on March 29, 2019 by guest

Transcription

1 JCM Accepts, published online ahead of print on 4 May 2011 J. Clin. Microbiol. doi: /jcm Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Echinocandin Susceptibility Testing of Candida Isolates Collected during a One-year Period in Sweden Marlene Axner-Elings 1, Silvia Botero-Kleiven 1, Rasmus Hare Jensen 2, and Maiken Cavling Arendrup 2 * Swedish Institute for Infectious Disease Control, Solna 1 ; Statens Serum Institute, Copenhagen 2 *Corresponding author. Mailing address: Unit of Mycology, Dept. Microbiological Surveillance and Research, Statens Serum Institute, Building 43/117, DK-2300 Copenhagen, Denmark. Phone: (+45) Fax: (+45) mad@ssi.dk. Running title Echinocandin susceptibility testing of Candida species Downloaded from on March 29, 2019 by guest Page 1 of 25

2 Abstract Susceptibility to the echinocandins anidulafungin, caspofungin and micafungin was determined using the recently revised CLSI breakpoints and Etest for 238 clinical bloodstream Candida isolates collected between September 2005 and August The isolates represent approximately 95% of all non-albicans Candida bloodstream infections and a third of C. albicans bloodstream infections during this one year period in Sweden. The collection included 81 C. albicans, 81 C. glabrata, 36 C. parapsilosis, 14 C. dubliniensis, 8 C. tropicalis, 8 C. lusitaniae, 5 C. krusei, 2 C. guilliermondii and 2 C. inconspicua isolates, and 1 C. pelliculosa isolate. The MICs were largely consistent with the global epidemiology of bloodstream Candida isolates. All C. albicans and C. glabrata isolates were susceptible to all 3 echinocandins (MIC µg/ml in all instances). Resistance (MIC 8 µg/ml) to anidulafungin alone was observed for 4 (11.1%) C. parapsilosis isolates and for 1/2 C. guilliermondii isolates. Intermediate susceptibility to caspofungin alone was observed for 2/5 C. krusei isolates. One of the eight C. tropicalis isolates was classified as intermediately susceptible to micafungin (MIC 0.5 µg/ml) and as resistant to anidulafungin and caspofungin (MIC: 1 µg/ml). This isolate harbored a heterozygous FKS1 hot spot mutation (S80P) known to confer echinocandin resistance. This first study to apply the revised CLSI breakpoints for Etest endpoints showed that the breakpoints worked successfully in detecting an isolate with a hot spot mutation. Acquired echinocandin resistance is rare in Sweden. Echinocandin MICs against C. parapsilosis and C. guilliermondii were lowest for micafungin. Page 2 of 25

3 Introduction The echinocandins anidulafungin, caspofungin and micafungin are effective and widely used in the treatment of invasive candidiasis. Reports of echinocandin resistance for clinical isolates causing invasive candidiasis have been rare. Mutations in two hot spot regions of FKS genes, which encode the target and major subunit of the 1,3-ß-D-glucan synthase complex, account for most cases of acquired echinocandin resistance reported for Candida strains (3, 7, 23, 26, 28, 30). Although rare in clinical practice, early detection of echinocandin resistance in clinical Candida isolates is necessary to ensure good clinical outcome (24, 31). Based on limited data when the echinocandins were first introduced, the Clinical and Laboratory Standards Institute (CLSI) proposed an interpretive susceptibility breakpoint of 2 µg/ml for all three echinocandins against all Candida species (12, 30). More recently, species-specific susceptibility (S) breakpoints and resistance (R) breakpoints have been approved by the CLSI (28). The revised CLSI breakpoints are summarized in Table 1 along with epidemiologic cut-off values (ECVs) in cases in which no CLSI breakpoint has been established. The CLSI M27-A3 and EUCAST EDef 7.1 protocols for broth microdilution assays are validated and widely used for susceptibility testing of Candida isolates to antifungals, including echinocandins (12, 32). There is also a widely used commercially available method for susceptibility testing (Etest, AB biomèrieux), which is validated. All three of these methods provide reliable results. An assessment of anidulafungin, caspofungin and micafungin minimum inhibitory concentrations (MICs) using methods based on EUCAST EDef 7.1, CLSI M27-A3 and Etest, showed all three methods to give acceptable results with regard to interpretation of susceptibility endpoints with the application of wild type upper limit values as breakpoints (6). Testing of Candida isolates for susceptibility to anidulafungin showed an essential agreement of 80% between the CLSI M27-A3 and Etest methods (14). Page 3 of 25

