PERSISTENCE OF EUROPEAN AND AMERICAN TYPE PRRSV STRAINS WITHIN LITHUANIAN PIG HERD

Transcription

1 Bull Vet Inst Pulawy 52, , 2008 PERSISTENCE OF EUROPEAN AND AMERICAN TYPE PRRSV STRAINS WITHIN LITHUANIAN PIG HERD ARUNAS STANKEVICIUS, RYTIS CEPULIS, HENRIKAS ZILINSKAS, TOMASZ STADEJEK 1, AND ZYGMUNT PEJSAK 1 Lithuanian Veterinary Academy, LT Kaunas, Lithuania 1 Department of Swine Diseases, National Veterinary Research Institute, Pulawy, Poland sarunas@lva.lt Received for publication July 16, 2008 Abstract The objective of this study was to evaluate the diversity and persistence of porcine reproductive and respiratory syndrome virus (PRRSV) in a swine herd where American type of modified live vaccine (MLV) was used. The study was carried out on the farrow-to-finish farm with sows, which had a history of endemic PRRSV manifested as periodic mini-outbreaks of PRRS. The farm has been endemically infected with PRRSV-EU since The vaccination programme with the MLV was first applied in 2001 and consisted of vaccinating all sows every six months and all gilts 60 d before farrowing. All incoming gilts were also vaccinated twice with a two-week interval. During the monitoring period, PRRSV-EU type was detected in 28 of 63 samples collected from two to three-month-old piglets. PRRSV-US type was detected in 20 samples. Nineteen samples were positive for both EU and US types of PRRSV at the same time. The results of RT-PCR testing serum samples from 58 sows were negative. ORF5 RT-PCR products from samples containing both PRRSV-EU and PRRSV-US types were sequenced. Phylogenetic analyses, showed a close relationship to the American genotype of PRRSV strains from the monitored farm to the known vaccine strain V2332 present in the American type PRRS MLV. The presence of the PRRSV-US in the two-three-month-old piglets indicates that the American type of vaccine virus has spread from vaccinated sows to the non-vaccinated piglets. Simultaneous presence of both PRRSV-EU and US strains in 19 samples suggests very low cross protection between the American type PRRS MLV and very diverse Lithuanian EU type field strains. In this situation an increased chance for inter-genotypic recombination can be a threat. Key words: swine, PRRS virus, vaccination, phylogenetic analysis. Porcine reproductive and respiratory syndrome virus (PRRSV) infection is considered one of the most important diseases in swine production today, being responsible for significant economic losses to the swine industry worldwide. One of the main characteristic features of PRRSV is its high variability. Several studies have described significant genetic differences between PRRSV isolates from Europe and North America (1, 9). Two genotypes of PRRSV are currently recognised: American (PRRSV-US) - and European (PRRSV-EU) - type strains. Both genotypes are only 55%-80% identical at the nucleotide level (17) and thought to derive from a common ancestor (8). Although PRRS is sometimes clinically similar in North America and in Europe, the strains of both genotypes differ in virulence (5) and antigenic (2, 11) and genetic properties (4, 8, 10). In spite of the fact that immune response to PRRSV is still not completely understood, some vaccines made from American- or European-type strains are being produced and marketed. Several studies have reported controversial results about the efficacy of vaccination with heterologous strains (7). It seems that Americantype vaccines are more effective in protecting against infections caused by American-type field strains and less effective against European-type field infections (20). However, it is obvious that some degree of protection against the heterologous genotype can be achieved (6). PRRSV-US field strains have been originally detected in North America and then introduced to European pig herds by the use of American type modified live vaccines (MLV) containing that type of the virus. On some occasions the virus of American type MLV had reverted to virulent strain after vaccinating naïve herds (12). In Lithuania, PRRS outbreaks were first observed in 1997, when new pig breeds were imported from Western Europe and introduced into local pig farms. However, the latest studies suggest that PRRSV must have been present in Lithuania before that time (15). Lithuanian PRRSV ORF5 and ORF7 sequences have been shown to belong to the genetic subtype 2 of PRRSV-EU genotype, grouping viruses, which are exceptionally different from the known strains circulating in Central and Western Europe (14, 15). It has to be noted that PRRSV-US genotype virus had also

