PERSISTENCE OF EUROPEAN AND AMERICAN TYPE PRRSV STRAINS WITHIN LITHUANIAN PIG HERD
|
|
- Dennis Booth
- 5 years ago
- Views:
Transcription
1 Bull Vet Inst Pulawy 52, , 2008 PERSISTENCE OF EUROPEAN AND AMERICAN TYPE PRRSV STRAINS WITHIN LITHUANIAN PIG HERD ARUNAS STANKEVICIUS, RYTIS CEPULIS, HENRIKAS ZILINSKAS, TOMASZ STADEJEK 1, AND ZYGMUNT PEJSAK 1 Lithuanian Veterinary Academy, LT Kaunas, Lithuania 1 Department of Swine Diseases, National Veterinary Research Institute, Pulawy, Poland sarunas@lva.lt Received for publication July 16, 2008 Abstract The objective of this study was to evaluate the diversity and persistence of porcine reproductive and respiratory syndrome virus (PRRSV) in a swine herd where American type of modified live vaccine (MLV) was used. The study was carried out on the farrow-to-finish farm with sows, which had a history of endemic PRRSV manifested as periodic mini-outbreaks of PRRS. The farm has been endemically infected with PRRSV-EU since The vaccination programme with the MLV was first applied in 2001 and consisted of vaccinating all sows every six months and all gilts 60 d before farrowing. All incoming gilts were also vaccinated twice with a two-week interval. During the monitoring period, PRRSV-EU type was detected in 28 of 63 samples collected from two to three-month-old piglets. PRRSV-US type was detected in 20 samples. Nineteen samples were positive for both EU and US types of PRRSV at the same time. The results of RT-PCR testing serum samples from 58 sows were negative. ORF5 RT-PCR products from samples containing both PRRSV-EU and PRRSV-US types were sequenced. Phylogenetic analyses, showed a close relationship to the American genotype of PRRSV strains from the monitored farm to the known vaccine strain V2332 present in the American type PRRS MLV. The presence of the PRRSV-US in the two-three-month-old piglets indicates that the American type of vaccine virus has spread from vaccinated sows to the non-vaccinated piglets. Simultaneous presence of both PRRSV-EU and US strains in 19 samples suggests very low cross protection between the American type PRRS MLV and very diverse Lithuanian EU type field strains. In this situation an increased chance for inter-genotypic recombination can be a threat. Key words: swine, PRRS virus, vaccination, phylogenetic analysis. Porcine reproductive and respiratory syndrome virus (PRRSV) infection is considered one of the most important diseases in swine production today, being responsible for significant economic losses to the swine industry worldwide. One of the main characteristic features of PRRSV is its high variability. Several studies have described significant genetic differences between PRRSV isolates from Europe and North America (1, 9). Two genotypes of PRRSV are currently recognised: American (PRRSV-US) - and European (PRRSV-EU) - type strains. Both genotypes are only 55%-80% identical at the nucleotide level (17) and thought to derive from a common ancestor (8). Although PRRS is sometimes clinically similar in North America and in Europe, the strains of both genotypes differ in virulence (5) and antigenic (2, 11) and genetic properties (4, 8, 10). In spite of the fact that immune response to PRRSV is still not completely understood, some vaccines made from American- or European-type strains are being produced and marketed. Several studies have reported controversial results about the efficacy of vaccination with heterologous strains (7). It seems that Americantype vaccines are more effective in protecting against infections caused by American-type field strains and less effective against European-type field infections (20). However, it is obvious that some degree of protection against the heterologous genotype can be achieved (6). PRRSV-US field strains have been originally detected in North America and then introduced to European pig herds by the use of American type modified live vaccines (MLV) containing that type of the virus. On some occasions the virus of American type MLV had reverted to virulent strain after vaccinating naïve herds (12). In Lithuania, PRRS outbreaks were first observed in 1997, when new pig breeds were imported from Western Europe and introduced into local pig farms. However, the latest studies suggest that PRRSV must have been present in Lithuania before that time (15). Lithuanian PRRSV ORF5 and ORF7 sequences have been shown to belong to the genetic subtype 2 of PRRSV-EU genotype, grouping viruses, which are exceptionally different from the known strains circulating in Central and Western Europe (14, 15). It has to be noted that PRRSV-US genotype virus had also
2 320 been introduced into one Lithuanian pig herd through the use of a modified live vaccine made from US type isolate. The objective of this study was to evaluate the diversity and persistence of PRRSV strains in a swine herd where American type MLV was used and where exceptionally diverse Lithuanian PRRSV strain was detected before introducing the heterologous vaccine. Material and Methods Samples collection and RNA extraction. The study was carried out on the farrow-to-finish farm with sows, which had a history of endemic PRRSV infection manifested as periodic mini-outbreaks of PRRS. The farm has been infected with PRRSV-EU since The vaccination with American type PRRS MLV was first applied in 2001 to all population of sows every six months and to all gilts 60 d before farrowing. Prior to introduction into the herd, all the new incoming gilts were also vaccinated two times with an interval of two weeks. In 2003, the vaccination programme was stopped due to low efficacy and regulatory issues. Afterwards, the herd was checked several times from 2004 to 2006 and during this period 63 lung samples from dead two three-month-old piglets with respiratory disorders were collected together with 58 blood samples from sows with abortion and low number of piglets. RNA was extracted from the homogenates of the tissues and blood samples. RNA from 250 µl of serum or mg of the tissue were extracted using the "Total RNA Prep Plus" kit, according to the manufacturer s protocol (A&A Biotechnology, Poland). Following extraction, the RNA was eluted in 100 µl of RNase free water. RT-PCR protocol. All