4 The present study was performed using the Etest to assess the in vitro susceptibility to anidulafungin, caspofungin and micafungin of bloodstream isolates collected over a one-year period from candidemia patients in Sweden Methods Organisms. We tested 238 clinical isolates of Candida species from patients with confirmed candidemia. All of the isolates had been retrieved by 28 clinical microbiology laboratories from different Swedish hospitals between September 2005 and August Susceptibility testing of the isolates was performed by the Swedish Institute for Infectious Disease Control. The 157 nonalbicans Candida isolates from Sweden were obtained from 157 candidemia patients; these isolates comprise all of the non-albicans Candida isolates retrieved from Sweden during the oneyear survey and represent approximately 95% of all cases of non-albicans candidemia in Sweden during this period. The 81 C. albicans isolates obtained from 81 patients represent approximately one-third of all cases of microbiologically confirmed candidemia caused by C. albicans in Sweden during this period. Confirmation of species identity was performed by pyrosequencing of species-specific ITS DNA signatures in the ribosomal DNA locus (9). Using the BioEdit program (Version ), all ITS2 sequences available at GenBank were aligned. Subsequently, 40 nucleotides (5 bps in the 28S rrna gene and 35 bps in the ITS2 region) were identified sufficient to discriminate between species of medically important yeasts. Using this information, a local nucleotide database with the 40 nucleotide long reference sequences was generated. The pyrosequencing technology can read from the first nucleotide after primer binding and generates short bp long sequences. Therefore, the last nucleotide of the sequencing primer is located 6 bps before the end of the 28S rrna gene. The clinical isolates were identified through the first 40 nucleotides after primer Page 4 of 25

5 binding. The sequences obtained by pyrosequencing analysis were BLAST searched against the local nucleotide database. Alignments with 100 % identity between the query and a sequence in the local database identified the clinical isolates on the species level. Antifungal agents. Etest strips (0.002 to 32 µg/ml) for micafungin (batch BI2518), caspofungin (batches BH0576 and BI2525), and anidulafungin (batches BI3578, BJ0645, BI3107, BI1808 and BJ0428) were purchased from AB biomèrieux, Sweden. Susceptibility testing. The E-test (AB biomèrieux, Sweden) was used for susceptibility testing according to the manufacturer's instructions. RPMI 1640 (Sigma) supplemented with 2% glucose buffered with M morpholinepropanesulfonic acid (MOPS) at ph 7.0 (Sigma) and 1.5% Bacto agar (Difco Laboratories) was used to prepare Etest RPMI-agar plates. Before susceptibility testing, each isolate was subcultured on Sabouraud agar. Inocula were prepared by transferring colonies from the 24-hour-old cultures into 0.85% NaCl and adjusting the suspension to a McFarland standard turbidity equivalent of 0.5. The agar plates were inoculated with the cell suspension by flooding the entire surface of the agar. The volume used for inoculation of the plates was approximately 5 ml. The excess fluid was discarded after approximately 1 minute, and the plates were placed inside a laminar flow cabinet until they were completely dry (about minutes). The same cell suspensions obtained from each isolate were used for susceptibility testing of all three echinocandins. As Etest strips contain a continuous gradient of drug rather than a standard 2-fold dilution series, the Etest MICs were elevated as required to the next drug concentration that matches the standard microdilution scheme. Etests were read at 24 and 48 hours by reading the trailing endpoints at the first visual point of significant inhibition of growth (i.e., 80% inhibition) (1). The recently revised CLSI breakpoints (28) and ECVs (27) were used to define resistance for Candida strains; these are summarized in Table 1. Page 5 of 25