2 320 been introduced into one Lithuanian pig herd through the use of a modified live vaccine made from US type isolate. The objective of this study was to evaluate the diversity and persistence of PRRSV strains in a swine herd where American type MLV was used and where exceptionally diverse Lithuanian PRRSV strain was detected before introducing the heterologous vaccine. Material and Methods Samples collection and RNA extraction. The study was carried out on the farrow-to-finish farm with sows, which had a history of endemic PRRSV infection manifested as periodic mini-outbreaks of PRRS. The farm has been infected with PRRSV-EU since The vaccination with American type PRRS MLV was first applied in 2001 to all population of sows every six months and to all gilts 60 d before farrowing. Prior to introduction into the herd, all the new incoming gilts were also vaccinated two times with an interval of two weeks. In 2003, the vaccination programme was stopped due to low efficacy and regulatory issues. Afterwards, the herd was checked several times from 2004 to 2006 and during this period 63 lung samples from dead two three-month-old piglets with respiratory disorders were collected together with 58 blood samples from sows with abortion and low number of piglets. RNA was extracted from the homogenates of the tissues and blood samples. RNA from 250 µl of serum or mg of the tissue were extracted using the "Total RNA Prep Plus" kit, according to the manufacturer s protocol (A&A Biotechnology, Poland). Following extraction, the RNA was eluted in 100 µl of RNase free water. RT-PCR protocol. All the collected samples were investigated by nested RT-PCR using primers specific for EU and US PRRSV strains (3).Total RNA was used as template in a single-tube reverse transcription nested PCR specific for ORF5 of EU-type and US-type PRRSV. In the first step, 5 µl of 22% trehalose was used to store and maintain the following mixture in the lid of 0.2 ml Eppendorf tubes: 20 pmol of each inner PRRSV-EU primers ORF5 (5 ATGAGATGTTCTCACAAATTGGGGCG -3') and ORF5R (5 CTAGGCCTCCCATTGCTCAGCCG AAGT3') (18) or PRRSV-US inner primers US ORF5B (5 GCTCCATTTCATGACACCTG -3 ) and US ORF5C (5 - AAAGGTGCAGAAGCCCTAGC -3 ) (9), 1 µl of dntps (10 mm), and 0.25 µl of Taq Polymerase (1.25 U, Fermentas, Lithuania). The tubes were left to dry for 2 h at room temperature prior to storage. In the next step, RT-PCR was performed in the bottom of the tubes containing the dried, trehalose-treated reagents within the lid. The amplification was carried out in 50 µl volumes containing 5 µl of RNA and the following reagents: 5 µl of 10x PCR buffer (Fermentas), 5 µl of MgCl 2 (25 mm, Fermentas), 2 µl of dntps (10 mm, Sigma), 5 pmol of each PPRSV-EU outer primers EUORF5B (5 CAATGAGGTGGGCIACAACC-3'), and EUORF5C (5'TATGTIATGCTAAAGGCTAGCAC3') (13) or PRRSV-US primers 208F (5 - GTACGGCGATAGGGACACC -3 ) and 331R (5 - CCAGAATGTACTTGCGGCC -3 ) (19), 1 µl of 10% Triton X-100 (Sigma), 0.5 µl (2.5 U) of Taq DNA polymerase (Fermentas), 0.25 µl (10 U) of RNasin (Promega, USA), and 0.5 µl (100 U) of MMLV reverse transcriptase (Life Technologies). Mineral oil was included to act as a vapour barrier between the RT-PCR reaction and the dried reagents within the lid. The tubes were then subjected to the following thermal cycling: 42 C for 30 min, 95 C for 5 min, and then 20 cycles at 94 C for 1 min, 55 C for 1 min, and 72 C for 1.5 min. The tubes were subsequently inverted several times to dissolve the dried reagents in the lid in order to initiate the nested PCR. The tubes were then centrifuged briefly before returning to the thermocycler for nested PCR, using 35 cycles of 94 C for 1 min, 55 C for 1 min, and 72 C for 1.5 min. A single extension step of 72 C for 10 min completed the amplification process. The RT-PCR resulted in a final amplicon of 606 bp for PRRSV-EU and 818 bp for PRRSV-US. DNA sequencing and phylogenetic analyses. Prior to sequencing, electrophoresis of the PCR products was performed on 1.5% agarose gel. After the ethidium bromide staining and desalting in ultrafiltered water, bands of the expected size were excised from the gel, and the DNA was recovered using Nucleospin Extract II kit (Macherey-Nagel, Germany) following the manufacturer s recommendations. Gel purified PCR products were cycle sequenced using the BigDye Terminator Cycle Sequencing kit (v2.0, Applied Biosystems, USA) and the ABI310 genetic analyser (Applied Bio-Systems, USA). Sequences of both strands of the ORF5 protein gene products were determined using the same EU and US primers as used for the nested PCR amplification. The obtained sequences were assembled by using SeqMan programme (Lasergene, programme package, DNASTAR, USA). Clustal W programme from MegAlign Lasergene programme package was used for sequence alignment and phylogenetic analyses. Results During the monitoring period, PRRSV-EU type was detected in 28 of 63 samples collected from twothree-month-old piglets. PRRSV-US type was detected in 20 samples. Nineteen samples were positive for both EU and US types of PRRSV. RT-PCR results from all serum samples of 58 sows were negative. Ten selected ORF5 PCR products from samples containing both PRRSV-EU and PRRSV-US types were sequenced and aligned with sequences available in the GenBank. Based on the sequences from the investigated farm and some selected EU-type ORF5 sequences from Lithuania, Belarus, Poland, and West European countries as well as US sequences, available in the GenBank, a phylogenetic tree was constructed (Fig. 1).

