Qian Gao Fudan University
|
|
- Virginia Collins
- 5 years ago
- Views:
Transcription
1 Qian Gao Fudan University
2 Outline Background & Objectives Genotyping methods Establish the epidemiological field sites Preliminary results of Molecular epidemiology of TB in China Molecular epidemiology of TB in Songjiang, Shanghai.
3 No. of Patient Tuberculosis in China Second largest number of tuberculosis (year) 患病人数 发病人数 新发病例 复治病例 Global Tuberculosis Control 2010, WHO The largest number of drug resistant patients Total drug resistance rate = 37.79%(560,000/year) Drug resistance among new patients = 35.16%(459,000/year) Drug resistance among treated patients = 55.17% (101,000/year) National DR-TB Survey( )
4 Key issue of TB control What s the main cause of tuberculosis cases? Recent transmission or Latent TB reactivation What s the main cause of drug-resistant TB? Primary drug resistance or acquired drug resistance Wu P.,et al., PLoS One, 2010, e10468
5 Objectives To figure out the proportion of recent transmission in all culture-positive TB cases To figure out the proportion of primary drugresistant cases in all drug-resistant cases
6 Hypothesis: Recent transmission Unique Cluster Infection Dormancy Reactivation n
7 Genotyping Methods
8 IS6110-RFLP
9 Sopligotyping (Spacer oligo typing) IS6110 DR locus H37Rv X Spacer BCG H37Rv X Barnes PF, Cave MD. New Engl J Med 2003; 349:
10 VNTR (variable number of tandem repeats) 1 CGAATTCTTCGGTGGTCTCGAGTGCTCCG >>>>>>>>>>>>>>>>>>>>> 30 CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA 1 83 CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTGCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CTCATCTGCGCCGCTCCTCCTCATCGCTTCGCTCTGCATCGTCACCGGCGCGA CATGGTCAGCCAGCGACGCTACACCGTAGGTTGGACACCATGAGTCAGAC <<<<<<<<<<<<<<<<<<<<< Strain 1 Strain 2 Strain 3 A B C D A B C D Strain Strain Strain
11 Genotyping Methods Spoligotyping: low discriminatory power IS6110-RFLP: high discriminatory power, but difficult to analyze VNTR: PCR-based, simple and easy to perform, digital number easy to compere between labs. H37Rv pattern Variable discriminatory power: loci exhibited different discriminatory power among geographically distant areas
12 Ideally VNTR typing First line loci(for genotyping of all isolates) Select appropriate number of loci(8-12 loci) Stable,easy to perform and analysis Suitable discrimination power of each locus,high discrimination power when combined Second line loci (for genotyping of isolates clustered by 1 st line loci ) High similarity among Beijing strains, patients share identical 1 st line loci genotype could not have epidemiological links For isolates with identical 1 st line loci genotype, run on the same gel (avoid reading bias in different gels)
13 Select the VNTR loci Study fields Total Beijing genotype Sichuan Guangxi Shanghai Shandong Henan Heilongjiang Total %
14 Discrimination power of Selected loci in different studies
15 Comparison of different VNTR loci Loci No. of strains No. of genotyp es No. of clusters No. of clustered strains HGI 95% CI VNTR VNTR VNTR VNTR
16 TB genotyping Kit Identificatio n of M. tuberculosis M. tuberculosis Mtb Kit NTM Sequencing of 16S rrna Identificatio n of Beijing strains Cluster analysis Determination of Beijing strains deletion of RD105 region VNTR-12 for genotyping of all M. tb isolates For isolates clustered with VNTR-12, further high variable loci were used
