Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
|
|
- James Bridges
- 6 years ago
- Views:
Transcription
1 A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly modulated throughout the course of MERS CoV infec>on. B) Func>onal network analysis of 7 common kinases from the central intersec>on of (A). Network associated func>ons: Cellular movement, cell death and survival, cell cycle. Grey shading designates nodes that were conserved across all data sets. Non highlighted nodes were not found to be conserved across the data sets in this study but are predicted by IPA to form part of the pathway/network presented.
2 A. B. Supplementary Figure : Inhibitory Ac8vi8es of FDA Licensed Kinase Inhibitors Targe8ng ERK/MAPK or PIK/AKT Signaling Against MERS CoV Infec8on by Plaque Reduc8on Assay. Kinase inhibitors (0 μm) were added prior to ( hr) MERS CoV infec>on. Following infec>on and washing, media supplemented without (A) or with (B) fresh kinase inhibitors were added back to the cells. Results are presented as mean ± SD. The results represent three experimental repeats (mean ± SD, n=).
3 Supplemental Table : InnateDB Analysis of Temporal Kinome Datasets From MERS- CoV Infections A. Pathways modulated hr post-infection Upregulated Pathways: Pten dependent cell cycle arrest and apoptosis Focal adhesion Bacterial invasion of epithelial cells Direct p5 effectors Erk and pi- kinase are necessary for collagen binding in corneal epithelia Integrin signaling pathway Notch-mediated HES/HEY network Pathways in cancer AP- transcription factor network AndrogenReceptor Renal cell carcinoma EPHA forward signaling EPHB forward signaling HGF signaling pathway Hypoxia and p5 in the cardiovascular
4 system Integrin signaling pathway Nectin adhesion pathway Netrin-mediated signaling events PDGFR-alpha signaling pathway SHP signaling Vegf hypoxia and angiogenesis Signaling events mediated by Hepatocyte Growth Factor Receptor (c-met) Axon guidance Melanoma Wnt signaling pathway p75(ntr)-mediated signaling Fc-epsilon receptor I signaling in mast cells Regulation of actin cytoskeleton Amyotrophic lateral sclerosis (ALS) Ccr signaling in eosinophils Endocytosis Signaling events mediated by VEGFR and VEGFR
5 Down-Regulated Pathways: Glypican network The 4bb-dependent immune response Signal transduction through ilr Nfkb activation by nontypeable hemophilus influenzae ATR signaling pathway Regulation of Androgen receptor activity Tnf/stress related signaling Toll-like receptor pathway Keratinocyte differentiation TGF-beta signaling p5 pathway Cytokine-cytokine receptor interaction Osteoclast differentiation Chagas disease (American trypanosomiasis) IL- signaling pathway Toll-like receptor signaling pathway
6 B. Pathways modulated 6 hr post-infection Up-Regulated Pathways: Calcineurin-regulated NFAT-dependent transcription in lymphocytes GMCSF-mediated signaling events Beta integrin cell surface interactions Downstream signaling in naïve CD8+ T cells FOXM transcription factor network Trk receptor signaling mediated by the MAPK pathway Cytokine-cytokine receptor interaction Cyclins and cell cycle regulation Destabilization of mrna by KSRP Ras signaling in the CD4+ TCR pathway Down-Regulated Pathways: Downregulated of mta- in er-negative breast tumors 4
7 Adherens junction Calcium signaling pathway Stabilization and expansion of the E cadherin adherens junction Bacterial invasion of epithelial cells HGF signaling pathway Signaling mediated by p8-alpha and p beta SHP signaling Leptin C. Pathways modulated 4 hr post-infection Up-Regulated Pathways: Noncanonical Wnt signaling pathway Wnt Adherens junction MTOR signaling pathway Tight junction Wnt signaling pathway TGF-beta signaling pathway Tgf beta signaling pathway
8 Wnt signaling pathway Insulin receptor signaling Class I PIK signaling events mediated by Akt Regulation of nuclear SMAD/ signaling Down-Regulated Pathways: IL- signaling Leishmaniasis Stat signaling pathway p7 transcription factor network Interleukin-6 signaling Axon guidance Toxoplasmosis Regulation of actin dynamics for phagocytic cup formation Endogenous TLR signaling IL7-mediated signaling events IL ATM pathway Activation of Rac