3 Lelystad NL 1991 Sel LV 2006 Porcilis PRRS vac NL Amervac PRRS vac NL Pyrsvac-183 vac E Che PL 2005 Sok-4 PL Yuz 2004 Zad BY 2004 Bel BY 2004 Zap BY 2004 Mik LV 2006 "S"farm LT 2004 "S"farm LT 2005 "S" farm LT 2006 Sno-4 Vas BY 2005 Bor BY 2004 Aus LT 2000 Kup LT 2007 Ber LT 2007 Eigi LT 2006 Canada 1994 Thai 2001 Jap Jap USA1205 Jap China USA HP Jap Ingelvac PRRS MLV vac VR-2332 USA "S" farm LT 2004 "S" farm LT Nucleotide Substitutions (x100) Fig. 1. A phylogenetic tree of the selected PRRSV strains downloaded from the GenBank and obtained in the present study, constructed with MegAlign programme from Lasergene package (DNASTAR). Clustal W algorithm was used for sequence alignment. European genotype PRRSV sequences from the farm were clearly different from West European sequences, as it was expected, and were grouped with other sequences from Lithuania. American genotype PRRSV sequences where closely related to VR2332 and the American type MLV sequences. The obtained US type sequences from the monitored farm showed 97.4% similarity to the American type PRRS MLV. Discussion Experimental studies have indicated that homologous EU type MLV vaccine was capable to reduce clinical signs, shorten persistence of viraemia in challenged pigs, and increase number of weaned piglets from gilts challenged with a European strain of PRRS virus. The vaccine was shown to have an effect against the heterologous challenge, although the protection was not complete. Experience from the field has indicated that the vaccination with the EU type strain may reduce mortality losses and increase daily weight gain in finishing and nursery pigs in herds with chronic losses due to infection with European strain of the virus (6). However, others have had negative experiences especially with the use of US type MLV. This modified live vaccine was spreading from vaccinated to nonvaccinated animals and the vaccine strain could be associated with a pathogenic effect in herds (3). A vaccine-like strain isolated from the field was demonstrated to have a pathogenic effect after experimental inoculation of the late-term pregnant sows (12). Two single mutations in the genome have been linked to the attenuation of the vaccine strain and the subsequent reversion to virulence (16). Furthermore, the reverted US type vaccine strain was capable of the spreading to other herds (3). Our study showed a close relationship of American genotype PRRSV strains from the investigated farm to strains V2332 or American type

4 322 PRRS MLV strain, which clearly points at its origin from the vaccine used in the farm. The presence of the PRRSV-US in two-three-month-old piglets born 1-3 years after vaccination programme was stopped, indicates that the vaccine virus had spread from vaccinated sows to non-vaccinated piglets and was persisting in the herd. Furthermore, sequences were not identical to the American type PRRS MLV (97.4%) that could suggest the prolonged circulation of at least several years of the MLV related strain in weaners of this farm resulting in a significant antigenic drift. The fact that vaccine related PRRSV-US strain was circulating within the monitored farm for more than one year after the vaccination was stopped indicates that the vaccine strain partially reverted to virulence (12). Simultaneous presence of PRRSV-EU and US strains in 19 samples could suggest a very low cross protection between the US type MLV and the very diverse Lithuanian field strains (15). In this situation an increased chance for inter-genotypic recombination can be a threat. Better understanding of the dynamics and persistence of the American type PRRSV strains related to MLV in herds infected with wild type EU genotype PRRSV as well as the level of possible cross protection between different EU and US types of PRRSV strains is essential for the development of successful PRRSV control programmes. However, this study has showed that at least in two-three-month-old piglets infected with the very diverse PRRSV-EU field strain, the use of heterologous PRRSV-US genotype vaccine did not show good cross protection. The results of our study clearly indicate that both EU and US genotype PRRSV strains were present at the same time in one animal. This was the first report of PRRSV-US infection in Lithuanian swine herd, but the farm had been using vaccine containing that type of the virus. Considering that this American type MLV was the only confirmed source of PRRSV-US strain in the herd and the sequence of the virus was very similar to that of the strain used in MLV it could