17 Study Design Wuchang, Heilongjiang Study Design Prospective, population-based epidemiologic study From June 2009 to Dec 2010 Wusheng, Sichuan Weishi, Henan Fei, Shandong Songjiang, Shanghai Represent different regions of China Pingguo, Guangxi Fields Areas(km 2 ) Population Prevalence of TB cases (/100,000 people) Heilongjiang(Wuchang) 3, , Shandong(Feixian) 1, , Henan(Weishi) 1, , Shanghai(Songjiang) 604 1,634, Sichuan(Wusheng) , Guangxi(Pingguo) 2, ,
18 Study strategy Establish the epidemiological fields Screen all suspected TB patients Questionnaire Patients & Close contact Culture positive TB patients Indentify MTB DST Genotyping Clustered Unique Cluster investigation Elucidate the recent transmission model
19 Establish the epidemiological field sites TB hospital, 1-2 general hospital and several community clinics Human resource: 3-5doctors and 3-4 lab staff Instruments (Biosafety cabinets, incubator, Autoclave etc.) Laboratory capacity: Sputum AFB stain, Microscopy, Cult ure Epidemiologic Investigation: In both hospital & community In country level
20 Epidemiology field sites In province-level: Laboratory capacity Drug Susceptibility Test Liquid culture Molecular genotyping New diagnosis assays
21 Workshop Training Techniques of TB rapid diagnosis New methods of case-finding TB epidemiological database based on network Ethics in clinical research Biosafety, DST and conservation of strains in laboratory
22 Quality assurance Provided commercial products (culture and DST medium, staining and Genotyping Kit) and standard protocols The DST results reported by provincial CDC were confirmed by detecting the gene mutation Site supervision: twice per year
23 Internet-based database To collect and manage the data Microscopy and culture VNTR genotyping DST results Clinical information of TB patients from questionnaires Demographic information of close contacts of TB patients from questionnaires
24 Network of Epidemiology field sites Sputum microscopy DST Epidemiologic investigation Internet-based database Sputum culture VNTR genotyping Data analysis Staff management Quality Control County-level lab Provincial lab Lab in Fudan University
25 Case finding Methods Passive case finding: screen suspected TB cases among those who go to TB hospital or suspected cases who are referred from general hospitals Active case finding: screen suspected TB cases who are recommended by community health workers Screening suspected TB patients Clinical symptom: cough for at least 2 weeks, fever, chest pain, weight loss Chest X-ray 3 sputum for AFB, 2 sputum for L-J culture Drug Susceptible Tests Proportion method on L-J medium (INH and RIF) Genotyping analysis 16-loci VNTR (identification of the clustered strains) DTM-PCR (identification of Beijing genotype strains)
26 Patients enrolled 11,942 suspected TB patients (Jun, 2009 Dec, 2010) 1470 (12.3%) culture-positive patients 1409 (95.8%) were identified as MTB isolates Field sites Suspected TB cases Culture Positive (%) Wusheng (Sichuan) (17.7) Pingguo (Guangxi) (9.5) 1375 (97.6%) had DST & genotyping results Songjiang (Shanghai) (17.1) Fei (Shandong) (6.8) Weishi (Henan) (8.7) Wuchang (Heilongjiang) (17.0) Total (12.3)
27 Characteristics of TB patients Regions Total Male (%) Patient Age (%) <25 25~44 45~64 >65 Wusheng (Sichuan) (75.3) 37 (17.1) 77 (35.7) 83 (38.4) 19 (8.8) Pingguo (Guangxi) (71.9) 24 (13.6) 65 (36.9) 53 (30.1) 34 (19.3) Songjiang (Shanghai) (66.0) 113 (28.5) 164 (41.4) 69 (17.4) 50 (12.6) Fei (Shandong) (76.7) 39 (18.9) 35 (17.0) 61 (29.6) 71 (34.5) Weishi (Henan) (73.1) 25 (12.7) 50 (25.4) 48 (24.4) 74 (37.6) Wuchang (Heilongjiang) (67.9) 31 (16.7) 50 (27.2) 71 (38.6) 32 (17.4) Total (71.3) 269 (19.6) 441 (32.1) 385 (28.0) 280 (20.3)