9 IFN alpha signaling IL-0 signaling IL- signaling Il soluble receptor signaling pathway Interferon alpha/beta signaling Interferon gamma signaling No-dependent il- pathway in nk cells InnateDB is a publically available pathway analysis tool. Based on levels of differential expression or phosphorylation InnateDB is able to predict pathways that are consistent with the experimental data. Pathways are assigned a probability value (p) based on the number of proteins present for a particular pathway. It also provides the number of uploaded pathways associated with a particular pathway as well as the subset of individual proteins that are differentially phosphorylated. 8 9 Supplemental Table : Conserved Kinases Across all MERS-CoV Kinome Data Sets Molecule Name BRAF CHUK GNBL HIFA MET NFATC 7
10 PAK PIKR PRKAA SMAD STAT STMN VIM YWHAZ
Additional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
More informationTable S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers
Table S7B- Biocarta functional annotation of celecoxib-modulated genes unique to COX-2 expressers ListHits ListTotal PopulationHits PopulationTotal Terms 3 72 10 1429 Glycolysis Pathway 3 72 11 1429 Regulation
More informationLate regulation of immune genes and micrornas in circulating leukocytes in a pig model of
1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars
More information# of transcr ipts FDR q- value transcripts PGF,CTNNB1,AKT2,FARP2,VEGFB,PDGFRA,DRD 2,CSF1,CDH1,ITGB1,SRC,KRAS,RASGRP3,MAP2. Pathway
Supplementary Table 9. Pathways and biological processes associated with transcripts specific to SEB in both the pre- and post- RASP leukocytes (transcripts included in the Reactome Function Interaction
More informationPathway Map Reference Guide
Pathway Map Reference Guide Focus Attention-grabber Your Pathway The most popular cell signaling pathways Sample & Assay Technologies Table of contents AKT Signaling 4 camp Signaling 5 Cellular Apoptosis
More informationPathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia
Supplementary Table 1. Pathways of changes in hypermethylation in F1 offspring exposed to intrauterine hyperglycemia Pathway Enrichment Score (-log10[p value]) p-value genes Glycosaminoglycan degradation
More informationAntigen Presentation and T Lymphocyte Activation. Abul K. Abbas UCSF. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Abul K. Abbas UCSF FOCiS 2 Lecture outline Dendritic cells and antigen presentation The role of the MHC T cell activation Costimulation, the B7:CD28 family
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009
T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells
More informationImmune response to infection
Immune response to infection Dr. Sandra Nitsche (Sandra.Nitsche@rub.de ) 20.06.2018 1 Course of acute infection Typical acute infection that is cleared by an adaptive immune reaction 1. invasion of pathogen
More informationSupplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationT Lymphocyte Activation and Costimulation. FOCiS. Lecture outline
1 T Lymphocyte Activation and Costimulation Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline T cell activation Costimulation, the B7:CD28 family Inhibitory receptors of T cells Targeting costimulators for
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationLecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationGFP Assays
GFP Assays 2009-07-03 GFP Assays Akt1 SMAD2 STAT3 NFAT-C1 MAPKAP-k2 Rac-1 PLCδ PH domain FYVE G2M CCPM Cell survival, proliferation, apoptosis, insulin response pathways TGF-beta signalling, growth, differentiation,
More informationSupplementary figures
Supplementary figures Supplementary figure 1: Pathway enrichment for each comparison. The first column shows enrichment with differentially expressed genes between the diet groups at t = 0, the second
More informationLecture 9: T-cell Mediated Immunity
Lecture 9: T-cell Mediated Immunity Questions to Consider How do T cells know where to go? Questions to Consider How do T cells know where to go? How does antigen get targeted to a T cell expressing the
More informationTable S1. Metadata for transcriptome interaction network and pathway analysis of 5448 intracelluarly infected TEpi cells in comparison to mock TEpi cells. Gene symbol Full name Log2FC gene expression in
More informationFollicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy
More informationCHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.
More informationTime course of immune response
Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response
More informationT cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
More informationThe g c Family of Cytokines Prof. Warren J. Leonard M.D.