6 Quality control. Quality control was performed on each day of testing by using the reference strains, C. albicans ATCC 90028, C. parapsilosis ATCC and C. krusei ATCC FKS gene sequence analysis. For the one C. tropicalis isolate that showed MIC values suggestive of resistance, genomic DNA was extracted from the culture grown 2 days on CHROM agar using a 2-step buffer extraction procedure as previously described (10, 11). The following primers were applied as polymerase chain reaction (PCR) and sequencing primers targeting two hot spots in the FKS1 target gene encoding the 1,3-β-D-glucan synthase subunit 1 of C. tropicalis: GSC_1F (TCATTGCTGTGGCCACTTTAG) and GSC_1R (TAGAATGAACGACCAATGGAGA) (21); and GSC_2F (ATTGCTCCTGCCGTTGATTG) and GSC_2R (GGTCAAATCAGTGAAACCG). Sequencing was performed at Macrogen Holland, and the obtained sequences were aligned with the FKS1 reference sequence of C. tropicalis (GenBank accession no. EU676168) using the bioinformatics software CLC DNA Workbench (CLC, Aarhus, Denmark). Results and Discussion Susceptibility to the echinocandins anidulafungin, caspofungin and micafungin was determined for 238 clinical isolates of Candida species from 238 patients with bloodstream Candida infections. Of these 238 isolates, 81 (34.0%) were C. albicans, 81 (34.0%) were C. glabrata, 36 (15.1%) were C. parapsilosis, 14 (5.9%) were C. dubliniensis, 8 (3.4%) were C. tropicalis, 8 (3.4%) were C. lusitaniae, 5 (2.1%) were C. krusei, 2 (0.8%) were C. guilliermondii and 2 (0.8%) were C. inconspicua; and there was 1 (0.4%) isolate of C. pelliculosa. For most Candida species tested, MIC values were low for all three echinocandins and below the susceptibility breakpoint. From the Etest readings at 24 hours, MIC 90 values for anidulafungin caspofungin, and micafungin, respectively, were 0.004, and µg/ml for C. albicans; Page 6 of 25

7 , and µg/ml for C. dubliniensis; 0.008, and µg/ml for C. glabrata; and 0.032, 0.5 and µg/ml for C. lusitaniae (Table 2). Etest readings at 48 hours gave similar results (Table 3). No MIC value was suggestive of resistance for these species at 24 or 48 hours, but a single C. albicans isolate were at the 48 hour reading classified as intermediately susceptible to caspofungin (MIC 0.5 µg/ml) (Table 4). These results are consistent with those reported elsewhere for these species (30) and support the use of the revised CLSI breakpoints for interpretation of Etest endpoints for these species. The MIC values for caspofungin were in general 3-4 dilution steps higher than those for anidulafungin and micafungin across the species in contrast to what is observed using the CLSI microdilution reference method (28). For C. krusei particularly, the MIC 90 value at 24 hours was 0.5 µg/ml for caspofungin as compared to and µg/ml, respectively, for anidulafungin and micafungin (Table 2). Thus, 2/5 C. krusei isolates were classified as intermediately susceptible to caspofungin (MICs of 0.5 µg/ml) at the 24-hour reading and 5/5 isolates at the 48- hour reading, whereas there was no C. krusei isolate found to be intermediately susceptible or resistant to anidulafungin or micafungin at any time point (Table 4). In general the three echinocandins are regarded as equally effective, and therefore any isolate would be expected to have the same susceptibility profile for all three compounds. In our study the MIC values for the five C. krusei isolates were either identical or only one dilution step apart, which indicates that none of the five isolates possessed acquired resistance mechanisms. Future evaluation of Etest results is needed to determine whether the revised resistance breakpoint of 0.5 µg/ml may be too restrictive for caspofungin and C. krusei. As generally observed with echinocandin susceptibility testing of C. parapsilosis and C. guilliermondii, MIC values were relatively high, especially for anidulafungin. Applying the Page 7 of 25

