Qian Gao Fudan University

Transcription

1 Qian Gao Fudan University

2 Outline Background & Objectives Genotyping methods Establish the epidemiological field sites Preliminary results of Molecular epidemiology of TB in China Molecular epidemiology of TB in Songjiang, Shanghai.

3 No. of Patient Tuberculosis in China Second largest number of tuberculosis (year) 患病人数 发病人数 新发病例 复治病例 Global Tuberculosis Control 2010, WHO The largest number of drug resistant patients Total drug resistance rate = 37.79%(560,000/year) Drug resistance among new patients = 35.16%(459,000/year) Drug resistance among treated patients = 55.17% (101,000/year) National DR-TB Survey( )

4 Key issue of TB control What s the main cause of tuberculosis cases? Recent transmission or Latent TB reactivation What s the main cause of drug-resistant TB? Primary drug resistance or acquired drug resistance Wu P.,et al., PLoS One, 2010, e10468

5 Objectives To figure out the proportion of recent transmission in all culture-positive TB cases To figure out the proportion of primary drugresistant cases in all drug-resistant cases

6 Hypothesis: Recent transmission Unique Cluster Infection Dormancy Reactivation n

7 Genotyping Methods

8 IS6110-RFLP

9 Sopligotyping (Spacer oligo typing) IS6110 DR locus H37Rv X Spacer BCG H37Rv X Barnes PF, Cave MD. New Engl J Med 2003; 349:

10 VNTR (variable number of tandem repeats) 1 CGAATTCTTCGGTGGTCTCGAGTGCTCCG >>>>>>>>>>>>>>>>>>>>> 30 CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 1 83 CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CATGGTCAGCCAGCGACGCTACACCGTAGGTTGGACACCATGAGTCAGAC <<<<<<<<<<<<<<<<<<<<< Strain 1 Strain 2 Strain 3 A B C D A B C D Strain Strain Strain

11 Genotyping Methods Spoligotyping: low discriminatory power IS6110-RFLP: high discriminatory power, but difficult to analyze VNTR: PCR-based, simple and easy to perform, digital number easy to compere between labs. H37Rv pattern Variable discriminatory power: loci exhibited different discriminatory power among geographically distant areas

12 Ideally VNTR typing First line loci(for genotyping of all isolates) Select appropriate number of loci(8-12 loci) Stable,easy to perform and analysis Suitable discrimination power of each locus,high discrimination power when combined Second line loci (for genotyping of isolates clustered by 1 st line loci ) High similarity among Beijing strains, patients share identical 1 st line loci genotype could not have epidemiological links For isolates with identical 1 st line loci genotype, run on the same gel (avoid reading bias in different gels)

13 Select the VNTR loci Study fields Total Beijing genotype Sichuan Guangxi Shanghai Shandong Henan Heilongjiang Total %

14 Discrimination power of Selected loci in different studies

15 Comparison of different VNTR loci Loci No. of strains No. of genotyp es No. of clusters No. of clustered strains HGI 95% CI VNTR VNTR VNTR VNTR

16 TB genotyping Kit Identificatio n of M. tuberculosis M. tuberculosis Mtb Kit NTM Sequencing of 16S rrna Identificatio n of Beijing strains Cluster analysis Determination of Beijing strains deletion of RD105 region VNTR-12 for genotyping of all M. tb isolates For isolates clustered with VNTR-12, further high variable loci were used

17 Study Design Wuchang, Heilongjiang Study Design Prospective, population-based epidemiologic study From June 2009 to Dec 2010 Wusheng, Sichuan Weishi, Henan Fei, Shandong Songjiang, Shanghai Represent different regions of China Pingguo, Guangxi Fields Areas(km 2 ) Population Prevalence of TB cases (/100,000 people) Heilongjiang(Wuchang) 3, , Shandong(Feixian) 1, , Henan(Weishi) 1, , Shanghai(Songjiang) 604 1,634, Sichuan(Wusheng) , Guangxi(Pingguo) 2, ,

18 Study strategy Establish the epidemiological fields Screen all suspected TB patients Questionnaire Patients & Close contact Culture positive TB patients Indentify MTB DST Genotyping Clustered Unique Cluster investigation Elucidate the recent transmission model

19 Establish the epidemiological field sites TB hospital, 1-2 general hospital and several community clinics Human resource: 3-5doctors and 3-4 lab staff Instruments (Biosafety cabinets, incubator, Autoclave etc.) Laboratory capacity: Sputum AFB stain, Microscopy, Cult ure Epidemiologic Investigation: In both hospital & community In country level

