Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
|
|
- Percival Dawson
- 6 years ago
- Views:
Transcription
1 Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC GGTATGGAATCAACCCGTTGTC Aco GCCCAACTGTGACTTCCATT GGCATGTAACCCGTAGCACT Agpat1 CACCCAGGATGTGAGAGTCTG CTGACAACGTCCAGGCGAGG Sqle CGCGCAGCGGTTACTCTGGT AGTCACGGCCGGGAACCTGT Mtp TGCGGGTCAACAGAGAGGCG CCTTGACCTTCCCCCGGACCA Gpat4 GGCAGAGGAGCTGGAGTC TGTTGTGGTACGTAATGATGG Dgat2 AGTGGCAATGCTATCATCATCGT AAGGAATAAGTGGGAACCAGATCA Fas GCTGCGGAAACTTCAGGAAAT AGAGACGTGTCACTCCTGGACTT Hmgcs GCCGTGAACTGGGTCGAA GCATATATAGCAATGTCTCCTGCAA Scd1 CCGGAGACCCCTTAGATCGA TAGCCTGTAAAAGATTTCTGCAACC Lipin1 GGTCCCCCAGCCCCAGTCCTT GCAGCCTGTGGCAATTCA Lipin2 AGTTGACCCCATCACCGTAG CCCAAAGCATCAGACTTGGT Srebp1 AGCAGCCCCTAGAACAAACAC CAGCAGTGAGTCTGCCTTGAT Srebp2 TGAAGGACTTAGTCATGGGGAC CGCAGCTTGTGATTGACCT ApoCIII AGGTACGTAGGTGCCATGC CGTCTTGGAGGCTTGTTCCA Pcsk9 CAGAGGTCATCACAGTCGGG GGGGCAAAGAGATCCACACA Hrpt TGACACTGGTAAAACAATGC AACACTTCGAGAGGTCCTTT Hmgcoar, 3-hydroxy-3-methylglutaryl coenzyme A reductase; Cyp7α, cholesterol 7alpha-hydroxylase; Cyp27a1, sterol 27-hydroxylase; Aco, Acyl coa carboxylase; Agpat1, 1-acylglycerol-3-phosphate O-acyltransferase; Sqle, Squalene monooxygenase; Mtp, Microsomal Triglyceride Transfer Protein; Gpat, Glycerol-3- phosphate acyltransferase; Dgat, Diacylglycerol acyltransferase; Fas, Fatty acid synthase; Hmgcs, HMGcoA synthase; Scd1, Stearoyl-coA desaturase-1; Srebp, Sterol regulatory element binding protein; Apo, apolipoprotein; Pcsk9, Proprotein Convertase Subtilisin/kexin type 9 ;Hrpt, Hypoxanthine guanine phosphoribosyl transferase.
2 Supplement Table II: Effect of on major plasma lipid species in Ldlr -/- mice Plasma (nmol/ml) VLDL (nmol/apob) IDL/LDL (nmol/apob) Chol * CE ** DG # TG # PC *** Chol, cholesterol; CE, cholesteryl esters; DG, diacylglycerol; TG, triglyceride; PC, phosphatidyl choline. Lipid levels were determined by LC/MSMS. Data are presented as nmol/ml for plasma and expressed nmol lipid per apob content for VLDL and IDL/LDL fractions. ApoB content of VLDL and IDL/LDL particles was determined by Western blotting. Data is mean sem from 7-8 mice per group. # p<.5, *p<, **p<.1, ***p<.1 v ctrl.
3 Supplemental Table III: Lipidomics of VLDL and LDL in v -treated Ldlr -/- mice VLDL (nmol/apob) IDL/LDL (nmol/apob) Sphingomyelin Ceramide Dihydroceramide Monohexosylceramide Dihydrohexoceramide Trihexosylceramide G M3 ganglioside Lysophosphatidylcholine Lysoalkylphosphatyidylcholine Phosphatidylcholine Alkylphosphatidylcholine Alkenylphosphatidylcholine Lysophosphatidylethanolamine Phosphatidylethanolamine Alkylphosphatidylethanolamine Alkenylphosphatidylethanolamine Phosphatidylglycerol Lysophosphatidylinositol Phosphatidylinositol Phosphatidylserine Lipid levels were determined by LC/MSMS. Data are presented relative to apob content and represent mean sem from 7-8 mice per group.