8 recently revised CLSI breakpoints with resistance defined as MIC 8 µg/ml for these species (Table 1) (28), 4 (11.1%) C. parapsilosis isolates and 1 of 2 C. guilliermondii isolates were resistant to anidulafungin when the Etest was read at 24 hours but none to caspofungin or micafungin (Table 4). Similar findings were observed with the Etest read at 48 hours, but with 6 (16.7%) C. parapsilosis isolates and both C. guilliermondii isolates resistant to anidulafungin and one C. guilliermondii isolate resistant to caspofungin. The MIC 90 values at 24 hours were 8 µg/ml for anidulafungin for both C. parapsilosis and C. guilliermondii, compared with 0.5 and 1 µg/ml, respectively, for caspofungin and 0.5 µg/ml for micafungin (Table 2). The naturally occurring polymorphism at hot spot 1 in FKS1 in C. parapsilosis and C. guilliermondii accounts for the MIC values being in the same range as those of hot spot mutant isolates of other Candida species (17). Whereas C. guilliermondii is a rare species for which only limited clinical data are available (5, 13, 29, 33), studies have been published which show that the overall clinical response to micafungin and caspofungin for invasive C. parapsilosis infections is comparable to that for infections caused by other Candida species (22, 25). C. parapsilosis has low virulence in animal models (4), and clinical data suggest that infections caused by this species are less severe than those caused by other Candida species, as they are associated with a lower rates of mortality, neutropenia, corticosteroid therapy, and hospitalization (2, 18, 20). Previous echinocandin use may predispose patients to C. parapsilosis infections, and breakthrough infections during echinocandin treatment has been significantly associated with C. parapsilosis (15, 34); thus other drug classes are generally preferred for infections caused by this species. With regard to clinical pharmacokinetics, the 3 echinocandins have average C min and C max plasma values of approximately 2 and 10 µg/ml, respectively (8, 19, 35). Thus, the higher anidulafungin MIC values for C. guilliermondii as compared to micafungin MICs in our study may be of clinical Page 8 of 25

9 relevance, although the general perception has been that the susceptibility to the three compounds of the echinocandin class of drugs is uniform. MIC 50 values for the 8 isolates of C. tropicalis were µg/ml for anidulafungin, µg/ml for caspofungin and µg/ml for micafungin when the Etest reading was taken at 24 hours (Table 2) or 48 hours (Table 3). For one of the eight C. tropicalis isolates, obtained from a patient receiving caspofungin, the MIC values were suggestive of resistance (MIC 1 µg/ml) for anidulafungin (MICs of 1 µg/ml at 24 hours and 2 µg/ml at 48 hours), caspofungin (4 and 8 µg/ml, respectively) and of intermediate susceptibility for micafungin (0.5 µg/ml at both 24 and 48 hours). Sequence analysis of the FKS1 region of this isolate revealed a heterozygous Fks1p (S80P) mutation, which is known to confer echinocandin resistance (16). Unfortunately no information was available as to the length of caspofungin exposure prior to the isolation of the isolate or the clinical outcome. For the other isolates included in our study (C. inconspicua, C. pelliculosa) MIC values of 0.25 µg/ml or less were observed for all three echinocandins (Tables 2 and 3), which is consistent with MIC values observed in the literature, and suggests that these species are good targets for echinocandin treatment (13). In conclusion, the MIC values of Candida isolates from candidemia patients in Sweden were largely consistent with global epidemiology of infective Candida strains reported in the literature. To our knowledge this is the first study to demonstrate the applicability of the revised breakpoints for interpretation of Etest endpoints for clinical isolates. The revised susceptibility CLSI breakpoints (Table 1) worked well for most species and successfully identified one resistant isolate with a heterozygous hot spot mutation in the FKS gene. However, as the Etest MIC values for anidulafungin and micafungin in contrast to those for caspofungin were in considerably lower than the revised CLSI microdilution susceptibility breakpoints it remains to be elucidated if the Page 9 of 25