28 Drug resistance In total, the rate of new TB cases was 87.7%. Regions New cases Re-treatment cases Total No. DR % MDR % Total No. DR % MDR % Wusheng (Sichuan) Pingguo (Guangxi) Songjiang (Shanghai) Fei (Shandong) Weishi (Henan) Wuchang (Heilongjiang) Total Primary drug resistance
29 Prevalence of Beijing strains In total, 1034 (75%) strains were identified as Beijing genotype. The distribution was significant varied in geographic regions in China (p<0.001). Sichuan Henan Shandong Shanghai Heilongjiang Study fields Total Beijing genotype % Wusheng (Sichuan) Pingguo (Guangxi) Songjiang (Shanghai) Fei (Shandong) Weishi (Henan) Wuchang (Heilongjiang) Guangxi
30 No associations of Beijing strains and DR Drug sensitivity * and anti-tb treatment history Total cases Beijing infection N (%) OR (95% CI) New cases DS (74.0) 1.00 DR (75.0) 1.04 ( ) INH (77.3) 1.15 ( ) RIF (70.8) 0.92 ( ) MDR (75.0) 1.12 ( ) Re-treated cases DS (79.2) 1.00 DR (76.3) 1.09 ( ) INH (76.5) 0.99 ( ) RIF (77.1) 1.20 ( ) MDR (77.5) 1.09 ( )
31 Recent transmission of TB Study Settings Total patients Clustered patients Cluster proportion (%) Maximum no. of patients in a cluster Wusheng (Sichuan) Pingguo (Guangxi) Songjiang (Shanghai) Fei (Shandong) Weishi (Henan) Wuchang (Heilongjiang) Total The identification of clustered patients was restricted to the same field site.
32 Risk factors of recent transmission Patients with MDR/Beijing strains had significantly high clustering rate Variables Total Clustered (%) Unique (%) P value Adjusted OR(95% CI) MDR (34.8) 45 (65.2) ( ) Beijing strains (31.1) 599 (68.9) ( ) Smoking (30.1) 314 (69.9) ( ) Han ethic (28.3) 598 (71.7) ( ) BCG vaccination (26.9) 207 (73.1) ( ) Multivariate analysis with multiple logistic regression model
33 Epidemiological link patients in one cluster in Heilongjiang site Case and ID Public place Confirmed transmission Probable link Possible link
34 Limitation & Improvement Study period is too short Extension in next five-year Case finding needs to improve Active case finding Culture positive rate is low (~30%) Sputum quality Liquid culture Molecular diagnosis
35 Incidence rate, N/100,000 Transmission of TB in Songjiang, Shanghai Characterizes of Songjiang Population: total about 1.5 million (0.5 million resident and 1 million of migrant) Industrial districts in Shanghai Resident Migrant Map of Shanghai
36 TB control program in Songjiang Case finding Active case finding initiated at 2003, From 2007, intensify TB screening among resident persons of > 60 years old. Patient management DOTS project From 2003, Shanghai expanded the free TB DOTS program to migrants Laboratory tests 3 sputum for AFB, 2 sputum for L-J culture
37 Culture positive rate (%) Improvement of Laboratory ability Induced sputum improves the diagnosis of tuberculosis Field site No spontaneous sputum Success induced Increased rate of culture positive TB cases (%) Culture positive Songjiang (%) Sm(+) Cul(+) Sm (-) Cul(+) Cul(+)
38 Characteristics of TB patients Total Total (N) Migrant (%) Male (%) Age (%) <45 yrs yrs Beijing strains(%) Drug resistant(%) MDR (%)