the collected samples were investigated by nested RT-PCR using primers specific for EU and US PRRSV strains (3).Total RNA was used as template in a single-tube reverse transcription nested PCR specific for ORF5 of EU-type and US-type PRRSV. In the first step, 5 µl of 22% trehalose was used to store and maintain the following mixture in the lid of 0.2 ml Eppendorf tubes: 20 pmol of each inner PRRSV-EU primers ORF5 (5 ATGAGATGTTCTCACAAATTGGGGCG -3') and ORF5R (5 CTAGGCCTCCCATTGCTCAGCCG AAGT3') (18) or PRRSV-US inner primers US ORF5B (5 GCTCCATTTCATGACACCTG -3 ) and US ORF5C (5 - AAAGGTGCAGAAGCCCTAGC -3 ) (9), 1 µl of dntps (10 mm), and 0.25 µl of Taq Polymerase (1.25 U, Fermentas, Lithuania). The tubes were left to dry for 2 h at room temperature prior to storage. In the next step, RT-PCR was performed in the bottom of the tubes containing the dried, trehalose-treated reagents within the lid. The amplification was carried out in 50 µl volumes containing 5 µl of RNA and the following reagents: 5 µl of 10x PCR buffer (Fermentas), 5 µl of MgCl 2 (25 mm, Fermentas), 2 µl of dntps (10 mm, Sigma), 5 pmol of each PPRSV-EU outer primers EUORF5B (5 CAATGAGGTGGGCIACAACC-3'), and EUORF5C (5'TATGTIATGCTAAAGGCTAGCAC3') (13) or PRRSV-US primers 208F (5 - GTACGGCGATAGGGACACC -3 ) and 331R (5 - CCAGAATGTACTTGCGGCC -3 ) (19), 1 µl of 10% Triton X-100 (Sigma), 0.5 µl (2.5 U) of Taq DNA polymerase (Fermentas), 0.25 µl (10 U) of RNasin (Promega, USA), and 0.5 µl (100 U) of MMLV reverse transcriptase (Life Technologies). Mineral oil was included to act as a vapour barrier between the RT-PCR reaction and the dried reagents within the lid. The tubes were then subjected to the following thermal cycling: 42 C for 30 min, 95 C for 5 min, and then 20 cycles at 94 C for 1 min, 55 C for 1 min, and 72 C for 1.5 min. The tubes were subsequently inverted several times to dissolve the dried reagents in the lid in order to initiate the nested PCR. The tubes were then centrifuged briefly before returning to the thermocycler for nested PCR, using 35 cycles of 94 C for 1 min, 55 C for 1 min, and 72 C for 1.5 min. A single extension step of 72 C for 10 min completed the amplification process. The RT-PCR resulted in a final amplicon of 606 bp for PRRSV-EU and 818 bp for PRRSV-US. DNA sequencing and phylogenetic analyses. Prior to sequencing, electrophoresis of the PCR products was performed on 1.5% agarose gel. After the ethidium bromide staining and desalting in ultrafiltered water, bands of the expected size were excised from the gel, and the DNA was recovered using Nucleospin Extract II kit (Macherey-Nagel, Germany) following the manufacturer s recommendations. Gel purified PCR products were cycle sequenced using the BigDye Terminator Cycle Sequencing kit (v2.0, Applied Biosystems, USA) and the ABI310 genetic analyser (Applied Bio-Systems, USA). Sequences of both strands of the ORF5 protein gene products were determined using the same EU and US primers as used for the nested PCR amplification. The obtained sequences were assembled by using SeqMan programme (Lasergene, programme package, DNASTAR, USA). Clustal W programme from MegAlign Lasergene programme package was used for sequence alignment and phylogenetic analyses. Results During the monitoring period, PRRSV-EU type was detected in 28 of 63 samples collected from twothree-month-old piglets. PRRSV-US type was detected in 20 samples. Nineteen samples were positive for both EU and US types of PRRSV. RT-PCR results from all serum samples of 58 sows were negative. Ten selected ORF5 PCR products from samples containing both PRRSV-EU and PRRSV-US types were sequenced and aligned with sequences available in the GenBank. Based on the sequences from the investigated farm and some selected EU-type ORF5 sequences from Lithuania, Belarus, Poland, and West European countries as well as US sequences, available in the GenBank, a phylogenetic tree was constructed (Fig. 1).
3 Lelystad NL 1991 Sel LV 2006 Porcilis PRRS vac NL Amervac PRRS vac NL Pyrsvac-183 vac E Che PL 2005 Sok-4 PL Yuz 2004 Zad BY 2004 Bel BY 2004 Zap BY 2004 Mik LV 2006 "S"farm LT 2004 "S"farm LT 2005 "S" farm LT 2006 Sno-4 Vas BY 2005 Bor BY 2004 Aus LT 2000 Kup LT 2007 Ber LT 2007 Eigi LT 2006 Canada 1994 Thai 2001 Jap Jap USA1205 Jap China USA HP Jap Ingelvac PRRS MLV vac VR-2332 USA "S" farm LT 2004 "S" farm LT Nucleotide Substitutions (x100) Fig. 1. A phylogenetic tree of the selected PRRSV strains downloaded from the GenBank and obtained in the present study, constructed with MegAlign programme from Lasergene package (DNASTAR). Clustal W algorithm was used for sequence alignment. European genotype PRRSV sequences from the farm were clearly different from West European sequences, as it was expected, and were grouped with other sequences from Lithuania. American genotype PRRSV sequences where closely related to VR2332 and the American type MLV sequences. The obtained US type sequences from the monitored farm showed 97.4% similarity to the American type PRRS MLV. Discussion Experimental studies have indicated that homologous EU type MLV vaccine was capable to reduce clinical signs, shorten persistence of viraemia in challenged pigs, and increase number of weaned piglets from gilts challenged with a European strain of PRRS virus. The vaccine was shown to have an effect against the heterologous challenge, although the protection was not complete. Experience from the field has indicated that the vaccination with the EU type strain may reduce mortality losses and increase daily weight gain in finishing and nursery pigs in herds with chronic losses due to infection with European strain of the virus (6). However, others have had negative experiences especially with the use of US type MLV. This modified live vaccine was spreading from vaccinated to nonvaccinated animals and the vaccine strain could be associated with a pathogenic effect in herds (3). A vaccine-like strain isolated from the field was demonstrated to have a pathogenic effect after experimental inoculation of the late-term pregnant sows (12). Two single mutations in the genome have been linked to the attenuation of the vaccine strain and the subsequent reversion to virulence (16). Furthermore, the reverted US type vaccine strain was capable of the spreading to other herds (3). Our study showed a close relationship of American genotype PRRSV strains from the investigated farm to strains V2332 or American type