10 sensitivity with respect to identify FKS hot spot mutant isolates may be vary depending on which etest strip is used. Furthermore, the breakpoint bisected the caspofungin MIC distribution for C. krusei, and thus further studies are needed in order to evaluate whether susceptible C. krusei isolates may be misclassified as caspofungin-resistant using the Etest and the revised CLSI breakpoints. Resistance to anidulafungin (but not to caspofungin or micafungin) was observed among C. parapsilosis and C. guilliermondii isolates. Future studies are needed to explore whether this observation translates into differential clinical efficacy for the three echinocandins with regard to infections caused by C. parapsilosis and C. guilliermondii. Acknowledgments. This work was supported by a grant from Astellas Pharma. We thank Connie Grogan (Irsee, Germany) for editorial assistance in the preparation of the manuscript. We also thank the members of the Swedish Reference Group for Antifungal Agents (RAM) for their support in the initiative of obtaining this collection of fungal isolates and Srisuda Pannanusorn for expert advice in the pyrosequencing experiments. References 1. Alexander, B. D., T. C. Byrne, K. L. Smith, K. E. Hanson, K. J. Anstrom, J. R. Perfect, and L. B. Reller Comparative evaluation of Etest and Sensititre YeastOne panels against the Clinical and Laboratory Standards Institute M27-A2 reference broth microdilution method for testing Candida susceptibility to seven antifungal agents. J Clin Microbiol 45: Page 10 of 25

11 Almirante, B., D. Rodriguez, M. Cuenca-Estrella, M. Almela, F. Sanchez, J. Ayats, C. Alonso-Tarres, J. L. Rodriguez-Tudela, and A. Pahissa Epidemiology, risk factors, and prognosis of Candida parapsilosis bloodstream infections: case-control population-based surveillance study of patients in Barcelona, Spain, from 2002 to J Clin Microbiol 44: doi: /jcm Arendrup, M., C. G. Garcia-Effron, W. Buzina, K. L. Mortensen, N. Reiter, C. Lundin, H. E. Jensen, C. Lass-Florl, D. S. Perlin, and B. Bruun Breakthrough Aspergillus fumigatus and Candida albicans double infection during caspofungin treatment: laboratory characteristics and implication for susceptibility testing. Antimicrob Agents Chemother 53: doi:0.1128/aac Arendrup, M., T. Horn, and N. Frimodt-Møller In vivo pathogenicity of eight medically relevant Candida species in an animal model. Infection 30: Arendrup, M. C., B. Bruun, J. J. Christensen, K. Fuursted, H. K. Johansen, P. Kjældgaard, J. D. Knudsen, and e. al National surveillance of fungemia in Denmark (2004 to 2009). J Clin Microbiol 49: doi: /jcm Arendrup, M. C., G. Garcia-Effron, C. Lass-Flo rl, A. Gomez Lopez, J.-L. Rodriguez-Tudela, M. Cuenca-Estrella, and D. S. Perlin Echinocandin susceptibility testing of Candida species: comparison of EUCAST EDef 7.1, CLSI M27- A3, Etest, Disk Diffusion, and Agar dilution methods with RPMI and IsoSensitest media. Antimicrob Agents Chemother 54: Baixench, M. T., N. Aoun, M. Desnos-Ollivier, D. Garcia-Hermoso, S. Bretagne, S. Ramires, C. Piketty, and E. Dannaoui Acquired resistance to echinocandins in Candida albicans: case report and review. J Antimicrob Chemoth 59: Page 11 of 25

12 Benjamin, D. K. J., T. Driscoll, N. L. Seibel, C. E. Gonzalez, M. M. Roden, R. Kilaru, K. Clark, J. A. Dowell, J. Schranz, and T. J. Walsh Safety and pharmacokinetics of intravenous anidulafungin in children with neutropenia at high risk for invasive fungal infections. Antimicrob Agents Chemother 50: Boyanton, B. L., R. A. Luna, L. R. Fasciano, K. G. Menne, and J. Versalovic DNA pyrosequencing-based identification of pathogenic Candida species by using the internal transcribed spacer 2 region. Arch Pathol Lab Med 132: Brillowska-Dabrowska, A DNA preparation from nail samples. Denmark patent WO Brillowska-Dabrowska, A. D., M. Saunte, and M. C. Arendrup Five-hour diagnosis of dermatophyte nail infections with specific detection of Trichophyton rubrum. J Clin Microbiol 45: doi: /jcm CLSI Reference method for broth dilution antifungal susceptibility testing of yeasts; approved standard, 3rd ed. CLSI document M27-A3 Clinical and Laboratory Standards Institute (CLSI), Wayne, PA. 13. Diekema, D. J., S. A. Messer, L. B. Boyken, R. J. Hollis, J. Kroeger, Tendolkar S, and M. A. Pfaller In vitro activity of seven systemically active antifungal agents against a large global collection of rare Candida species as determined by CLSI broth microdilution methods. J Clin Microbiol 47: Espinel-Ingroff, A., E. Canton, J. Peman, and E. Martín-Mazuelo Comparison of anidulafungin MICs determined by the Clinical and Laboratory Standards Institute broth microdilution method (M27-A3 Document) and Etest for Candida species isolates. Antimicrob Agents Chemother 54: Page 12 of 25