4 Supplement Table IV: Lipidomics of SM species in VLDL and LDL in v -treated Ldlr -/- mice VLDL (nmol/pc) IDL/LDL (nmol/pc) SM 32:1 SM 33:1 SM 34:1 SM 34:2 SM 34:3 SM 36:1 SM 36:2 SM 36:3 SM 38:1 SM 38:2 SM 42:1 SM 31:1 SM 33:1 SM 35:1 SM 35:2 SM 37:2 SM 39:1 SM 41:1 SM 41: ** # * # * * * ** * *** * # ** * * * * * Levels of SM species were determined by LC/MSMS. Data is presented nmol per PC content and is mean sem from 7-8 mice per group. # p<.5, *p<, ** p<.1, ***p<.1.
5 Figure I A wt Ldlr-/- B wt Ldlr-/- C wt Ldlr-/- Figure I: does not induce liver or kidney toxicity. Wt and Ldlr -/- mice were treated with 2mg/kg/day or vehicle () for 4 weeks via subcutaneous implanted Alzet Osmotic minipumps. Formalin-perfused livers (A) and kidneys (B) were paraffin embedded and stained with hematoxylin/eosin. Kidney sections were also stained with Periodic acid-schiff stain (C). Tissue sections shown were viewed using a 2x objective. Scale bar = 2µm. No significant difference was
6 Figure II A B Blood glucose (mmol/l) AUC glucose (mmol/l x 12min) ** Time (min) Figure II: does not induce insulin resistance in LDLr -/- mice. LDLr -/- mice were treated with 2mg/kg/day or vehicle () for 4 weeks. Non-fasted insulin tolerance tests were performed as described in material and methods. (A) Blood glucose levels in response to i.p. injection of insulin and (B) Glucose area under the curve (AUC). Values are mean S.E.M. (n=1 per group). ** p<.
7 Figure III Hepatic mrna level (fold induction) Hmgcoar Fas Scd1 Srebp1 Srebp2 Figure III: does not affect hepatic mrna levels of genes involved in lipid synthesis. Wt mice were treated with 2mg/kg/day or vehicle () for 4 weeks. Hepatic mrna levels were determined by qpcr as described in Materials and Methods.
8 Figure IV VLDL particle size (nm) Figure IV: does not affect VLDL particle size in LDLr -/- mice. LDLr -/- mice were treated with 2mg/kg/day or vehicle () for 4 weeks. VLDL was isolated by density ultracentrifugation and VLDL particle size was determined using dynamic light scattering as described in Material and Methods.
9 Figure V wt Ldlr -/- [ 3 H] activity (% of injected dose) Liver Heart Spleen Kidney GonWAT ScWAT Muscle SolMuscle [ 3 H] activity (% of injected dose) Liver * Heart Spleen Kidney GonWAT ScWAT Muscle SolMuscle wt Ldlr -/- [ 14 C] activity (% of injected dose) Liver Heart Spleen Kidney GonWAT ScWAT Muscle SolMuscle Figure V: inhibits hepatic uptake of lipoprotein derived cholesteryl oleate in LDLr -/- mice. Wt and LDLr -/- mice were treated with 2 mg/kg/day or cremaphore vehicle () for 4 weeks. Mice were injected with VLDL-like particles, double-labeled with [ 3 H]TO and [ 14 C]CO. 3 H- and 14 C- uptake by organs and tissues were determined at 15 min for wt and 3 min for LDLr -/- after injection. Data are expressed as percentage 3 H- or 14 C-activity of the injected dose per total tissue, with the exception of kidney, white adipose tissue pads and muscle which were determined as uptake in 1 representative tissue. GonWAT, gonadal white adipose tissue, scwat, subcutaneous white adipose tissue. Values are mean S.E.M. (n=5-7 per group). * p<.5. [ 14 C] activity (% of injected dose) Liver * Heart Spleen Kidney GonWAT ScWAT Muscle SolMuscle
10 Figure VI Figure VI: Plasma PCSK9 levels are not increased by in wt mice Wt were treated with 2 mg/kg/day or vehicle () for 4 weeks. Plasma PSCK9 levels were determined by Western Blotting. A representative sample from Ldlr -/- mice is shown. No increase in PCSK9 was observed after treatment of wt mice.
Supplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationMetabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
More informationThe Addition of Ezetimibe to Statin therapy in. Patients with Homozygous Familial. Hypercholesterolaemia
The Addition of Ezetimibe to Statin therapy in Patients with Homozygous Familial Hypercholesterolaemia Submitted in fulfilment with the requirements for the degree Master in Medicine (MMed) Dr Adriano
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Triacylglycerol and Fatty Acid Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM II. Triacylglycerol synthesis A. Overall pathway Glycerol-3-phosphate + 3 Fatty acyl-coa à Triacylglycerol + 3 CoASH B. Enzymes 1. Acyl-CoA synthase 2. Glycerol-phosphate
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationZuhier Awan, MD, PhD, FRCPC
Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationJuxtapid. Juxtapid (lomitapide) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 Subject: Juxtapid Page: 1 of 6 Last Review Date: September 20, 2018 Juxtapid Description Juxtapid (lomitapide)
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationRegulating Hepatic Cellular Cholesterol
Under circumstances of cholesterol deficiency, Sterol Regulatory Element Binding Proteins (SREBPs) via binding to DNA nuclear response elements set off genomic production of proteins and enzymes that induce
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationLarge-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention
Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM The LDL Receptor, LDL Uptake, and the Free Cholesterol Pool
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM The, LDL Uptake, and the Free Cholesterol Pool I. Michael Brown and Joseph Goldstein A. Studied families with familial hypercholesterolemia. B. Defined the relationship
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationSUPPLEMENTARY,INFORMATIONS,,,, mtorc1,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD,!! Sébastien!M.!
SUPPLEMENTARY,INFORMATIONS,,,, mtorc,is,required,for,brown,adipose,tissue,recruitment,and, METABOLIC,ADAPTATION,TO,COLD, SébastienM.Labbé,,MathildeMouchiroud,,AlexandreCaron,,BlandineSecco,, Elizaveta
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationCompanion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes
Companion to Biosynthesis of Ketones & Cholesterols, Regulation of Lipid Metabolism Lecture Notes The major site of acetoacetate and 3-hydorxybutyrate production is in the liver. 3-hydorxybutyrate is the
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationPCs Acyl chain double bonds. PEs
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0 1 2
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationCholesterol Metabolism
Cholesterol Metabolism Lippincott s Illustrated Review Chapter 18 Steroid Nucleus 1 2 Cholesterol was isolated from gall bladder stones in 1774 3 Sources and Elimination of Cholesterol Synthesis: 1000
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationN-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP
Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA
More informationChapter VIII: Dr. Sameh Sarray Hlaoui
Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.
More informationEmerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids
Emerging science on omega-3: A lipidomic view of omega-3 in health and disease Peter Meikle 04 May 2017 Health benefits of omega 3 fatty acids Can lower plasma triacylglycerol can reduce the risk of metabolic
More informationPoly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1
Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species
More informationBringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health
Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive
More informationChapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids
Chapter 1 The Lipid Droplet: a Dynamic Organelle, not only Involved in the Storage and Turnover of Lipids Sven-Olof Olofsson, Pontus Boström, Jens Lagerstedt, Linda Andersson, Martin Adiels, Jeanna Perman,
More informationSUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients
SUPPLEMENTAL MATERIAL A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in diabetic patients Cubedo et al: ApoA-I truncated form in diabetes By Judit Cubedo a, Teresa Padró
More informationControl 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
More informationDigestion, absorption, and transport of dietary lipids
TG metabolism Utilization of dietary lipids Synthesis in liver and adipose tissue Fatty acid catabolism and synthesis Mobilization of TG to provide energetic needs β-oxidation of fatty acids De novo synthesis
More informationALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)
a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationSupplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna
Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationSupplemental Information. FGF19, FGF21, and an FGFR1/b-Klotho-Activating. Antibody Act on the Nervous System. to Regulate Body Weight and Glycemia
Cell Metabolism, Volume 26 Supplemental Information FGF19, FGF21, and an FGFR1/b-Klotho-Activating Antibody Act on the Nervous System to Regulate Body Weight and Glycemia Tian Lan, Donald A. Morgan, Kamal
More informationDisorders of Lipid Metabolism
CHAPTER 37 Disorders of Lipid Metabolism CLAY F. SEMENKOVICH ANNE C. GOLDBERG IRA J. GOLDBERG Lipid Biochemistry and Metabolism, 1660 Nuclear Receptors and Lipid Metabolism, 1665 Plasma Lipoproteins, Apolipoproteins,
More informationSphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity
Sphingolipid de novo synthesis: its relevance to metabolic diseases and cell polarity Xian-Cheng Jiang (shian-chen chiang) SUNY Downstate Medical Center Cell plasma membrane Lipid rafts Sphingolipid =
More informationChapter 16 - Lipid Metabolism
Chapter 16 - Lipid Metabolism Fatty acids have four major physiologic roles in the cell: Building blocks of phospholipids and glycolipids Added onto proteins to create lipoproteins, which targets them
More informationCholesterol and its transport. Alice Skoumalová
Cholesterol and its transport Alice Skoumalová 27 carbons Cholesterol - structure Cholesterol importance A stabilizing component of cell membranes A precursor of bile salts A precursor of steroid hormones
More informationChapter 21 Lipid Biosynthesis. 1. Fatty acids 2. Eicosanoids 3. Triacylglycerols 4. Membrane phospholipids 5. Cholesterol, steroids, and isoprenoids
Chapter 21 Lipid Biosynthesis 1. Fatty acids 2. Eicosanoids 3. Triacylglycerols 4. Membrane phospholipids 5. Cholesterol, steroids, and isoprenoids 1. Fatty acid synthesis takes a different pathway from
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationBlood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.
Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary
More informationHepatic insulin signaling regulates VLDL secretion and atherogenesis in mice
Hepatic insulin signaling regulates VLDL secretion and atherogenesis in mice Seongah Han,, Domenico Accili, Alan R. Tall J Clin Invest. 2009;119(4):1029-1041. https://doi.org/10.1172/jci36523. Research
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationSUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
More informationLipid Chemistry. Presented By. Ayman Elsamanoudy Salwa Abo El-khair
Lipid Chemistry Presented By Ayman Elsamanoudy Salwa Abo El-khair 4 Objectives: 1. By the end of this chapter the student should be able to: define lipids. describe the biological importance of lipids.