4 322 PRRS MLV strain, which clearly points at its origin from the vaccine used in the farm. The presence of the PRRSV-US in two-three-month-old piglets born 1-3 years after vaccination programme was stopped, indicates that the vaccine virus had spread from vaccinated sows to non-vaccinated piglets and was persisting in the herd. Furthermore, sequences were not identical to the American type PRRS MLV (97.4%) that could suggest the prolonged circulation of at least several years of the MLV related strain in weaners of this farm resulting in a significant antigenic drift. The fact that vaccine related PRRSV-US strain was circulating within the monitored farm for more than one year after the vaccination was stopped indicates that the vaccine strain partially reverted to virulence (12). Simultaneous presence of PRRSV-EU and US strains in 19 samples could suggest a very low cross protection between the US type MLV and the very diverse Lithuanian field strains (15). In this situation an increased chance for inter-genotypic recombination can be a threat. Better understanding of the dynamics and persistence of the American type PRRSV strains related to MLV in herds infected with wild type EU genotype PRRSV as well as the level of possible cross protection between different EU and US types of PRRSV strains is essential for the development of successful PRRSV control programmes. However, this study has showed that at least in two-three-month-old piglets infected with the very diverse PRRSV-EU field strain, the use of heterologous PRRSV-US genotype vaccine did not show good cross protection. The results of our study clearly indicate that both EU and US genotype PRRSV strains were present at the same time in one animal. This was the first report of PRRSV-US infection in Lithuanian swine herd, but the farm had been using vaccine containing that type of the virus. Considering that this American type MLV was the only confirmed source of PRRSV-US strain in the herd and the sequence of the virus was very similar to that of the strain used in MLV it could be concluded that the circulating PRRSV-US type strain originated from the vaccine as it had been reported before (3, 16). Acknowledgments: This study was supported by the grant of the Lithuanian State Science and Studies Foundation No. T References 1. Andreyev V.G., Wesley R.D., Mengeling W.L., Vorwald A.C., Lager K.M.: Genetic variation and phylogenetic relationships of 22 porcine reproductive and respiratory syndrome virus (PRRSV) field strains based on sequence analysis of open reading frame 5. Arch Virol 1997, 142, Bautista E.M., Goyal S.M., Collins J.E.: Serologic survey for Lelystad and VR-2332 strains of porcine reproductive and respiratory syndrome (PRRS) virus in US swine herds. J Vet Diagn Invest 1993, 5, Botner A., Strandbygaard B., Sorensen K.J., Haven P., Madsen K.G., Alexandersen S.: Appearance of acute PRRSV-like symptoms in sow herds after vaccination with a modified live PRRS vaccine. Vet Rec 1997, 141, Forsberg R., Storgaard T., Nielsen H.S., Oleksiewicz M.B., Cordioli P., Sala G., Hein J., Botner A.: The genetic diversity of European type PRRSV is similar to that of the North American type but is geographically skewed within Europe. Virology 2002, 299, Halbur P.G., Paul R.S., Frey M.L., Landgraf J., Eernisse K., Meng X.J., Andrews J.J., Lum M.A., Rathje J.A.: Comparison of the antigen distribution of two US porcine reproductive and respiratory syndrome virus isolates with that of the Lelystad virus. Vet Pathol 1996, 33, Labarque G., Van Gucht S., Van Reeth K., Nauwynck H., Pensaert M.: Respiratory tract protection upon challenge of pigs vaccinated with attenuated porcine reproductive and respiratory syndrome virus vaccines. Vet Microbiol 2003, 95, Meng X. J.: Heterogeneity of porcine reproductive and respiratory syndrome virus: implications for current vaccine efficacy and future vaccine development. Vet Microbiol 2000, 74, Meng X.J., Paul P.S., Halbur P.G., Lum M.A.: Phylogenetic analysis of the putative M (ORF6) and N (ORF7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): implication for the existence of two genotypes of PRRSV in the USA and Europe. Arch Virol 1995, 140, Meulenberg J., Hulst M., De Meijer E., Moonen P., De Kluyver E., Vensvoorte G., Moormann R.: Lelystad virus, the causative agent of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV and EAV. Virology 1993, 192, Meulenberg J., Petersen-den Besten E., De Kluyver R., Moormann W. Schaaper M., Wensvoort G.: Characterisation of proteins encoded by ORFs2 to 7 Lelystad virus. Virology 1995, 206, Nelson E.A., Christopher-Hennings J., Drew T., Wensvoort G., Collins J.E., Benfield D.A.: Differentiation of US and European isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies. J Clin Microbiol 1993, 31, Nielsen H.S., Oleksiewicz M. B., Forsberg R., Stadejek T., Botner A., Storgaard T.: Reversion of a live porcine reproductive and respiratory syndrome virus vaccine investigated by parallel mutations. J Gen Virol 2001, 82, Oleksiewicz M., Botner A., Madsen K., Storgaard T.: Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RT-PCR amplification of whole viral genes. Vet Microbiol 1998, 64, Stadejek T., Oleksiewicz M. B., Potapchuk D., Podgorska K.: Porcine reproductive and respiratory syndrome virus strains of exceptional diversity in eastern Europe support the definition of new genetic subtypes. J Gen Virol 2006, 87, Stadejek T., Stankevicius A., Storgaard T., Oleksiewicz M., Belak S., Drew T., Pejsak Z.: Identification of radically different variants of porcine reproductive and respiratory syndrome virus in Eastern Europe: towards a common ancestor for European and American viruses. J Gen Virol 2002, 83, Storgaard T., Oleksiewicz M., Botner A.: Examination of the selective pressures on a live PRRS vaccine virus. Arch Virol 1999, 144,