39 Cluster proportion by time period Year Cluster proportion within (%) 1 yrs 2 yrs 3 yrs 4 yrs 5yrs Cumulated proportion of clustered cases
40 Sampling frame Total TB cases (n=1535) Culture-positive (n=691,45%) Culture-negative (n=844,55%) Isolates genotyped Unable to obtain isolates (n=43) Yes (n=629, 90%) Remain for cluster analysis (n=599, 95%) Not available (n=19) False-positive cultures (n=30)
41 Characteristics of TB patients, % of the TB cases were from migrants. Characteristics Migrant cases (n=427) Resident cases (n=172) P value No. % No. % Female (sex) < Age (median, IQR) < BMI value (mean±sd) 20.6± ± Previously treated Diagnosis delay days (median, IQR) Clinical symptoms Cough Cavity Laboratory test Smear positive Beijing strains Drug resistant MDR
42 25.7% (154/599) of patients were categorized into 55 clusters 24.3% in 2009, 24.4% in % in Of the 55 clusters, Cluster analysis 24 (43.6%) were involved with both migrants and residents TB patients among migrants were less likely to be clustered (23.0%, 98/427 vs. 32.6%, 56/172, p=0.01), compared to resident patients. Cluster size No. of clusters No. of clustered patients Total Migrants only Residents only Both involved Total Migrant Resident Total
43 Cluster proportion by age
44 Risk factors for genotypic clustering
45 Epidemiological link Super market In 52 cases, 2 cases were family members, 2 cases had experience of contacting with the same TB cases, 9 cases in were linked by places they frequently visited. In total, 11 cases (21.2%) had clearly epidemiological link.
46 Comparison with previous studies Cluster proportion North America, South Africa, Malawi et al %, North European 15-19% High risk factors HIV+ homeless drug abuse low income et al. HIV+: easy from infection to diseases General population in Shanghai Transmission settings Close relative contact Bus Bar School Hospital, et al. Casual transmission
47 Suggestion Cluster proportion is not comparable with previous studied The Big challenge for China TB control program How to block the transmission of TB?
48 Summary Establishment of epidemiological field sites in six provinces in China. Cluster rate in China is not comparable with that in other countries Recently transmission is a important factor and should not be overlooked TB control is big challenge for China
49 Staff in each field sites Acknowledgement 11 th National five-year Key Project
Molecular Epidemiology of Tuberculosis. Kathy DeRiemer, PhD, MPH School of Medicine University of California, Davis
Molecular Epidemiology of Tuberculosis Kathy DeRiemer, PhD, MPH School of Medicine University of California, Davis Overview TB transmission and pathogenesis Genotyping methods Genotyping for clinical management
More informationTransmission of MDR/XDR Tuberculosis in Shanghai. Qian Gao Shanghai Medical College Fudan University
Transmission of MDR/XDR Tuberculosis in Shanghai Qian Gao Shanghai Medical College Fudan University Drug Resistant TB in China The Highest DR-TB Burden Country New TB cases/year Cases with any DR MDR XDR
More informationNational Survey of Drug-Resistant Tuberculosis in China Dr. Yanlin Zhao
National Survey of Drug-Resistant Tuberculosis in China Dr. Yanlin Zhao National Centre for Tuberculosis Control and Prevention of China CDC National TB Reference Laboratory, China CDC BACKGROUND China
More informationTB In Detroit 2011* Early TB: Smudge Sign. Who is at risk for exposure to or infection with TB? Who is at risk for TB after exposure or infection?