The Family of Cytokines Chief, Laboratory of Molecular Immunology Director, Immunology Center National Heart, Lung, and Blood Institute National Institutes of Health Department of Health and Human Services
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/7/303/303ra139/dc1 Supplementary Materials for Magnetic resonance image features identify glioblastoma phenotypic subtypes with distinct molecular
More informationEffector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
More informationT Cell Activation, Costimulation and Regulation
1 T Cell Activation, Costimulation and Regulation Abul K. Abbas, MD University of California San Francisco 2 Lecture outline T cell antigen recognition and activation Costimulation, the B7:CD28 family
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationScott Abrams, Ph.D. Professor of Oncology, x4375 Kuby Immunology SEVENTH EDITION
Scott Abrams, Ph.D. Professor of Oncology, x4375 scott.abrams@roswellpark.org Kuby Immunology SEVENTH EDITION CHAPTER 11 T-Cell Activation, Differentiation, and Memory Copyright 2013 by W. H. Freeman and
More informationEffector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells
ICI Basic Immunology course Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells Abul K. Abbas, MD UCSF Stages in the development of T cell responses: induction
More informationCAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM
CAN THE CD43 MOLECULE BE CONSIDERED AS A THERAPEUTIC TAGET? Yvonne Rosenstein Instituto de Biotecnologia, UNAM CD43: the molecule and its signaling capacities favors a Th1 differentiation pattern and contributes
More informationINTRACELLULAR SIGNALLING
INTRACELLULAR SIGNALLING R. Benacka,, MD, PhD Department of Pathophysiology Medical faculty, Safarik University 1. Long distance chemo A. Receptors without enzymatic activity c-amp IP3- dependent c-gmp/no
More informationIL-24 AND ITS ROLE IN WOUND HEALING
IL-24 AND ITS ROLE IN WOUND HEALING Nancy J. Poindexter, Ryan Williams, Garth Powis, Sunil Chada, and Elizabeth A. Grimm & Introgen Therapeutics, Inc., Houston, TX IL-24/MDA 24/MDA-77 is a Tumor Suppressor
More informationThe Antiviral Potential of ERK/MAPK and PI3K/AKT/mTOR Signaling Modulation for MERS-CoV Infection as Identified by Temporal Kinome Analysis
AAC Accepts, published online ahead of print on 8 December 2014 Antimicrob. Agents Chemother. doi:10.1128/aac.03659-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5
More informationTCR, MHC and coreceptors
Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationEosinophils! 40! 30! 20! 10! 0! NS!
A Macrophages Lymphocytes Eosinophils Neutrophils Percentage (%) 1 ** 4 * 1 1 MMA SA B C Baseline FEV1, % predicted 15 p = 1.11 X 10-9 5 CD4:CD8 ratio 1 Supplemental Figure 1. Cellular infiltrate in the
More informationsilent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
More informationDiabetes Mellitus and Breast Cancer
Masur K, Thévenod F, Zänker KS (eds): Diabetes and Cancer. Epidemiological Evidence and Molecular Links. Front Diabetes. Basel, Karger, 2008, vol 19, pp 97 113 Diabetes Mellitus and Breast Cancer Ido Wolf
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationImpact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationContents. Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX
Contents Preface XV Acknowledgments XXI List of Abbreviations XXIII About the Companion Website XXIX 1 General Aspects of Signal Transduction and Cancer Therapy 1 1.1 General Principles of Signal Transduction
More informationDisorders of Cell Growth & Neoplasia
General Pathology VPM 152 Disorders of Cell Growth & Neoplasia Lecture 3 Rate of growth, local invasion, and metastasis. Molecular basis of cancer (normal cell-cycle and cellular proliferation). Enrique
More informationA particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationJPEMS 2014 Basic Immunology module Activation and functions of T lymphocytes
JPEMS 2014 Basic Immunology module Activation and functions of T lymphocytes Teacher: Pr. Régis Josien, Laboratoire d Immunologie, CHU Nantes Regis.Josien@univ-nantes.fr 1 An#gen recogni#on by T cells
More informationInterleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases
54 Review Article Interleukin-6; pathogenesis and treatment of autoimmune inflammatory diseases Toshio Tanaka 1, 2), Masashi Narazaki 3), Kazuya Masuda 4) and Tadamitsu Kishimoto 4, ) 1) Department of
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationAdaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,
Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development
More informationCentral tolerance. Mechanisms of Immune Tolerance. Regulation of the T cell response
Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. Mechanisms of Immune Tolerance ACTIVATION (immunity) SUPPRESSION (tolerance)
More informationMechanisms of Immune Tolerance
Immunoregulation: A balance between activation and suppression that achieves an efficient immune response without damaging the host. ACTIVATION (immunity) SUPPRESSION (tolerance) Autoimmunity Immunodeficiency
More informationDeregulation of signal transduction and cell cycle in Cancer
Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324
More informationImmunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
More information2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
More informationTHE HALLMARKS OF CANCER
THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated
More informationAbnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9
Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis
More informationSupplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.
Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression. (a) Characterization of c-independent SP8 cells. Stainings for maturation markers (top)
More informationReview Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy
Review Questions: Janeway s Immunobiology 8th Edition by Kenneth Murphy Chapter 11 (pages 429-460): Dynamics of Adaptive Immunity prepared by Kelly von Elten, Walter Reed National Military Medical Center,
More informationStructure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
More informationThe Immune Response in Time and Space
The Immune Response in Time and Space Chapters 14 & 4 Sharon S. Evans, Ph.D. Department of Immunology 845-3421 sharon.evans@roswellpark.org September 18 & 23, 2014 Inflammation Inflammation Complex response
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationThe mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge
The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More informationAllergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD.