5 Suarez P., Zardoya R., Martin M.J., Prieto C., Dopazo J., Solana A., Castro J.M.: Phylogenetic relationships of European strains of porcine reproductive and respiratory syndrome virus (PRRSV) inferred from DNA sequences of putative ORF5 and ORF7 genes. Virus Res 1996, 42, Suarez P., Zaroya R., Prieto C., Solana A., Tabares E., Bautista J., Castro J.: Direct detection of the porcine reproductive and respiratory syndrome (PRRS) virus by reverse polymerase chain reaction (RT-PCR). Arch Virol 1994, 135, Umthun A., Mengeling W.: Restriction fragment length polymorphism analysis of strains of porcine reproductive and respiratory syndrome virus by use of a nested-set reverse transcriptase-polymerase chain reaction. Am J Vet Res 1999, 60, Van Woensel P.A. M., Liefkens K., Demaret S.: Effect on viraemia of an American and a European serotype PRRSV vaccine after challenge with European wild-type strains of the virus. Vet Rec 1998, 142,
Keywords: PRRSV, wild boar, seroprevalence, phylogenetic analyses
54 EUROPRRS2011, Novi Sad, Serbia PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME VIRUS (PRRSV) INFECTION IN LITHUANIAN WILD BORS (SUS SCROFA) POPULATION Arunas Stankevicius 1, Jurate Buitkuviene 1, Jurgita
More informationOriginal Paper Veterinarni Medicina, 51, 2006 (8):
Restriction fragment length polymorphism of ORF6 and ORF7 genes of porcine reproductive and respiratory syndrome virus (PRRSV) vaccine strains registered in the Czech Republic E. KOSINOVA, I. PSIKAL Veterinary
More informationRespiratory tract protection upon challenge of pigs vaccinated with attenuated porcine reproductive and respiratory syndrome virus vaccines
Veterinary Microbiology 95 (2003) 187 197 Respiratory tract protection upon challenge of pigs vaccinated with attenuated porcine reproductive and respiratory syndrome virus vaccines G. Labarque, S. Van
More informationGenetic diversity and phylogenetic analysis of glycoprotein 5 of European-type porcine reproductive and respiratory virus strains in Spain
Journal of General Virology (2003), 84, 529 534 DOI 10.1099/vir.0.18478-0 Short Communication Genetic diversity and phylogenetic analysis of glycoprotein 5 of European-type porcine reproductive and respiratory
More informationEdinburgh Research Explorer
Edinburgh Research Explorer Comparison of molecular and biological characteristics of a modified live porcine reproductive and respiratory syndrome virus (PRRSV) vaccine (Ingelvac PRRS MLV), the parent
More informationThe PRRS vaccine for the entire herd. H appy to. be healthy. Licensed. in breeding pigs and piglets. from weeks of age
The PRRS vaccine for the entire herd H appy to be healthy Licensed in breeding pigs and piglets 2 from weeks of age P orcine Reproductive and Respiratory Syndrome, endemic in most pig producing countries,
More informationGenetic Diversity Characterization of Porcine Reproductive and Respiratory Syndrome Virus Isolates in Romania, Based on Phylogenetic Analysis
Int. J. Mol. Sci. 2012, 13, 12046-12061; doi:10.3390/ijms130912046 Article OPEN ACCESS International Journal of Molecular Sciences ISSN 1422 0067 www.mdpi.com/journal/ijms Genetic Diversity Characterization
More informationPatrick L. Graham, DVM, MS
MJ PRRS Vaccine: Field efficacy Patrick L. Graham, DVM, MS Peggy Anne Hawkins, DVM, MS Farm Introduction Fall 2008 4/5 year old sow farm 6400 sows 2 previous PRRSV outbreaks Serum therapy Sows and GDU
More informationThis article is the result of review
Peer reviewed Diagnostic notes Porcine reproductive and respiratory syndrome (PRRS) diagnostics: Interpretation and limitations Jane Christopher-Hennings, DVM, MS; Kay S. Faaberg, PhD; Michael P. Murtaugh,
More informationPorcine Reproductive and Respiratory Syndrome Virus
Compilation of experimental investigations of PRRS vaccine technologies using modified live vaccines, inactivated vaccines and immunomodulation Michael Roof, PhD, Executive Director of Bio-Research Boehringer
More informationDrew Robert Magstadt Iowa State University. Iowa State University Capstones, Theses and Dissertations. Graduate Theses and Dissertations
Graduate Theses and Dissertations Iowa State University Capstones, Theses and Dissertations 2015 Cross-protection in Fostera PRRS vaccinated nursery swine against contemporary, heterologous porcine reproductive
More informationNEW CONCEPTS FOR THE CONTROL OF PRRS: WITHIN PIG STRATEGIES
NEW CONCEPTS FOR THE CONTROL OF PRRS: WITHIN PIG STRATEGIES Monte B. McCaw Department of Population Health and Pathobiology North Carolina State University Past problems PRRS is the most demoralizing swine
More informationSponsors. Production Assistants Steven Claas Lynn Leary. Layout David Brown
Sponsors University of Minnesota College of Veterinary Medicine College of Agricultural, Food and Environmental Sciences Extension Service Swine Center Production Assistants Steven Claas Lynn Leary Layout
More informationPorcine reproductive and respiratory
Peer reviewed Original research Genetic interaction between porcine reproductive and respiratory syndrome virus (PRRSV) strains in cell culture and in animals Michael P. Murtaugh, PhD; Shishan Yuan, PhD;
More informationProceedings of the 21st International Pig Veterinary Society Congress IPVS
www.ivis.org Proceedings of the 21st International Pig Veterinary Society Congress IPVS Jul. 18 21, 2010 Vancouver, Canada Next congress: 22nd International Pig Veterinary Society Congress June 10-13,
More informationA new recombined porcine reproductive and respiratory syndrome virus virulent strain in China
Original Article J Vet Sci 2018, 19(1), 89-98 ㆍ https://doi.org/10.4142/jvs.2018.19.1.89 JVS A new recombined porcine reproductive and respiratory syndrome virus virulent strain in China Jian-guo Dong
More informationNorgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information
More informationPorcine reproductive and respiratory
Original research Peer reviewed Genetic diversity and possible avenues of dissemination of porcine reproductive and respiratory syndrome virus in two geographic regions of Mexico Laura Batista, DVM, PhD;
More informationUnusual severe cases of type 1 porcine reproductive and respiratory syndrome virus (PRRSV) infection in conventionally reared pigs in South Korea
Lyoo et al. BMC Veterinary Research (2015) 11:272 DOI 10.1186/s12917-015-0584-5 CASE REPORT Unusual severe cases of type 1 porcine reproductive and respiratory syndrome virus (PRRSV) infection in conventionally
More informationNorgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended
More informationA Systematic Management Strategy for Breeding Herds Based on PRRS Herd Status
A Systematic Management Strategy for Breeding Herds Based on PRRS Herd Status James F. Lowe, DVM,MS 1,2 and committee members, Neil Debuse, DVM, MS 3, Robert Morrison, DVM, PhD, MBA 4, Montserrat Torremorell,
More informationDevelopment of Real-time, multiplex PCR/RT-PCR assays for improved PRDC pathogen detection - NPB #03-114
Title: Investigator: Institution: Development of Real-time, multiplex PCR/RT-PCR assays for improved PRDC pathogen detection - NPB #03-114 Steven B. Kleiboeker University of Missouri Date Received: June
More informationNÔNG LÂM UNIVERSITY VIET NAM DEPARTMENT OF BIOTECHNOLOGY. Diagnosis and Genetic analysis of some viruses caused emerging diseases in pig in Vietnam
NÔNG LÂM UNIVERSITY VIET NAM DEPARTMENT OF BIOTECHNOLOGY Diagnosis and Genetic analysis of some viruses caused emerging diseases in pig in Vietnam Võ Khánh Hưng 1 Main Contents Genetic analysis of PRRSV
More informationPRRS control and eradication in a production system
PRRS control and eradication in a production system Tara S. Donovan, DVM The Hanor Company of Wisconsin, LLC, Spring Green, Wisconsin Introduction The HANOR Company is a pork production company located
More informationEffect of various stocking methods and extra-label PRRS vaccination on average daily gain
ORIGINAL RESEARCH Sornsen SA, Zimmerman JJ, Roof MB. Effect of various stocking methods and extra-label PRRS vaccination on average daily gain. Swine Health and Production. 1998;6(1):7 11. Effect of various
More informationReassortment of influenza A virus genes linked to PB1 polymerase gene
International Congress Series 1263 (2004) 714 718 Reassortment of influenza A virus genes linked to PB1 polymerase gene Jean C. Downie* www.ics-elsevier.com Centre for Infectious Diseases and Microbiology,
More informationPRRSV: Comparison of commercial vaccines in their ability to induce protection against current PRRSV strains of high virulence
PRRSV: Comparison of commercial vaccines in their ability to induce protection against current PRRSV strains of high virulence Osorio 1, F.A., MS, DVM, PhD.; Zuckermann 2, F.; Wills 1 R.; Meier 2, W.;
More informationM. hyo. M. hyo. M. hyo. Single injection. Double protection. Ready-to-use protection against both PCV2 and M. hyo. It s easy. It works.
M. hyo P C V 2 P C V 2 M. hyo M. hyo P C V 2 Single injection. Double protection. Single injection. Double protection. Ready-to-use protection against both PCV2 and M. hyo. PCV M Hyo It s easy. It works.
More informationGyula Balka 1*, Karla Dreckmann 2, György Papp 3 and Christian Kraft 2
Balka et al. Porcine Health Management (216) 2:24 DOI 1.1186/s4813-16-37-y RESEARCH Vaccination of piglets at 2 and 3 weeks of age with Ingelvac PRRSFLEX EU provides protection against heterologous field
More informationUse of an Experimental Model To Test the Efficacy of Planned Exposure to Live Porcine Reproductive and Respiratory Syndrome Virus
CLINICAL AND VACCINE IMMUNOLOGY, Dec. 2007, p. 1572 1577 Vol. 14, No. 12 1556-6811/07/$08.00 0 doi:10.1128/cvi.00332-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Use of an
More informationPRRS Control Practitioner s View. John Hayden BVSc MRCVS Integra Veterinary Services
PRRS Control Practitioner s View John Hayden BVSc MRCVS Integra Veterinary Services PRRS diagnoses trend and seasonality (data for Q3 and 2015 incomplete) Viruses PRRS and swine flu predominant PCV2 associated
More informationOIE Reference Laboratory Reports Activities
OIE Reference Laboratory Reports Activities Activities in 2016 This report has been submitted : 2017-01-18 11:31:50 Name of disease (or topic) for which you are a designated OIE Reference Laboratory: Porcine
More informationCASE REPORT. Using vaccination and unidirectional pig flow to control PRRSV transmission. Summary. Materials and methods.
CASE REPORT Using vaccination and unidirectional pig flow to control PRRSV transmission Scott A Dee, DVM, PhD, Dipl; ACVM; Reid Philips, DVM Dee S, Philips R. Using vaccination and unidirectional pig flow
More informationLoad reduction in live PRRS vaccines using oil and polymer adjuvants
Available online at www.sciencedirect.com Procedia in Vaccinology 6 (2012 ) 134 140 5 th Vaccine and ISV Global Annual Congress Load reduction in live PRRS vaccines using oil and polymer adjuvants Sebastien
More informationProduct # Kit Components
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Pneumocystis jirovecii PCR Kit Product # 42820 Product Insert Background Information
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationSponsors. Production Assistant Janice Storebo. Formatting Tina Smith. CD-ROM David Brown
Sponsors University of Minnesota College of Veterinary Medicine College of Food, Agricultural and Natural Resource Sciences Extension Service Swine Center Thank you to IDEXX Laboratories for their financial
More informationHepatitis B Virus Genemer
Product Manual Hepatitis B Virus Genemer Primer Pair for amplification of HBV Viral Specific Fragment Catalog No.: 60-2007-10 Store at 20 o C For research use only. Not for use in diagnostic procedures
More informationPorcine Respiratory and Reproductive Syndrome Virus Vaccinology: A Review for Commercial Vaccines
American Journal of Animal and Veterinary Sciences, 2012, 7 (4), 149-158 ISSN: 1557-4555 2012 J.E. Larson et al., This open access article is distributed under a Creative Commons Attribution (CC-BY) 3.0
More informationIntroduction REGULAR ARTICLES
DOI 10.1007/s11250-016-1099-1 REGULAR ARTICLES Efficacy of Fostera PRRS modified live virus (MLV) vaccination strategy against a Thai highly pathogenic porcine reproductive and respiratory syndrome virus
More informationKit Components Product # EP42720 (24 preps) MDx 2X PCR Master Mix 350 µl Cryptococcus neoformans Primer Mix 70 µl Cryptococcus neoformans Positive
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cryptococcus neoformans End-Point PCR Kit Product# EP42720 Product
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationPRRS immunology: what are we missing?