Those oral antibiotics are just not working! Inpatient Standards of Care & Discharge Planning S/He s in the Hospital: Now What Do I Do? Dana G. Kissner, MD TB Intensive Workshop, Lansing, MI 2012 Objectives:
More informationKen Jost, BA, has the following disclosures to make:
Diagnosis of TB Disease: Laboratory Ken Jost, BA May 10, 2017 TB Intensive May 9-12, 2017 San Antonio, TX EXCELLENCE EXPERTISE INNOVATION Ken Jost, BA, has the following disclosures to make: No conflict
More informationTB trends and TB genotyping
Management of a TB Contact Investigation for Public Health Workers Albuquerque, NM October 1, 214 TB trends and TB genotyping Marcos Burgos MD October 1, 214 Marcos Burgos, MD has the following disclosures
More informationHow best to structure a laboratory network with new technologies
How best to structure a laboratory network with new technologies Cristina Gutierrez, MD, PhD Uniting to scale up TB care in Central Asia 14 and 15 April 2011 Tashkent, Uzbekistan New laboratory diagnostics
More informationMDR, XDR and Untreatable Tuberculosis and Laboratory Perspectives. Martie van der Walt TUBERCULOSIS EPIDEMIOLOGY & INTERVENTION RESEARCH UNIT
TUBERCULOSIS EPIDEMIOLOGY & INTERVENTION RESEARCH UNIT MDR, XDR and Untreatable Tuberculosis and Laboratory Perspectives Martie van der Walt IOM Meeting 15-17 January 2013 introduction 1 min 150 words
More informationDiagnosis and Treatment of Tuberculosis, 2011
Diagnosis of TB Diagnosis and Treatment of Tuberculosis, 2011 Alfred Lardizabal, MD NJMS Global Tuberculosis Institute Diagnosis of TB, 2011 Diagnosis follows Suspicion When should we Think TB? Who is
More informationDiagnosis of TB: Laboratory Ken Jost Tuesday April 1, 2014
TB Nurse Case Management San Antonio, Texas April 1 3, 2014 Diagnosis of TB: Laboratory Ken Jost Tuesday April 1, 2014 Ken Jost, BA has the following disclosures to make: No conflict of interests No relevant
More informationResearch Methods for TB Diagnostics. Kathy DeRiemer, PhD, MPH University of California, Davis Shanghai, China: May 8, 2012
Research Methods for TB Diagnostics Kathy DeRiemer, PhD, MPH University of California, Davis Shanghai, China: May 8, 2012 Overview Why do we need good TB diagnostics? What works? What doesn t work? How
More informationPrevalence of tuberculosis (TB) infection and disease among adolescents western Kenya: preparation for future TB vaccine trials
Prevalence of tuberculosis (TB) infection and disease among adolescents western Kenya: preparation for future TB vaccine trials Videlis Nduba 1,2, Peter Onyango 1, Anja Van t Hoog 1,3, Anthony Hawkridge
More informationWhen Can Isolation Be Discontinued?
When Can Isolation Be Discontinued? - It Depends on the Patient and the Setting. Masae Kawamura M.D. and Barbara Seaworth M.D. Texas: (800) TEX-LUNG New Jersey: 973-972-3270? HNTC Consultation Line California:
More informationIntensified TB case finding among PLHIV and vulnerable population Identifying contacts Gunta Kirvelaite
Intensified TB case finding among PLHIV and vulnerable population Identifying contacts Gunta Kirvelaite Riga East Clinical hospital, Centre for tuberculosis and lung diseases. Head of outpatient department.
More informationOUT-TB Web. Ontario Universal Typing of Tuberculosis: Surveillance and Communication System
OUT-TB Web Ontario Universal Typing of Tuberculosis: Surveillance and Communication System Dr. Frances Jamieson, Ontario Public Health Laboratories November 30 th, 2009 Tuberculosis : A Global Problem
More informationNATIONAL TUBERCULOSIS PREVALENCE SURVEY 2016