13 Forrest, G. N., E. Weekes, and J. K. Johnson Increasing incidence of Candida parapsilosis candidemia with caspofungin usage. J Infect 56: Garcia-Effron, G., D. P. Kontoyiannis, R. E. Lewis, and D. S. Perlin Caspofungin-resistant Candida tropicalis strains causing breakthrough fungemia in patients at high risk for hematologic malignancies. Antimicrob Agents Chemother 52: : doi: /aac Garcia-Effron, G. S., K. Katiyar, S. Park, T. D. Edlind, and D. S. Perlin A naturally occurring proline-to-alanine amino acid change in Fks1p in Candida parapsilosis, Candida orthopsilosis, and Candida metapsilosis accounts for reduced echinocandin susceptibility. Antimicrob Agents Chemother 52: doi: /aac Hajjeh, R. A., A. N. Sofair, L. H. Harrison, G. M. Lyon, B. A. Arthington-Skaggs, S. A. Mirza, M. Phelan, J. Morgan, W. Lee-Yang, M. A. Ciblak, L. E. Benjamin, L. T. Sanza, S. Huie, S. F. Yeo, M. E. Brandt, and D. W. Warnock Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of isolates collected from 1998 to 2000 in a population based active surveillance program. J Clin Microbiol 42: Hiemenz, J., P. Cagnoni, D. Simpson, S. Devine, N. Chao, J. Keirns, W. Lau, D. Facklam, and D. Buell Pharmacokinetic and maximum tolerated dose study of micafungin in combination with fluconazole versus fluconazole alone for prophylaxis of fungal infections in adult patients undergoing a bone marrow or peripheral stem cell transplant. Antimicrob Agents Chemother 49: Horn, D. L., D. D. Neofytos, E. J. Anaissie, J. A. Fishman, W. J. Steinbach, A. J. Olyaei, K. A. Marr, M. A. Pfaller, C. H. Chang, and K. M. Webster Page 13 of 25

14 Epidemiology and outcomes of candidemia in 2019 patients: data from the prospective antifungal therapy alliance registry. Clin Infect Dis 48: Katiyar, S., M. Pfaller, and T. D. Edlind Candida albicans and Candida glabrata clinical isolates exhibiting reduced echinocandin susceptibility. Antimicrob Agents Chemother 50: doi: /aac Kuse, E. R., P. Chetchotisakd, C. A. da Cunha, M. Ruhnke, C. Barrios, D. Raghunadharao, J. S. Sekhon, A. Freire, V. Ramasubramanian, I. Demeyer, M. Nucci, A. Leelarasamee, F. Jacobs, J. Decruyenaere, D. Pittet, A. J. Ullmann, L. Ostrosky-Zeichner, O. Lortholary, S. Koblinger, H. Diekmann-Berndt, and O. A. Cornely Micafungin versus liposomal amphotericin B for candidaemia and invasive candidosis: a phase III randomised double-blind trial. Lancet 369: doi: /s (07) Laverdiere, M., R. G. Lalonde, J. G. Baril, D. C. Sheppard, S. Park, and D. S. Perlin Progressive loss of echinocandin activity following prolonged use for treatment of Candida albicans oesophagitis. J Antimicrob Chemoth 57: Pappas, P. G., J. H. Rex, J. D. Sobel, S. G. Filler, W. E. Dismukes, T. J. Walsh, and J. E. Edwards Guidelines for treatment of candidiasis. Clin Infect Dis 38: Pappas, P. G., C. M. Rotstein, R. F. Betts, M. Nucci, D. Talwar, J. J. De Waele, J. A. Vazquez, B. F. Dupont, D. L. Horn, L. Ostrosky-Zeichner, A. C. Reboli, B. Suh, R. Digumarti, C. Wu, L. L. Kovanda, L. J. Arnold, and D. N. Buell Micafungin versus caspofungin for treatment of candidemia and other forms of invasive candidiasis. Clin Infect Dis 45: Page 14 of 25