PRRS immunology: what are we missing? A typical starting point for learning about the immune response of pigs to PRRSV is the standard model of anti-viral immunity. Primary infection of a host cell triggers
More informationThe Creation of a Vaccine for Porcine Reproductive and Respiratory Syndrome Virus. Presented by Justin Hsing Briarcliff High School
The Creation of a Vaccine for Porcine Reproductive and Respiratory Syndrome Virus Presented by Justin Hsing Briarcliff High School Purpose and Goals Create an effective vaccine against PRRSV Currently
More informationA two-year follow-up study of the PCV2 status of a Danish pig herd that was initially assumed to be PCV2-free
Kristensen et al. Porcine Health Management 2015, 1:5 RESEARCH Open Access A two-year follow-up study of the PCV2 status of a Danish pig herd that was initially assumed to be PCV2-free Charlotte S Kristensen
More informationPEDV in the US: Overview, history and lessons
PEDV in the US: Overview, history and lessons 3rd International Biosafety & Biocontainment Symposium: Bio-risk Management in a One Health World Baltimore, MD February 4, 2015 Dr. Derald Holtkamp, Iowa
More informationVaccination and Control of PRRS
Vaccination and Control of PRRS Key Contributors Univ of Minnesota RP Mulupuri Zhengguo Xiao Craig Johnson Juan Li Sally Robinson Scott Dee Pipestone Vet Clinic Jeff Zimmerman Iowa State Paul Yeske Swine
More informationOriginal Article Identification of Different Serotypes of Infectious Bronchitis Viruses in Allantoic Fluid Samples with Single and Multiplex RT- PCR
Iranian Journal of Virology 2009;3(2): 24-29 2009, Iranian Society for Virology Original Article Identification of Different Serotypes of Infectious Bronchitis Viruses in Allantoic Fluid Samples with Single
More informationPorcine reproductive and respiratory syndrome virus (PRRSV): Immunization strategies, virulence of various isolates, and efficacy of DNA vaccination
Graduate Theses and Dissertations Graduate College 2009 Porcine reproductive and respiratory syndrome virus (PRRSV): Immunization strategies, virulence of various isolates, and efficacy of DNA vaccination
More informationEvolution of influenza
Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal
More informationCHARACTERISATION OF INFECTIOUS BURSAL DISEASE VIRUS AND DETERMINATION OF POSSIBLE VACCINE STRAIN(S) IN KENYA
CHARACTERISATION OF INFECTIOUS BURSAL DISEASE VIRUS AND DETERMINATION OF POSSIBLE VACCINE STRAIN(S) IN KENYA Investigator: Dr. Mutinda, W.U (BVM, MSc.) Supervisors: Prof. P.N Nyaga, BVM, MSc, PhD Prof.
More informationARTICLE IN PRESS Journal of Virological Methods xxx (2011) xxx xxx
G Model ARTICLE IN PRESS Journal of Virological Methods xxx (2011) xxx xxx Contents lists available at SciVerse ScienceDirect Journal of Virological Methods jou rn al h om epage: www.elsevier.com/locate/jviromet
More informationSEROPREVALENCE OF ANTIBODIES AGAINST SWINE INFLUENZA VIRUS IN PIGS OF DIFFERENT AGE
Bull Vet Inst Pulawy 49, 3-7, 2005 SEROPREVALENCE OF ANTIBODIES AGAINST SWINE INFLUENZA VIRUS IN PIGS OF DIFFERENT AGE IWONA MARKOWSKA-DANIEL 1 AND ARUNAS STANKEVICIUS 2 1 Department of Swine Diseases,
More informationGuideline on the procedure to be followed when a batch of a vaccine finished product is suspected to be contaminated with bovine viral diarrhoea virus
1 2 3 15 January 2015 EMA/CVMP/IWP/205351/2006-Rev.1 Committee for Medicinal Products for Veterinary Use (CVMP) 4 5 6 7 Guideline on the procedure to be followed when a batch of a vaccine finished product
More informationFRA Swine Bioscwin Leman China Swine Conference
FRA Swine 2016 Bioscwin Leman China Swine Conference Content 1. Welcome: Challenge Question 2. The origin of FRA C12 Dry 3. What is FRA C12 Dry 4. PRRS in Swine Industry 5. FRA C12 versus PRRS 6. Summary:
More informationCytomegalovirus (CMV) End-Point PCR Kit Product# EP36300
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Cytomegalovirus (CMV) End-Point PCR Kit Product# EP36300 Product
More informationFirst Pandemic H1N1 Outbreak from a Pig Farm in Italy
52 The Open Virology Journal, 2010, 4, 52-56 First Pandemic H1N1 Outbreak from a Pig Farm in Italy Open Access Ana Moreno *,1, Livia Di Trani 2, Loris Alborali 1, Gabriele Vaccari 2, Ilaria Barbieri 1,
More informationInstructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.