20 Epidemiology field sites In province-level: Laboratory capacity Drug Susceptibility Test Liquid culture Molecular genotyping New diagnosis assays

21 Workshop Training Techniques of TB rapid diagnosis New methods of case-finding TB epidemiological database based on network Ethics in clinical research Biosafety, DST and conservation of strains in laboratory

22 Quality assurance Provided commercial products (culture and DST medium, staining and Genotyping Kit) and standard protocols The DST results reported by provincial CDC were confirmed by detecting the gene mutation Site supervision: twice per year

23 Internet-based database To collect and manage the data Microscopy and culture VNTR genotyping DST results Clinical information of TB patients from questionnaires Demographic information of close contacts of TB patients from questionnaires

24 Network of Epidemiology field sites Sputum microscopy DST Epidemiologic investigation Internet-based database Sputum culture VNTR genotyping Data analysis Staff management Quality Control County-level lab Provincial lab Lab in Fudan University

25 Case finding Methods Passive case finding: screen suspected TB cases among those who go to TB hospital or suspected cases who are referred from general hospitals Active case finding: screen suspected TB cases who are recommended by community health workers Screening suspected TB patients Clinical symptom: cough for at least 2 weeks, fever, chest pain, weight loss Chest X-ray 3 sputum for AFB, 2 sputum for L-J culture Drug Susceptible Tests Proportion method on L-J medium (INH and RIF) Genotyping analysis 16-loci VNTR (identification of the clustered strains) DTM-PCR (identification of Beijing genotype strains)

26 Patients enrolled 11,942 suspected TB patients (Jun, 2009 Dec, 2010) 1470 (12.3%) culture-positive patients 1409 (95.8%) were identified as MTB isolates Field sites Suspected TB cases Culture Positive (%) Wusheng (Sichuan) (17.7) Pingguo (Guangxi) (9.5) 1375 (97.6%) had DST & genotyping results Songjiang (Shanghai) (17.1) Fei (Shandong) (6.8) Weishi (Henan) (8.7) Wuchang (Heilongjiang) (17.0) Total (12.3)

27 Characteristics of TB patients Regions Total Male (%) Patient Age (%) <25 25~44 45~64 >65 Wusheng (Sichuan) (75.3) 37 (17.1) 77 (35.7) 83 (38.4) 19 (8.8) Pingguo (Guangxi) (71.9) 24 (13.6) 65 (36.9) 53 (30.1) 34 (19.3) Songjiang (Shanghai) (66.0) 113 (28.5) 164 (41.4) 69 (17.4) 50 (12.6) Fei (Shandong) (76.7) 39 (18.9) 35 (17.0) 61 (29.6) 71 (34.5) Weishi (Henan) (73.1) 25 (12.7) 50 (25.4) 48 (24.4) 74 (37.6) Wuchang (Heilongjiang) (67.9) 31 (16.7) 50 (27.2) 71 (38.6) 32 (17.4) Total (71.3) 269 (19.6) 441 (32.1) 385 (28.0) 280 (20.3)

28 Drug resistance In total, the rate of new TB cases was 87.7%. Regions New cases Re-treatment cases Total No. DR % MDR % Total No. DR % MDR % Wusheng (Sichuan) Pingguo (Guangxi) Songjiang (Shanghai) Fei (Shandong) Weishi (Henan) Wuchang (Heilongjiang) Total Primary drug resistance

29 Prevalence of Beijing strains In total, 1034 (75%) strains were identified as Beijing genotype. The distribution was significant varied in geographic regions in China (p<0.001). Sichuan Henan Shandong Shanghai Heilongjiang Study fields Total Beijing genotype % Wusheng (Sichuan) Pingguo (Guangxi) Songjiang (Shanghai) Fei (Shandong) Weishi (Henan) Wuchang (Heilongjiang) Guangxi

30 No associations of Beijing strains and DR Drug sensitivity * and anti-tb treatment history Total cases Beijing infection N (%) OR (95% CI) New cases DS (74.0) 1.00 DR (75.0) 1.04 ( ) INH (77.3) 1.15 ( ) RIF (70.8) 0.92 ( ) MDR (75.0) 1.12 ( ) Re-treated cases DS (79.2) 1.00 DR (76.3) 1.09 ( ) INH (76.5) 0.99 ( ) RIF (77.1) 1.20 ( ) MDR (77.5) 1.09 ( )

31 Recent transmission of TB Study Settings Total patients Clustered patients Cluster proportion (%) Maximum no. of patients in a cluster Wusheng (Sichuan) Pingguo (Guangxi) Songjiang (Shanghai) Fei (Shandong) Weishi (Henan) Wuchang (Heilongjiang) Total The identification of clustered patients was restricted to the same field site.