15 Pasquale, T., J. R. Tomada, M. Ghannoun, J. Dipersio, and H. Bonilla Emergence of Candida tropicalis resistant to caspofungin. J Antimicrob Chemother 61: Pfaller, M. A., L. Boyken, R. J. Hollis, J. Kroeger, S. A. Messer, S. Tendolkar, R. N. Jones, J. Turnidge, and D. J. Diekema Wild-type MIC distributions and epidemiological cutoff values for the echinocandins and Candida spp. J Clin Microbiol 48: Pfaller, M. A., D. J. Diekema, D. Andes, M. C. Arendrup, S. D. Brown, M. Motyl, and D. S. Perlin Clinical breakpoints for the echinocandins and Candida revisited: integration of molecular, clinical, and microbiological data to arrive at species-specific interpretive criteria. Drug Resist Updat:in press. Published online at Pfaller, M. A., D. J. Diekema, M. Mendez, C. Kibbler, P. Erzsebet, C. Chang, L. Gibbs, A. Newell, and Global-Antifungal-Surveillance-Group Candida guilliermondii, an opportunistic fungal pathogen with decreased susceptibility to fluconazole: geographic and temporal trends from the ARTEMIS DISK antifungal surveillance program. J Clin Microbiol 44: Pfaller, M. A., D. J. Diekema, L. Ostrosky-Zeichner, J. H. Rex, B. D. Alexander, D. Andes, S. D. Brown, V. Chaturvedi, M. A. Ghannoum, C. C. Knapp, D. J. Sheehan, and T. J. Walsh Correlation of MIC with outcome for Candida species tested against caspofungin, anidulafungin, and micafungin: analysis and proposal for interpretive MIC Breakpoints. J Clin Microbiol 46: Rex, J. H., T. J. Walsh, J. D. Sobel, S. G. Filler, P. G. Pappas, W. E. Dismukes, and J. E. Edwards Practice guidelines for treatment of candidiasis. Infectious Diseases Society of America. Clin Infect Dis 30: Page 15 of 25

16 Rodriguez-Tudela, J. L., M. C. Arendrup, F. Barchiesi, J. Bille, E. Chryssanthou, M. Cuenca-Estrella, E. Dannaoui, D. W. Denning, J. P. Donnelly, F. Dromer, W. Fegeler, C. Lass-Florl, C. B. Moore, M. Richardson, P. Sandven, A. Velegraki, and P. E. Verweij EUCAST definitive document EDef 7.1: method for the determination of broth dilution MICs of antifungal agents for fermentative yeasts. Clin Microbiol Infect 14: Sandven, P., L. Bevanger, A. Digranes, H. H. Haukland, T. Mannsåker, and P. Gaustad Candidemia in Norway (1991 to 2003): Results from a nationwide study. J Clin Microbiol 44: Sipsas, N., V, R. Lewis, E, J. Tarrand, R. Hachem, K. Rolston, V, I. I. Raad, and D. P. Kontoyiannis Candidemia in patients with hematologic malignancies in the era of new antifungal agents ( ): stable incidence but changing epidemiology of a still frequently lethal infection. Cancer 115: Spriet, I., P. Annaert, P. Meersseman, G. Hermans, W. Meersseman, R. Verbesselt, and L. Willems Pharmacokinetics of caspofungin and voriconazole in critically ill patients during extracorporeal membrane oxygenation. J Antimicrob Chemother 63: Page 16 of 25