More informationMicropathology Ltd. University of Warwick Science Park, Venture Centre, Sir William Lyons Road, Coventry CV4 7EZ
www.micropathology.com info@micropathology.com Micropathology Ltd Tel 24hrs: +44 (0) 24-76 323222 Fax / Ans: +44 (0) 24-76 - 323333 University of Warwick Science Park, Venture Centre, Sir William Lyons
More informationExpression and diagnostic use of recombinant M protein of the porcine reproductive and respiratory syndrome virus
ACTA VET. BRNO 2017, 86: 11 17; https://doi.org/10.2754/avb201786010011 Expression and diagnostic use of recombinant M protein of the porcine reproductive and respiratory syndrome virus Jitka Frölichová
More informationDiagnostic Methods of HBV and HDV infections
Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection
More informationHuman parainfluenza virus type 2 hemagglutininneuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009
Almajhdi et al. Virology Journal 2012, 9:316 SHORT REPORT Open Access Human parainfluenza virus type 2 hemagglutininneuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009
More informationSequence Analysis and Expression of ORF5 in Korean Isolate of Porcine Reproductive and Respiratory Syndrome Virus
Journal of Bacteriology and Virology 2011. Vol. 41, No. 3 p.173 181 http://dx.doi.org/10.4167/jbv.2011.41.3.173 Original Article Sequence Analysis and Expression of ORF5 in Korean Isolate of Porcine Reproductive
More informationWhat it feels like to have PRRS on your farm Dr. Carlo Lasagna. Martini S.p.A. Italy
What it feels like to have PRRS on your farm Dr. Carlo Lasagna Martini S.p.A. Italy Agenda Introduction: the battlefield, the pigs, the viruses Disease impact: from psychology to economy passing through
More informationCUSTOMIZED CONTROL. Because every herd is unique
TM CUSTOMIZED CONTROL Because every herd is unique The FLEX Family of swine vaccines puts you in control CUSTOMIZED CONTROL FOR MANAGING MAJOR RESPIRATORY DISEASES IN YOUR SWINE HERD Porcine Circovirus
More informationHuman Immunodeficiency Virus-1 (HIV-1) Genemer. Primer Pair for amplification of HIV-1 Specific DNA Fragment
Product Manual Human Immunodeficiency Virus-1 (HIV-1) Genemer Primer Pair for amplification of HIV-1 Specific DNA Fragment Catalog No.: 60-2002-10 Store at 20 o C For research use only. Not for use in
More informationFIREWALL. The trivalent flu protection
FIREWALL The trivalent flu protection Profile Influenza Pathogen: Influenza A virus, Orthomyxoviridae Subtypes are classified depending on the presence of hemagglutinin (HA) and neuraminidase (NA) on the
More informationPorcilis PRRS and Porcilis M Hyo
Porcilis PRRS and Porcilis M Hyo can now be mixed Protect against two top respiratory pathogens with one less injection Two important respiratory vaccines can now be mixed Porcilis PRRS and can now be
More informationDetection of equine infectious anemia nucleic acid in asymptomatic carrier horses by nested PCR
Asian Biomedicine Vol. 4 No. 6 December 2010; 971-975 Brief communication (Original) Detection of equine infectious anemia nucleic acid in asymptomatic carrier horses by nested PCR Sunutcha Suntrarachun
More informationInstructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN
Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona
More informationPorcine reproductive and respiratory syndrome virus: Genetic diversity of recent British isolates
Veterinary Microbiology 162 (2013) 507 518 Contents lists available at SciVerse ScienceDirect Veterinary Microbiology jo u rn al ho m epag e: ww w.els evier.c o m/lo cat e/vetmic Porcine reproductive and
More information1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal swine Influenza A vir
New Influenza A Virus Real Time RT-PCR Kit User Manual LT028310RRFY - 1 - 1. Intended Use New Influenza A virus real time RT-PCR Panel is used for the detection of universal influenza A virus, universal
More informationTatjana Sattler 1,2*, Jutta Pikalo 2, Eveline Wodak 2 and Friedrich Schmoll 2
Sattler et al. BMC Veterinary Research (2016) 12:259 DOI 10.1186/s12917-016-0888-0 RESEARCH ARTICLE Ability of ELISAs to detect antibodies against porcine respiratory and reproductive syndrome virus in
More informationShort communication. Xiang-Jin Meng,l,z t Prem S. Paul, 1,2. Igor Morozov 1 and Patrick G. Halbur 1'3
Journal of General Virology (996),, 65-0. Printed in Great Britain 65 Short communication A nested set of six or seven subgenomic mrnas is formed in cells infected with different isolates of porcine reproductive
More informationRegional PRRS eradication. Anders Elvstroem, DVM Svinepraksis.dk
Regional PRRS eradication Anders Elvstroem, DVM Svinepraksis.dk Introduction Introduction Svinepraksis.dk provides veterinary service for 250 swine herds Most herds are located in Eastern Jutland Eastern
More informationInvestigation on Infectious Agents of Aborted Pig Fetuses and Its Correlation with PRRSV MLV Vaccine
Journal of Agricultural Science and Technology A 7 (2017) 282-287 doi: 10.17265/2161-6256/2017.04.006 D DAVID PUBLISHING Investigation on Infectious Agents of Aborted Pig Fetuses and Its Correlation Woo-Taek
More informationGang Wang 1, Yuli He 1, Yabin Tu 1, Yonggang Liu 1, En-Min Zhou 2, Zifeng Han 1,3, Chenggang Jiang 1, Shujie Wang 1, Wenda Shi 1 and Xuehui Cai 1*
Wang et al. Virology Journal 2014, 11:2 SHORT REPORT Open Access Comparative analysis of apoptotic changes in peripheral immune organs and lungs following experimental infection of piglets with highly
More informationExperiences on Mycoplasma Hyopneumoniae Elimination on Farrow-to-Wean Farms. Bill Minton DVM. Four Star Veterinary Service LLC.
Experiences on Mycoplasma Hyopneumoniae Elimination on Farrow-to-Wean Farms Bill Minton DVM. Four Star Veterinary Service LLC. Chickasaw, OH Applications of Disease Eliminations WHY? Unwanted Guests PRRS
More informationDETECTION AND SUBTYPING OF SWINE INFLUENZA VIRUSES IN CLINICAL SAMPLES BY THE MEAN OF DEVELOPED MULTIPLEX POLYMERASE CHAIN REACTION ASSAYS
Bull Vet Inst Pulawy 53, 319-325, 2009 DETECTION AND SUBTYPING OF SWINE INFLUENZA VIRUSES IN CLINICAL SAMPLES BY THE MEAN OF DEVELOPED MULTIPLEX POLYMERASE CHAIN REACTION ASSAYS ANDRZEJ KOWALCZYK AND IWONA
More informationPorcine reproductive and respiratory syndrome virus (PRRSV)
Comparison of Commercial Real-Time Reverse Transcription-PCR Assays for Reliable, Early, and Rapid Detection of Heterologous Strains of Porcine Reproductive and Respiratory Syndrome Virus in Experimentally
More informationMINNESOTA VOLUNTARY PRRS ELIMINATION PROJECT. Pork Lenders Meeting July 29, 2011 Dave Wright, D.V.M.
