR, MHC and coreceptors

TCR, MHC and coreceptors Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236

ulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236 Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine

More information

Eosinophils! 40! 30! 20! 10! 0! NS!

Eosinophils! 40! 30! 20! 10! 0! NS! A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the

More information

silent epidemic,. (WHO),

silent epidemic,. (WHO), Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining

More information

Diabetes Mellitus and Breast Cancer

Diabetes Mellitus and Breast Cancer Masur K, Thévenod F, Zänker KS (eds): Diabetes and Cancer. Epidemiological Evidence and Molecular Links. Front Diabetes. Basel, Karger, 2008, vol 19, pp 97 113 Diabetes Mellitus and Breast Cancer Ido Wolf

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach

Impact of NM23-M1 knock-out on metastatic potential of hepatocellular carcinoma: a transgenic approach Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical

More information

Intrinsic cellular defenses against virus infection

Intrinsic cellular defenses against virus infection Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Contents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX

Contents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX Contents Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX 1 General Aspects of Signal Transduction and Cancer Therapy 1 1.1 General Principles of Signal Transduction

More information

Disorders of Cell Growth & Neoplasia

Disorders of Cell Growth & Neoplasia General Pathology VPM 152 Disorders of Cell Growth & Neoplasia Lecture 3 Rate of growth, local invasion, and metastasis. Molecular basis of cancer (normal cell-cycle and cellular proliferation). Enrique

More information

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se

A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

JPEMS 2014 Basic Immunology module Activation and functions of T lymphocytes

JPEMS 2014 Basic Immunology module Activation and functions of T lymphocytes JPEMS 2014 Basic Immunology module Activation and functions of T lymphocytes Teacher: Pr. Régis Josien, Laboratoire d Immunologie, CHU Nantes Regis.Josien@univ-nantes.fr 1 An#gen recogni#on by T cells

More information

Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases

Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases 54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response

Central tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. Mechanisms of Immune Tolerance ACTIVATION (immunity) SUPPRESSION (tolerance)

More information

Mechanisms of Immune Tolerance

Mechanisms of Immune Tolerance Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. ACTIVATION (immunity) SUPPRESSION (tolerance) Autoimmunity Immunodeficiency

More information

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

More information

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells

Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard

More information

2013 W. H. Freeman and Company. 12 Signal Transduction

2013 W. H. Freeman and Company. 12 Signal Transduction 2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure

More information

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

More information

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9 Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis

More information

Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.

Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. (a) Characterization of c-independent SP8 cells. Stainings for maturation markers (top)

More information

Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy

Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy Chapter 11 (pages 429-460): Dynamics of Adaptive Immunity prepared by Kelly von Elten, Walter Reed National Military Medical Center,

More information

Structure and Function of Antigen Recognition Molecules

Structure and Function of Antigen Recognition Molecules MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and

More information

The Immune Response in Time and Space

The Immune Response in Time and Space The Immune Response in Time and Space Chapters 14 & 4 Sharon S. Evans, Ph.D. Department of Immunology 845-3421 sharon.evans@roswellpark.org September 18 & 23, 2014 Inflammation Inflammation Complex response

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.

Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

Chapter 11 CYTOKINES

Chapter 11 CYTOKINES Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune

More information

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY

ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through

More information

remember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with

remember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with بسم هللا الرحمن الرحيم The last lecture we discussed the antigen processing and presentation and antigen recognition then the activation by T lymphocyte and today we will continue with B cell recognition

More information

Supplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis

Supplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Supplementary Files Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Lei Xin 1 *, M.D., Jun Gao 1 *, Ph.D., Dan Wang 1 *, M.D., Jin-Huan Lin 1, M.D., Zhuan Liao 1,

More information

IMMUNOTHERAPY FOR CANCER A NEW HORIZON. Ekaterini Boleti MD, PhD, FRCP Consultant in Medical Oncology Royal Free London NHS Foundation Trust

IMMUNOTHERAPY FOR CANCER A NEW HORIZON. Ekaterini Boleti MD, PhD, FRCP Consultant in Medical Oncology Royal Free London NHS Foundation Trust IMMUNOTHERAPY FOR CANCER A NEW HORIZON Ekaterini Boleti MD, PhD, FRCP Consultant in Medical Oncology Royal Free London NHS Foundation Trust ASCO Names Advance of the Year: Cancer Immunotherapy No recent

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

Adaptive Immunity to Bacteria. T cell subsets

Adaptive Immunity to Bacteria. T cell subsets Adaptive Immunity to Bacteria Role of T cells in anti-bacterial host responses. Dr. C. Piccirillo Department of Microbiology & Immunology McGill University T cell subsets MHC I and II -restricted cells

More information

Distinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis

Distinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis Distinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis Gangwen Han,, Molly Kulesz-Martin, Xiao-Jing Wang J Clin Invest. 2005;115(7):1714-1723.

