SUPPLEMENTARY INFORMATION

Transcription

1 1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins, CD11b/integrin α M and CD18/integrin β 2, in the RAW264.7 murine monocytoid cell line. The expression of CD11b/integrin α M was increased to two-fold by the treatment of S1P, whereas that of CD18/integrin β 2 was slightly increased (~1.2 fold) only in the presence of high-dose of S1P (10-6 M). Error bars represent SEM (n = 3 for each). 1

2 Supplementary Fig. 2. Differentiation of CX 3 CR1-EGFP + and CSF1R-EGFP + cells into TRAP + mature osteoclasts. Femoral bone tissues of heterozygous CX 3 CR1-EGFP knock-in mice (a) and CSF1R-EGFP transgenic mice (b). Fluorescent images for EGFP (left panels), staining for TRAP (tartrate-resistant acid phosphatase) (middle panels), and overlay (with transmission image) (right panels). Scale bar represents 20 µm. 2

3 Supplementary Fig. 3. In vivo migratory behavior of CSF1R-EGFP positive cells in calvaria bone tissues visualized using intravital two-photon imaging. Summary of the mean velocities of CSF1R-EGFP positive cells, in the presence of vehicle (black boxes) or the S1P 1 agonist SEW2871 (5 mg/kg) (red circles). Data points (n = 211 for vehicle and n = 308 for SEW2871) represent individual cells compiled from 4 independent experiments. Intravital two-photon images of mouse skull bone tissues of CSF1R-EGFP transgenic mice in the absence or presence of SEW2871 are shown in Supplementary Videos 5 and 6, respectively. 3

4 Supplementary Fig. 4. Effect of SEW2871 on the composition of peripheral mononuclear cells (PMC). PMC collected from mice 1 hour after administration of vehicle (left panel in a) or SEW2871 (5 mg/kg) (right panel in a) were stained with anti-cd3 (PE-Cy7) and anti-cd11b (FITC). Cell counts are shown in b. V, vehicle; SEW, SEW2871; T, CD3 + T cell; Mo, CD11b + monocytoid cell. Error bars represent SEM (n = 3 for each). 4

5 Supplementary Fig. 5. Loss of S1P 1 expression in CD11b + myeloid cells in the cs1p -/- 1 mice. Conventional RT-PCR detection (a) and real-time quantitative PCR analysis (b) of S1P 1 mrna in total mononuclear cells (MNC) and MNCs sorted using CD11b-microbeads (Milteny Biotec), from wild-type and conditional (CD11b + lineage-specific) S1P 1 knockout (cs1p -/- 1 ) mice. Primers used for detecting S1P 1 (a) were the same ones used in Fig. 1 (the sequences are listed in Supplementary Table 4). c, Immunohistochemical analysis of S1P 1 in femoral -/- bone tissues from control and cs1p 1 mice. Staining for S1P 1 (green) was merged with transmission (Nomarski image). Scale bar represents 20 µm. 5

6 Supplementary Fig. 6. Histological examination combined with computational quantification for measuring osteoclast attachment ratio to the bone surface. Left panel, dual fluorescent imaging of bone trabeculae and osteoclasts with two-photon microscopy. Osteoclasts were visualized by fluorescence-based TRAP staining with ELF97 substrate (green) and bone trabeculae were detected by 2nd harmonic emission (cyan). Right panel, computational segmentation of the image (F. K., submitted). Blue areas represent bone trabeculae (2nd harmonic fluorescence signal) and red and green areas show TRAP-positive osteoclasts that are attached to or detached from bone trabeculae, respectively. Bone-osteoclast interfaces were automatically detected and are shown as white lines between the red and blue areas. 6

7 Supplementary Fig. 7. Absence of effects of S1P on RANKL-induced osteoclastogenesis in vitro. a, Representative images of osteoclast precursor RAW264.7 cultured for four days with RANKL (50 ng/ml) in the absence (left panel) or presence (10-8 M) (right panel) of S1P. Scale bar represents 50 µm. b, Number of nuclei within TRAP-positive multinucleated (more than 4 nuclei) cells per visual field. Error bars represent ± SEM (n = 5 for each). More than 1000 nuclei were counted in ten visual fields 7