Allergy and Immunology Review Corner: Chapter 13 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti, MD. Chapter 13: Mechanisms of Immunity to Viral Disease Prepared by
More informationT cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
More informationChapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
More informationACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through
More informationremember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with
بسم هللا الرحمن الرحيم The last lecture we discussed the antigen processing and presentation and antigen recognition then the activation by T lymphocyte and today we will continue with B cell recognition
More informationSupplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis
Supplementary Files Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Lei Xin 1 *, M.D., Jun Gao 1 *, Ph.D., Dan Wang 1 *, M.D., Jin-Huan Lin 1, M.D., Zhuan Liao 1,
More informationIMMUNOTHERAPY FOR CANCER A NEW HORIZON. Ekaterini Boleti MD, PhD, FRCP Consultant in Medical Oncology Royal Free London NHS Foundation Trust
IMMUNOTHERAPY FOR CANCER A NEW HORIZON Ekaterini Boleti MD, PhD, FRCP Consultant in Medical Oncology Royal Free London NHS Foundation Trust ASCO Names Advance of the Year: Cancer Immunotherapy No recent
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationAdaptive Immunity to Bacteria. T cell subsets
Adaptive Immunity to Bacteria Role of T cells in anti-bacterial host responses. Dr. C. Piccirillo Department of Microbiology & Immunology McGill University T cell subsets MHC I and II -restricted cells
More informationDistinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis
Distinct mechanisms of TGF-b1 mediated epithelial-to-mesenchymal transition and metastasis during skin carcinogenesis Gangwen Han,, Molly Kulesz-Martin, Xiao-Jing Wang J Clin Invest. 2005;115(7):1714-1723.
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationThe role of microrna in metastatic processes of non-small cell lung carcinoma
The role of microrna in metastatic processes of non-small cell lung carcinoma Zuzana Pastorkova a, Jozef Skarda a, Jozef Andel b Background. MicroRNAs are small non-coding one-stranded RNA molecules that
More informationBiobehavioral Pathways in Epithelial Ovarian Cancer
Biobehavioral Pathways in Epithelial Ovarian Cancer Susan K. Lutgendorf, Ph.D. Departments of Psychology, Obstetrics and Gynecology, and Urology and Holden Comprehensive Cancer Center University of Iowa
More informationInnate Immunity: (I) Molecules & (II) Cells. Part II: Cells (aka the Sentinels)
Innate Immunity: (I) Molecules & (II) Cells Stephanie Eisenbarth, M.D., Ph.D. FOCIS Advanced Course 2/19/18 Department of Laboratory Medicine Yale School of Medicine Department of Immunobiology Yale School
More informationOncoMir Library Cancer Type Target Gene
OncoMir Library Cancer Type Target Gene hsa-let-7a-1 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-2 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-3 Breast Cancer, Lung
More informationChapter 13: Cytokines
Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or
More informationFuture outlooks in NET: The pathologists point of view. Aurel Perren, Institute of Pathology University of Bern
Future outlooks in NET: The pathologists point of view Aurel Perren, Institute of Pathology University of Bern ESMO Preceptorship on GI neuroendocrine tumors (NETs) Leuven, November 2014 Near Future >
More information1. Overview of Adaptive Immunity
Chapter 17A: Adaptive Immunity Part I 1. Overview of Adaptive Immunity 2. T and B Cell Production 3. Antigens & Antigen Presentation 4. Helper T cells 1. Overview of Adaptive Immunity The Nature of Adaptive
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationDNA vaccine, peripheral T-cell tolerance modulation 185
Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory
More informationKevin R. Fox, MD Rena Rowan Breast Center Abramson Cancer Center University of Pennsylvania Perelman School of MedicineR
Kevin R. Fox, MD Rena Rowan Breast Center Abramson Cancer Center University of Pennsylvania Perelman School of MedicineR Treatment of early stage, HER2 positive breast cancer Treatment of early stage,
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationPI3K Background. The SignalRx R & D pipeline is shown below followed by a brief description of each program:
PI3K Background The phosphatidylinositol 3-kinase (PI3K) pathway is a key cell signaling node whose dysregulation commonly results in the transformation of normal cells into cancer cells. The role of PI3K
More informationEpstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
More informationImmunology MIMM-314 MID-TERM II EXAMINATION. 1 hour between 8:30 a.m. - 10:00 a.m. McIntyre Medical Rm 504 (Martin Amphitheatre)
GROUP (Version) 1 Annotated version April 8, 2011, RGEP DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY Immunology MIMM-314 MID-TERM II EXAMINATION Course Coordinator: Dr. Roger Palfree Date: Thursday, March
More informationT Cell Effector Mechanisms I: B cell Help & DTH
T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide
More information