32 Risk factors of recent transmission Patients with MDR/Beijing strains had significantly high clustering rate Variables Total Clustered (%) Unique (%) P value Adjusted OR(95% CI) MDR (34.8) 45 (65.2) ( ) Beijing strains (31.1) 599 (68.9) ( ) Smoking (30.1) 314 (69.9) ( ) Han ethic (28.3) 598 (71.7) ( ) BCG vaccination (26.9) 207 (73.1) ( ) Multivariate analysis with multiple logistic regression model

33 Epidemiological link patients in one cluster in Heilongjiang site Case and ID Public place Confirmed transmission Probable link Possible link

34 Limitation & Improvement Study period is too short Extension in next five-year Case finding needs to improve Active case finding Culture positive rate is low (~30%) Sputum quality Liquid culture Molecular diagnosis

35 Incidence rate, N/100,000 Transmission of TB in Songjiang, Shanghai Characterizes of Songjiang Population: total about 1.5 million (0.5 million resident and 1 million of migrant) Industrial districts in Shanghai Resident Migrant Map of Shanghai

36 TB control program in Songjiang Case finding Active case finding initiated at 2003, From 2007, intensify TB screening among resident persons of > 60 years old. Patient management DOTS project From 2003, Shanghai expanded the free TB DOTS program to migrants Laboratory tests 3 sputum for AFB, 2 sputum for L-J culture

37 Culture positive rate (%) Improvement of Laboratory ability Induced sputum improves the diagnosis of tuberculosis Field site No spontaneous sputum Success induced Increased rate of culture positive TB cases (%) Culture positive Songjiang (%) Sm(+) Cul(+) Sm (-) Cul(+) Cul(+)

38 Characteristics of TB patients Total Total (N) Migrant (%) Male (%) Age (%) <45 yrs yrs Beijing strains(%) Drug resistant(%) MDR (%)

39 Cluster proportion by time period Year Cluster proportion within (%) 1 yrs 2 yrs 3 yrs 4 yrs 5yrs Cumulated proportion of clustered cases

40 Sampling frame Total TB cases (n=1535) Culture-positive (n=691,45%) Culture-negative (n=844,55%) Isolates genotyped Unable to obtain isolates (n=43) Yes (n=629, 90%) Remain for cluster analysis (n=599, 95%) Not available (n=19) False-positive cultures (n=30)

41 Characteristics of TB patients, % of the TB cases were from migrants. Characteristics Migrant cases (n=427) Resident cases (n=172) P value No. % No. % Female (sex) < Age (median, IQR) < BMI value (mean±sd) 20.6± ± Previously treated Diagnosis delay days (median, IQR) Clinical symptoms Cough Cavity Laboratory test Smear positive Beijing strains Drug resistant MDR

42 25.7% (154/599) of patients were categorized into 55 clusters 24.3% in 2009, 24.4% in % in Of the 55 clusters, Cluster analysis 24 (43.6%) were involved with both migrants and residents TB patients among migrants were less likely to be clustered (23.0%, 98/427 vs. 32.6%, 56/172, p=0.01), compared to resident patients. Cluster size No. of clusters No. of clustered patients Total Migrants only Residents only Both involved Total Migrant Resident Total

43 Cluster proportion by age

44 Risk factors for genotypic clustering

45 Epidemiological link Super market In 52 cases, 2 cases were family members, 2 cases had experience of contacting with the same TB cases, 9 cases in were linked by places they frequently visited. In total, 11 cases (21.2%) had clearly epidemiological link.

46 Comparison with previous studies Cluster proportion North America, South Africa, Malawi et al %, North European 15-19% High risk factors HIV+ homeless drug abuse low income et al. HIV+: easy from infection to diseases General population in Shanghai Transmission settings Close relative contact Bus Bar School Hospital, et al. Casual transmission

47 Suggestion Cluster proportion is not comparable with previous studied The Big challenge for China TB control program How to block the transmission of TB?

48 Summary Establishment of epidemiological field sites in six provinces in China. Cluster rate in China is not comparable with that in other countries Recently transmission is a important factor and should not be overlooked TB control is big challenge for China

49 Staff in each field sites Acknowledgement 11 th National five-year Key Project