MINNESOTA VOLUNTARY PRRS ELIMINATION PROJECT Pork Lenders Meeting July 29, 2011 Dave Wright, D.V.M. Coordinator Minnesota Voluntary Regional PRRS Elimination Project N212 Funding USDA APHIS PRRS CAP AASV
More informationEAPA. Spray Dried Porcine Plasma. A Safe and Vital Feed Ingredient EUROPEAN ANIMAL PROTEIN ASSOCIATION
IATION Spray Dried Porcine Plasma A Safe and Vital Feed Ingredient Plasma is Safe represents all European blood products producers. members have manufacturing plants in EU (France, Belgium, United Kingdom,
More informationDevelopment of highly pathogenic avian in uenza and Newcastle disease surveillance means on the basis of molecular and genetic techniques
ISSN: 2312-3370, Agricultural Science and Practice, 2014, Vol. 1, No. 3 UDC 619:636.5:619.578.832.1 Development of highly pathogenic avian in uenza and Newcastle disease surveillance means on the basis
More informationPRRSV Control and Elimination in Canada
PRRSV Control and Elimination in Canada Doug MacDougald DVM, South West Ontario Veterinary Services, 219 Oak Street, Stratford, ON N5A 8A1; Email: dmacdougald@southwestvets.ca Introduction Several PRRSV
More informationEconomic Impacts of Porcine Reproductive and Respiratory Syndrome (PRRS) Outbreak in Vietnam Pig Production
Tropical Agricultural Research Vol. 23 (2): 152 159 (2012) Economic Impacts of Porcine Reproductive and Respiratory Syndrome (PRRS) Outbreak in Vietnam Pig Production H. Zhang * and H. Kono 1 Department
More informationSwine Biosecurity Practices
Swine Biosecurity Practices 3rd International Biosafety & Biocontainment Symposium: Bio-risk Management in a One Health World Baltimore, MD February 4, 2015 Dr. Derald Holtkamp, Iowa State University Outline
More informationHigh Failure Rate of the ViroSeq HIV-1 Genotyping System for Drug Resistance Testing in Cameroon, a Country with Broad HIV-1 Genetic Diversity
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2011, p. 1635 1641 Vol. 49, No. 4 0095-1137/11/$12.00 doi:10.1128/jcm.01478-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. High Failure
More informationProduction results from piglets vaccinated in a field study in Spain with a Type 1 Porcine Respiratory and Reproductive virus modified live vaccine
Cano et al. Porcine Health Management (2016) 2:22 DOI 10.1186/s40813-016-0038-x RESEARCH Open Access Production results from piglets vaccinated in a field study in Spain with a Type 1 Porcine Respiratory
More informationISOLATION AND ID ENTIFICATION OF PORCINE REPROD UCTIVE AND RESPIRATORY SY ND ROME ( PRRS) VIRUS IN CHINA
1997,20 (3) : 82 86 Journal of N anjing A gricult ural U niversity Ξ (, 210095) 7, Marc2145 4 3 J1 J2 J3 (56,1 h), 30 80 nm, 80 100 nm, Marc2145,52 22 (BUDR), 3 ( PRRSV), PRRSV ; ; S8581280153 ISOLATION
More informationOutbreaks and control of swine influenza viruses in Korea
Inception meeting of the OIE/JTF Project for Controlling Zoonoses in Asia under One Health Concept Outbreaks and control of swine influenza viruses in Korea Tokyo, Japan, 19-20, December 2013 Yeun-Kyung
More informationUsing polymerase chain reaction to obtain PRRSV-free piglets from endemically infected herds
CASE REPORT Donadeu M, Arias M, Gomez-Tejedor C, et al. Using polymerase chain reaction to obtain PRRSV-free piglets from endemically infected herds. Swine Health Prod. 1999;7(6):255 261. Using polymerase
More informationMaterial and methods. Challenge The pigs were challenged at 16 weeks of age when the challenge control pigs became antibody negative by the
Evaluation of the efficacy of Mycoplasma hyopneumoniae bacterin following immunization of young pigs in the presence of varying levels of maternal antibodies H. Jayappa * MVSc, PhD, R. Davis BS, V. Rapp-Gabrielson
More informationEmergence of a virulent porcine reproductive and respiratory syndrome virus (PRRSV) 1 strain in Lower Austria
Sinn et al. Porcine Health Management (2016) 2:28 DOI 10.1186/s40813-016-0044-z CASE REPORT Open Access Emergence of a virulent porcine reproductive and respiratory syndrome virus (PRRSV) 1 strain in Lower
More informationAfrican swine fever in Lithuania. SCoFcAH 21 August 2014, State Food and Veterinary Service, Lithuania
African swine fever in Lithuania SCoFcAH 21 August 2014, State Food and Veterinary Service, Lithuania 1 2 ASF positive wild boar cases on 24 of January 2014 Primary outbreak of ASF (ASF/1) in domestic
More informationE E Hepatitis E SARS 29, Lancet. E A B Enterically-Transmitted Non-A, Hepatitis E. Virus HEV nm. 1.35g/cm s ALT AST HEV HEV
7850 2004 Hepatitis E Tian-Cheng LI Naokazu TAKEDA Tatsuo MIYAMURA SARS 8 Lancet E E E Hepatitis E VirusHEV E E HEV HEV E 1955 29,000 E E A A B Enterically-Transmitted Non-A, Non-B Hepatitis 1983 Balayan
More informationHIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis
Product Manual HIV-1 Genemer Detection Kit Ready to Use Amplification Kit for HIV-1 Specific DNA Fragment Analysis For research use only. Not for use in diagnostic procedures for clinical purposes Catalog
More informationPORCINE RESPIRATORY DISEASE COMPLEX (PRDC)
«µ«æ å ªï Ë 32 æ» 2545 125 PORCINE RESPIRATORY DISEASE COMPLEX (PRDC) Eileen Thacker 1 Roongroje Thanawongnuwech 2* Abstract Eileen Thacker 1 Roongroje Thanawongnuwech 2* PORCINE RESPIRATORY DISEASE COMPLEX
More informationSequence analysis for VP4 of enterovirus 71 isolated in Beijing during 2007 to 2008
16 2009 3 4 1 Journal of Microbes and Infection, March 2009, Vol. 4, No. 1 2007 2008 71 VP4 1, 2, 2, 2, 1, 2, 2, 2, 1, 2 1., 100730; 2., 100020 : 2007 2008 71 ( EV71), 2007 3 EV71( 1, 2 ) 2008 5 EV71(
More informationThe FIRST intradermal M Hyo vaccine
The FIRST intradermal M Hyo vaccine Effective, safe and animal friendly in a single dose Porcilis M Hyo ID Once Take the leap forward with easy-to-use needle free vaccinations Porcilis M Hyo ID Once One
More informationStudy of Prevalence of Bird flu by using RT PCR at Central Veterinary Laboratory, Nepal, 2007
Study of Prevalence of Bird flu by using RT PCR at Central Veterinary Laboratory, Nepal, 2007 Dipesh Dhakal 1, Pawan Dulal 1, Rewati Man Shrestha 2, Salina Manandhar 2 and Janardan Lamichhane 1 1 Department
More information