17 357 Table 1: Susceptibility and resistance breakpoints (S: X / R: Y µg/ml) for echinocandins Species Anidulafungin Caspofungin Micafungin C. albicans a 0.25 / / / 1 C. dubliniensis b 0.25 / / / 1 C. glabrata a / / / 0.25 C. krusei a 0.25 / / / 1 C. tropicalis a 0.25 / / / 1 C. parapsilosis a 2 / 8 2 / 8 2 / 8 C. guilliermondii a 2 / 8 2 / 8 2 / 8 C. lusitaniae c 2 / / / 2 a CLSI breakpoints as approved at the CLSI meeting in January 9-11, 2011 in Orlando, Florida, and based on Pfaller, M A et al (2010) Drug Resist Updat (in press) published online at b Based on C. albicans, because MIC values for C. albicans and C. dubliniensis are similar, and no breakpoints have been established for C. dubliniensis. c Based on epidemiological cutoff values (ECVs) described by Pfaller, M A et al (2010b). J Clin Microbiol 48: Page 17 of 25

18 Table 2. In vitro susceptibility of common yeast isolates from 238 bloodstream isolates to micafungin, caspofungin and anidulafungin determined by Etest and read at 24 hours MIC (µg/ml) a Number of isolates with MIC (µg/ml) of: N Range 50% 90% Anidulafungin C. albicans 80 b C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C guilliermondii C. inconspicua Page 18 of 25

19 C. pelliculosa Caspofungin C. albicans 80 b C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa Micafungin C. albicans 80 b C. glabrata Page 19 of 25

20 C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa a 50% and 90% minimum inhibitory concentrations (MICs) at which 50% and 90% of isolates are inhibited, respectively b MIC 24h value for one C. albicans isolate missing Page 20 of 25

21 Table 3. In vitro susceptibility of common yeast isolates from 238 bloodstream isolates to micafungin, caspofungin and anidulafungin determined by Etest and read at 48 hours MIC (µg/ml) a Number of isolates with MIC (µg/ml) of: N Range 50% 90% Anidulafungin C. albicans C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C guilliermondii Page 21 of 25

22 C. inconspicua C. pelliculosa Caspofungin C. albicans C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa Micafungin C. albicans Page 22 of 25

23 372 C. glabrata C. parapsilosis C. dubliniensis C. tropicalis C. lusitaniae C. krusei C. guilliermondii C. inconspicua C. pelliculosa a 50% and 90% minimum inhibitory concentrations (MICs) at which 50% and 90% of isolates are inhibited, respectively Page 23 of 25

24 Table 4. Rate of resistance to anidulafungin, caspofungin and micafungin from 238 bloodstream yeast isolates N Etest at 24 h Intermediately resistant a Resistant a no. (%) no. (%) N Etest at 48 h Intermediately resistant a no. (%) Resistant a no. (%) Anidulafungin C. albicans 80 b 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. glabrata 81 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. parapsilosis 36 6 (16.7) 4 (11.1) (41.6) 6 (16.7) C. dubliniensis 14 0 (0.0) 0 (0.0) 14 0 (0.0) 0 (0.0) C. tropicalis 8 0 (0.0) (0.0) 1 C. lusitaniae C. krusei C. guilliermondii Caspofungin C. albicans 80 b 0 (0.0) 0 (0.0) 81 0 (0.0) 1 (1.2) C. glabrata 81 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. parapsilosis 36 0 (0.0) 0 (0.0) 36 0 (0.0) 0 (0.0) C. dubliniensis 14 0 (0.0) 0 (0.0) 14 0 (0.0) 0 (0.0) C. tropicalis C. lusitaniae C. krusei C. guilliermondii Micafungin C. albicans 80 b 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. glabrata 81 0 (0.0) 0 (0.0) 81 0 (0.0) 0 (0.0) C. parapsilosis 36 0 (0.0) 0 (0.0) 36 0 (0.0) 0 (0.0) C. dubliniensis 14 0 (0.0) 0 (0.0) 14 0 (0.0) 0 (0.0) Page 24 of 25

25 C. tropicalis C. lusitaniae C. krusei C. guilliermondii a Resistance (R) as defined in Table 1. There are no accepted breakpoints for C. inconspicua and C. pelliculosa resistance; thus, these isolates are not included. b MIC 24h value for one C. albicans isolate missing Downloaded from on March 29, 2019 by guest Page 25 of 25