More informationKynamro. Kynamro (mipomersen) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.40.02 Subject: Kynamro Page: 1 of 5 Last Review Date: September 15, 2017 Kynamro Description Kynamro
More informationMetabolism of acylglycerols and sphingolipids. Martina Srbová
Metabolism of acylglycerols and sphingolipids Martina Srbová Types of glycerolipids and sphingolipids 1. Triacylglycerols function as energy reserves adipose tissue (storage of triacylglycerol), lipoproteins
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationChem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols
Chem 431A-L24-F'07 page 1 of 5 Chem 431A-L24-F 07 admin: Last time: We finished Chapt 7, started Chapt 10 FA s and TG s FA=fatty acid, TG=triglycerides or triacylglycerols (0) REVIEW: FA s are very reduced
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationPhospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
More informationBiochemistry, physiology, and genetics of GPAT, AGPAT, and lipin enzymes in triglyceride synthesis
Am J Physiol Endocrinol Metab 296: E1195 E1209, 2009. First published March 31, 2009; doi:10.1152/ajpendo.90958.2008. Biochemistry, physiology, and genetics of GPAT, AGPAT, and lipin enzymes in triglyceride
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationThematic review series: The Pathogenesis of Atherosclerosis
thematic review Thematic review series: The Pathogenesis of Atherosclerosis Effects of infection and inflammation on lipid and lipoprotein metabolism: mechanisms and consequences to the host 1 Weerapan
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationGROWTH HORMONE AND PPARα IN THE REGULATION OF GENES INVOLVED IN HEPATIC LIPID METABOLISM. Caroline Améen
GROWTH HORMONE AND PPARα IN THE REGULATION OF GENES INVOLVED IN HEPATIC LIPID METABOLISM Caroline Améen Department of Physiology and Wallenberg Laboratory for Cardiovascular Research Sahlgrenska Academy
More informationNovel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27
Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Ed O Brien, Jean-Claude Bakala-N Goma, Chunhua Shi Cumming School
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationAN OVERVIEW OF FATTY ACID ETHYL ESTERS
AN OVERVIEW OF FATTY ACID ETHYL ESTERS Michael Laposata, M.D., Ph.D. Director of Clinical Laboratories Massachusetts General Hospital Professor, Harvard Medical School OUTLINE OF PRESENTATION Background
More informationKSRP is critical in governing hepatic lipid metabolism
KSRP is critical in governing hepatic lipid metabolism through controlling Per2 expression Chu-Fang Chou, 1, * Xiaolin Zhu, 1, Yi-Yu Lin, * Karen L. Gamble, W. Timothy Garvey, and Ching-Yi Chen 2, * Department
More informationIs it really that simple? Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics
Alyssa Hasty, PhD Associate Professor Molecular Physiology and Biophysics Why we care about hepatic lipogenesis Control of lipid synthesis What can go wrong in humans Animal models dlto study lipoprotein
More informationOptimising. membranes
Optimising Neuronal membranes Lipids are classified as 1. Simple lipids oils and fats 2. Complex lipids a) Phospholipids b) Glycosphingolipids containing a fatty acid, sphingosine and a CHO c) Lipoproteins
More informationWILL ABSENCE OF GPAT1 IMPROVE DIET-INDUCED ATHEROSCLEROSIS IN APOE HETEROZYGOUS MICE? PEI-CHI WU
WILL ABSENCE OF GPAT1 IMPROVE DIET-INDUCED ATHEROSCLEROSIS IN APOE HETEROZYGOUS MICE? PEI-CHI WU A thesis submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment
More informationLipid Lowering in Patients at High Risk for Cardiovascular Disease
Lipid Lowering in Patients at High Risk for Cardiovascular Disease Prof. John J.P. Kastelein, MD PhD FESC Dept. of Vascular Medicine Academic Medical Center / University of Amsterdam The Netherlands Novel
More informationLipoprotein Formation, Structure and Metabolism: Cholesterol Balance and the Regulation of Plasma Lipid Levels
Lipoprotein Formation, Structure and Metabolism: Balance and the Regulation of Plasma Lipid Levels David E. Cohen, MD, PhD Director of Hepatology, Gastroenterology Division, Brigham and Women s Hospital
More informationLipid Metabolism in Familial Hypercholesterolemia
Lipid Metabolism in Familial Hypercholesterolemia Khalid Al-Rasadi, BSc, MD, FRCPC Head of Biochemistry Department, SQU Head of Lipid and LDL-Apheresis Unit, SQUH President of Oman society of Lipid & Atherosclerosis
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationPPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
More informationBiosynthesis of Fatty Acids
Biosynthesis of Fatty Acids Fatty acid biosynthesis takes place in the cytosol rather than the mitochondria and requires a different activation mechanism and different enzymes and coenzymes than fatty
More informationCellular control of cholesterol. Peter Takizawa Department of Cell Biology
Cellular control of cholesterol Peter Takizawa Department of Cell Biology Brief overview of cholesterol s biological role Regulation of cholesterol synthesis Dietary and cellular uptake of cholesterol
More information