NATIONAL TUBERCULOSIS PREVALENCE SURVEY 2016 Department of Health/National TB Control Program Philippine Council for Health Research and Development Foundation for the Advancement of Clinical Epidemiology,
More information10/3/2017. Updates in Tuberculosis. Global Tuberculosis, WHO 2015 report. Objectives. Disclosures. I have nothing to disclose
Disclosures Updates in Tuberculosis I have nothing to disclose Chris Keh, MD Assistant Clinical Professor, Division of Infectious Diseases, UCSF TB Controller, TB Prevention and Control Program, Population
More informationEpidemiology and diagnosis of MDR-TB in children H Simon Schaaf
Epidemiology and diagnosis of MDR-TB in children H Simon Schaaf Desmond Tutu TB Centre Department of Paediatrics and Child Health, Stellenbosch University, and Tygerberg Children s Hospital (TCH) Definitions
More informationNew Tuberculosis Guidelines. Jason Stout, MD, MHS
New Tuberculosis Guidelines Jason Stout, MD, MHS Two New Sets of Guidelines Treatment of Drug-Susceptible Tuberculosis Clinical Infectious Diseases 2016; 63(7): e147-e195 Diagnosis of Tuberculosis in Adults
More informationTB infection control: overview and importance
TB infection control: overview and importance John Ferguson, Newcastle, NSW Infectious Diseases & Microbiology jferguson@hnehealth.nsw.gov.au Goroka Hospital, September 2014 Patterns of TB disease Latent
More informationScott Lindquist MD MPH Tuberculosis Medical Consultant Washington State DOH and Kitsap County Health Officer
Tuberculosis in the 21 st Century Scott Lindquist MD MPH Tuberculosis Medical Consultant Washington State DOH and Kitsap County Health Officer Feedback Poll In my opinion, the recent media coverage of
More informationXpert MTB/RIF assay validation experience --- impact and plan in China
Xpert MTB/RIF assay validation experience --- impact and plan in China Dr. Zhao Yanlin Chinese Center for Disease Control & Prevention Dr. Richard O Brien FIND April. 16, 2013 Progress Contribution for
More informationAnnual Tuberculosis Report Oregon 2007
Annual Tuberculosis Report Oregon 7 Oregon Department of Human Services Public Health Division TB Program April 8 Page 2 Table of Contents Charts Chart 1 TB Incidence in the US and Oregon, 1985-7.. page
More informationINTENSIFIED TB CASE FINDING
INTENSIFIED TB CASE FINDING My friends call me Intensified Case Finding (ICF) I undertake regularly screening all people with, or at high risk of HIV, for symptoms of TB in health care facilities, communities
More informationDetection and Treatment of Tuberculosis in Correctional Facilities: Opportunities and Challenges
Detection and Treatment of Tuberculosis in Correctional Facilities: Opportunities and Challenges David Karol, MD, MA Bureau of Prisons, FMC Butner Duke University Medical Center June 26, 2013 No Disclosures
More informationOriginal Article Evaluation of Xpert MTB/RIF in detection of pulmonary and extrapulmonary tuberculosis cases in China
Int J Clin Exp Pathol 2017;10(4):4847-4851 www.ijcep.com /ISSN:1936-2625/IJCEP0045802 Original Article Evaluation of Xpert MTB/RIF in detection of pulmonary and extrapulmonary tuberculosis cases in China
More informationTB: A Supplement to GP CLINICS
TB: A Supplement to GP CLINICS Chapter 10: Childhood Tuberculosis: Q&A For Primary Care Physicians Author: Madhukar Pai, MD, PhD Author and Series Editor What is Childhood TB and who is at risk? India
More informationINDEX CASE INFORMATION
Instructions for Completing the MDH Tuberculosis Contact Investigation Report Form Please provide as much information as possible. Each field represents information that is important to the contact investigation.