8 Supplementary Fig. 8. Model of S1P-directed chemotaxis of osteoclast precursor monocytes. Before they can undergo terminal maturation on the bone surface, a subset of osteoclast precursors detaches and re-enters the blood circulation due to the presence of an S1P gradient. Treatment with S1P 1 agonists, such as SEW2871, further mobilize osteoclast precursors, leading to inhibition of osteoclastogenesis. RANKL signaling down-regulates the expression of S1P 1, inhibiting osteoclast precursor re-exit into the circulation, enhancing osteoclast maturation and function. 8

9 Supplementary Fig. 9. Effect of FTY720 on the composition of peripheral mononuclear cells (PBMC) and bone marrow cells (BM). PBMC (a) and BM cells (c) collected from the mice 4 hour after administration of vehicle or FTY720 (3 mg/kg) were stained with anti-cd3 (PE-Cy7) and anti-cd11b (FITC). The corresponding cell counts are shown in b and d. V, vehicle; FTY, FTY720; T, CD3 + T cell; Mo, CD11b + monocytes (in b). Error bars represent SEM (n = 3 for each). e, Immunofluorescent detection of F4/80 + monocytes (red) and B220 + B cells (green) in mouse femoral bone tissues treated with vehicle (left) or FTY720 (right). Nuclei were labeled with Hoechst (blue). Scale bars represent

10 µm. Corresponding cell counts are shown in f. FTY720 appears to act as a "functional agonist" that promotes exit of OP monocytes from bone marrow, although this drug has been reported to act as a "functional antagonist" for lymphocyte egress from secondary lymphoid organs by down-regulating S1P 1 expression 24, 25. The difference may lie in evidence showing that the functional effect of S1P or FTY720 varies depending on the cell type or organ under study

11 Supplementary Fig. 10. Differential temporal effect of FTY720 and SEW2871 on the mobilization of CD11b + OP/monocytoid cells. PBMC collected from the mice treated with SEW2871 (SEW, 5 mg/kg, i.v.) or FTY720 (FTY, 3 mg/kg, i.p.) for 1, 5, and 20 hours, were stained with anti-cd11b (FITC). SEW2871, a self-active S1P 1 receptor agonist, was injected intravenously, and the monocytoid cell-mobilizing effect was visible within 1 hour and less prominent after 4 hours. On the other hand, FTY720 was injected by intraperitoneally and needs metabolism (phosphorylation) for activation. The effect of FTY720 occurred more slowly and lasted longer, diminishing after 20 hours). 11

12 2. Supplementary Tables Supplementary Table 1. FACS analysis of MNCs from CX 3 CR1-EGFP (heterozygous) knock-in and CSF1R-EGFP transgenic mice. Data are shown as mean ± SEM. CX 3 CR1-EGFP CSF1R-EGFP In total MNCs EGFP + cells 25.9 ± 0.8 % 56.3 ± 4.8 % In EGFP + cells RANK 66.5 ± 3.4 % 50.6 ± 5.5 % CD11b ± 6.6 % 92.2 ± 8.4 % CD11c ± 2.8 % 30.3 ± 5.0 % 12

13 Supplementary Table 2. FACS analysis of CD11b + MNCs in bone marrow, spleen and liver, treated with SEW2871, FTY720 or vehicles. Data are shown as mean ± SEM. vehicle SEW2871 P value Bone marrow 47.1 ± 1.3 % 32.9 ± 1.6 % p = Spleen 15.5 ± 0.8 % 18.7 ± 0.2 % p = 0.17 Liver 29.6 ± 0.4 % 32.5 ± 0.2 % p = 0.15 vehicle FTY720 P value Bone marrow 47.1 ± 1.3 % 34.1 ± 2.1 % p =