be concluded that the circulating PRRSV-US type strain originated from the vaccine as it had been reported before (3, 16). Acknowledgments: This study was supported by the grant of the Lithuanian State Science and Studies Foundation No. T References 1. Andreyev V.G., Wesley R.D., Mengeling W.L., Vorwald A.C., Lager K.M.: Genetic variation and phylogenetic relationships of 22 porcine reproductive and respiratory syndrome virus (PRRSV) field strains based on sequence analysis of open reading frame 5. Arch Virol 1997, 142, Bautista E.M., Goyal S.M., Collins J.E.: Serologic survey for Lelystad and VR-2332 strains of porcine reproductive and respiratory syndrome (PRRS) virus in US swine herds. J Vet Diagn Invest 1993, 5, Botner A., Strandbygaard B., Sorensen K.J., Haven P., Madsen K.G., Alexandersen S.: Appearance of acute PRRSV-like symptoms in sow herds after vaccination with a modified live PRRS vaccine. Vet Rec 1997, 141, Forsberg R., Storgaard T., Nielsen H.S., Oleksiewicz M.B., Cordioli P., Sala G., Hein J., Botner A.: The genetic diversity of European type PRRSV is similar to that of the North American type but is geographically skewed within Europe. Virology 2002, 299, Halbur P.G., Paul R.S., Frey M.L., Landgraf J., Eernisse K., Meng X.J., Andrews J.J., Lum M.A., Rathje J.A.: Comparison of the antigen distribution of two US porcine reproductive and respiratory syndrome virus isolates with that of the Lelystad virus. Vet Pathol 1996, 33, Labarque G., Van Gucht S., Van Reeth K., Nauwynck H., Pensaert M.: Respiratory tract protection upon challenge of pigs vaccinated with attenuated porcine reproductive and respiratory syndrome virus vaccines. Vet Microbiol 2003, 95, Meng X. J.: Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet Microbiol 2000, 74, Meng X.J., Paul P.S., Halbur P.G., Lum M.A.: Phylogenetic analysis of the putative M (ORF6) and N (ORF7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): implication for the existence of two genotypes of PRRSV in the USA and Europe. Arch Virol 1995, 140, Meulenberg J., Hulst M., De Meijer E., Moonen P., De Kluyver E., Vensvoorte G., Moormann R.: Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 1993, 192, Meulenberg J., Petersen-den Besten E., De Kluyver R., Moormann W. Schaaper M., Wensvoort G.: Characterisation of proteins encoded by ORFs2 to 7 Lelystad virus. Virology 1995, 206, Nelson E.A., Christopher-Hennings J., Drew T., Wensvoort G., Collins J.E., Benfield D.A.: Differentiation of US and European isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies. J Clin Microbiol 1993, 31, Nielsen H.S., Oleksiewicz M. B., Forsberg R., Stadejek T., Botner A., Storgaard T.: Reversion of a live porcine reproductive and respiratory syndrome virus vaccine investigated by parallel mutations. J Gen Virol 2001, 82, Oleksiewicz M., Botner A., Madsen K., Storgaard T.: Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RT-PCR amplification of whole viral genes. Vet Microbiol 1998, 64, Stadejek T., Oleksiewicz M. B., Potapchuk D., Podgorska K.: Porcine reproductive and respiratory syndrome virus strains of exceptional diversity in eastern Europe support the definition of new genetic subtypes. J Gen Virol 2006, 87, Stadejek T., Stankevicius A., Storgaard T., Oleksiewicz M., Belak S., Drew T., Pejsak Z.: Identification of radically different variants of porcine reproductive and respiratory syndrome virus in Eastern Europe: towards a common ancestor for European and American viruses. J Gen Virol 2002, 83, Storgaard T., Oleksiewicz M., Botner A.: Examination of the selective pressures on a live PRRS vaccine virus. Arch Virol 1999, 144,

5 Suarez P., Zardoya R., Martin M.J., Prieto C., Dopazo J., Solana A., Castro J.M.: Phylogenetic relationships of European strains of porcine reproductive and respiratory syndrome virus (PRRSV) inferred from DNA sequences of putative ORF5 and ORF7 genes. Virus Res 1996, 42, Suarez P., Zaroya R., Prieto C., Solana A., Tabares E., Bautista J., Castro J.: Direct detection of the porcine reproductive and respiratory syndrome (PRRS) virus by reverse polymerase chain reaction (RT-PCR). Arch Virol 1994, 135, Umthun A., Mengeling W.: Restriction fragment length polymorphism analysis of strains of porcine reproductive and respiratory syndrome virus by use of a nested-set reverse transcriptase-polymerase chain reaction. Am J Vet Res 1999, 60, Van Woensel P.A. M., Liefkens K., Demaret S.: Effect on viraemia of an American and a European serotype PRRSV vaccine after challenge with European wild-type strains of the virus. Vet Rec 1998, 142,