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

The role of microrna in metastatic processes of non-small cell lung carcinoma

The role of microrna in metastatic processes of non-small cell lung carcinoma The role of microrna in metastatic processes of non-small cell lung carcinoma Zuzana Pastorkova a, Jozef Skarda a, Jozef Andel b Background. MicroRNAs are small non-coding one-stranded RNA molecules that

More information

Biobehavioral Pathways in Epithelial Ovarian Cancer

Biobehavioral Pathways in Epithelial Ovarian Cancer Biobehavioral Pathways in Epithelial Ovarian Cancer Susan K. Lutgendorf, Ph.D. Departments of Psychology, Obstetrics and Gynecology, and Urology and Holden Comprehensive Cancer Center University of Iowa

More information

Innate Immunity: (I) Molecules & (II) Cells. Part II: Cells (aka the Sentinels)

Innate Immunity: (I) Molecules & (II) Cells. Part II: Cells (aka the Sentinels) Innate Immunity: (I) Molecules & (II) Cells Stephanie Eisenbarth, M.D., Ph.D. FOCIS Advanced Course 2/19/18 Department of Laboratory Medicine Yale School of Medicine Department of Immunobiology Yale School

More information

OncoMir Library Cancer Type Target Gene

OncoMir Library Cancer Type Target Gene OncoMir Library Cancer Type Target Gene hsa-let-7a-1 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-2 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-3 Breast Cancer, Lung

More information

Chapter 13: Cytokines

Chapter 13: Cytokines Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or

More information

Future outlooks in NET: The pathologists point of view. Aurel Perren, Institute of Pathology University of Bern

Future outlooks in NET: The pathologists point of view. Aurel Perren, Institute of Pathology University of Bern Future outlooks in NET: The pathologists point of view Aurel Perren, Institute of Pathology University of Bern ESMO Preceptorship on GI neuroendocrine tumors (NETs) Leuven, November 2014 Near Future >

More information

1. Overview of Adaptive Immunity

1. Overview of Adaptive Immunity Chapter 17A: Adaptive Immunity Part I 1. Overview of Adaptive Immunity 2. T and B Cell Production 3. Antigens & Antigen Presentation 4. Helper T cells 1. Overview of Adaptive Immunity The Nature of Adaptive

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

DNA vaccine, peripheral T-cell tolerance modulation 185

DNA vaccine, peripheral T-cell tolerance modulation 185 Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory

More information

Kevin R. Fox, MD Rena Rowan Breast Center Abramson Cancer Center University of Pennsylvania Perelman School of MedicineR

Kevin R. Fox, MD Rena Rowan Breast Center Abramson Cancer Center University of Pennsylvania Perelman School of MedicineR Kevin R. Fox, MD Rena Rowan Breast Center Abramson Cancer Center University of Pennsylvania Perelman School of MedicineR Treatment of early stage, HER2 positive breast cancer Treatment of early stage,

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

PI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program:

PI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program: PI3K Background The phosphatidylinositol 3-kinase (PI3K) pathway is a key cell signaling node whose dysregulation commonly results in the transformation of normal cells into cancer cells. The role of PI3K

More information

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer

Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1

More information

Immunology MIMM-314 MID-TERM II EXAMINATION. 1 hour between 8:30 a.m. - 10:00 a.m. McIntyre Medical Rm 504 (Martin Amphitheatre)

Immunology MIMM-314 MID-TERM II EXAMINATION. 1 hour between 8:30 a.m. - 10:00 a.m. McIntyre Medical Rm 504 (Martin Amphitheatre) GROUP (Version) 1 Annotated version April 8, 2011, RGEP DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY Immunology MIMM-314 MID-TERM II EXAMINATION Course Coordinator: Dr. Roger Palfree Date: Thursday, March

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information