14 Supplementary Table 3. Uterine weight of control and ovariectomized mice. Uterine weight (mg) Mice Mean SEM. Sham-operated, vehicle Sham-operated, FTY Ovariectomized, vehicle Ovariectomized, FTY Differences between the ovariectomized and sham-operated mice were statistically significant (p < 0.01), whereas difference between the mice treated with vehicle and those with FTY720 were not statistically different (p > 0.05). 14

15 Supplementary Table 4. Primer pairs used for RT-PCR to detect mrna of S1P receptors. The expected molecular weight in base pairs (b.p.) is indicated. The presence of mrna for GAPDH was detected as a control. Forward (5-3 ) Reverse (5-3 ) b.p. S1P 1 GCTGCTTGATCATCCTAGAG GAAAGGAGCGCGAGCTGTTG 318 S1P 2 CCAAGGAGACGCTGGACATG TGCCGTAGAGCTTGACCTTG 511 S1P 3 GCAACTTGGCTCTCTGCGAC GACGATGGTCACCAGAATGG 342 S1P 4 GTGTATGGCTGCATCGGTCTGTG GGATTAATGGCTGAGTTGAACACG 485 S1P 5 GTGGCGCTCGCCGCGTCGGTG GAAGGTGTAGATGATGGGATTCAG 625 GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA

16 3. Supplementary Video Legends Supplementary Videos 1 and 2. In vitro chemotaxis of RAW264.7 cells toward an S1P gradient detected using the EZ-Taxiscan device. Cells were loaded in the upper chamber in the absence (Supplementary Video 1) or presence (Supplementary Video 2) of S1P (10-8 M) and images were taken every minute for 2 hours. Scale bars represent 150 µm. Playback speed is 300x. Supplementary Videos 3 and 4. Intravital two-photon imaging of mouse skull bone tissues of CX 3 CR1-EGFP knock-in (heterozygous) mice. Sequential images in the same visual field were acquired before (Supplementary Video 3) and 30 minutes after (Supplementary Video 4) intravenous injection of the potent S1P 1 agonist, SEW2871 (5 mg/kg). CX 3 CR1-EGFP positive cells can be seen in green. The microvasculature of bone marrow tissues was visualized by intravenous injection of 70kDa dextran-conjugated Texas Red (red). Scale bars represent 50 µm. Playback speed is 300x. Supplementary Videos 5 and 6. Intravital two-photon imaging of mouse skull bone tissues of CSF1R-EGFP transgenic mice. Sequential images in the same visual field were acquired before (Supplementary Video 5) and 30 minutes after (Supplementary Video 6) intravenous injection of the potent S1P 1 agonist, SEW2871 (5 mg/kg). CSF1R-EGFP positive cells can be seen in green. The microvasculature of bone marrow tissues was visualized by intravenous injection of 70kDa dextran-conjugated Texas Red (red). Scale bars represent 50 µm. Playback speed is 300x. Supplementary Video 7. Intravital two-photon imaging of mouse skull bone tissues of CX 3 CR1-EGFP knock-in (heterozygous) mice, pre-treated with FTY720 (3 mg/kg, i.p.) 4 hours 16

17 before imaging. CX 3 CR1-EGFP positive cells can be seen in green. The microvasculature of bone marrow tissues was visualized by intravenous injection of 70kDa dextran-conjugated Texas Red (red). Scale bars represent 50 µm. Playback speed is 300x. 17

18 4. Supplementary Notes 31. Pappu, R. et al. Promotion of lymphocyte egress into blood and lymph by distinct sources of sphingosine-1-phosphate. Science 316, (2007) 32. Pham, T. H. et al. S1P 1 receptor signaling overrides retention mediated by Gα i -coupled receptors to promote T cell egress. Immunity 28, (2008) 33. Schwab, S. R. & Cyster, J. G. Finding a way out: lymphocyte egress from lymphoid organs. Nat. Immunol. 8, (2007) 18