More informationTOG The Way Forward
TOG 2016- The Way Forward Main Changes in Diagnostic algorithm Definition (Type, Classification, Outcome) Registration at the time of Diagnosis (PHI level Notification Register) Long term follow up (till
More information7. Are you currently engaged in research that could support new TB diagnostic assay development? Yes No
Determining Future TB Reference Material Requirements WHO/TDR TB Expert & End-User Survey Properly handled samples from well-characterized patients with suspected tuberculosis from disease endemic countries
More informationMolecular Epidemiology of Extrapulmonary Tuberculosis
Molecular Epidemiology of Extrapulmonary Tuberculosis A Maryland State Review Jessie Torgersen PHASE Intern Maryland State Department of Health and Mental Hygiene Division of TB Control May 12, 2004 Outline
More informationContact Investigation and Prevention in the USA
Contact Investigation and Prevention in the USA George D. McSherry, MD Division of Infectious Disease Penn State Children s Hospital Pediatric Section TB Center of Excellence Rutgers Global Tuberculosis
More informationTreatment of Tuberculosis, 2017
Treatment of Tuberculosis, 2017 Charles L. Daley, MD National Jewish Health University of Colorado Health Sciences Center Treatment of Tuberculosis Disclosures Advisory Board Horizon, Johnson and Johnson,
More informationTUBERCULOSIS. Presented By: Public Health Madison & Dane County
TUBERCULOSIS Presented By: Public Health Madison & Dane County What is Tuberculosis? Tuberculosis, or TB, is a disease caused by a bacteria called Mycobacterium tuberculosis. The bacteria can attack any
More informationA ten-year evolution of a multidrugresistant tuberculosis (MDR-TB) outbreak in an HIV-negative context, Tunisia ( )
A ten-year evolution of a multidrugresistant tuberculosis (MDR-TB) outbreak in an HIV-negative context, Tunisia (2001-2011) Naira Dekhil 1, Besma Mhenni 1, Raja Haltiti 2, and Helmi Mardassi 1 (speaker)
More informationwith these FACTS... 2
Gibson Kibiki MD, MMed, PhD KCRI - KCMC Tanzania PRIOR 10 th Nov 2009, Nijmegen, The Netherlands 1 with these FACTS... 2 The leading causes of death worldwide from preventable infectious diseases 3.0 in
More informationNew Approaches to the Diagnosis and Management of Tuberculosis Infection in Children and Adolescents
New Approaches to the Diagnosis and Management of Tuberculosis Infection in Children and Adolescents Jeffrey R. Starke, M.D. Professor of Pediatrics Baylor College of Medicine [With great thanks to Andrea
More informationPredictors of drug sensitive tuberculosis treatment outcomes among hospitalised
Predictors of drug sensitive tuberculosis treatment outcomes among hospitalised patients in South Africa: a multinomial logit model Abiola O. Olaleye 1,* and Andy K. Beke 1 1 School of Health Systems and
More informationTB Intensive San Antonio, Texas November 11 14, 2014
TB Intensive San Antonio, Texas November 11 14, 2014 Diagnosis of TB: Laboratory Ken Jost, BA November 12, 2014 Ken Jost, BA has the following disclosures to make: No conflict of interests No relevant
More informationFundamentals of Tuberculosis (TB)
TB in the United States Fundamentals of Tuberculosis (TB) From 1953 to 1984, reported cases decreased by approximately 5.6% each year From 1985 to 1992, reported cases increased by 20% 25,313 cases reported
More informationTB Nurse Case Management San Antonio, Texas April 9-11, 2013
TB Nurse Case Management San Antonio, Texas April 9-11, 2013 TB / Dose Counting Rachel Munoz, RN. TB Nurse Case Manager/Nurse Consultant Austin/Travis County Health Department April 10, 2013 Rachel Munoz,
More informationPrinciple of Tuberculosis Control. CHIANG Chen-Yuan MD, MPH, DrPhilos
Principle of Tuberculosis Control CHIANG Chen-Yuan MD, MPH, DrPhilos Estimated global tuberculosis burden 2015 an estimated 10.4 million incident cases of TB (range, 8.7 million 12.2 million) 142 cases
More informationTB Contact Investigation
Ann Raftery, RN, PHN, MS Curry International TB Center Overview Contact investigation as a core TB control and elimination activity Components of TB Contact Investigation TB Control Priority Strategies.
More informationTB the basics. (Dr) Margaret (DHA) and John (INZ)
TB the basics (Dr) Margaret (DHA) and John (INZ) Question 1 The scientist who discovered M. tuberculosis was: A: Louis Pasteur B: Robert Koch C: Jean-Antoine Villemin D: Calmette and Guerin Question 2
More informationTitle: Meta-analysis of Individual patient Data (IPD) of Patients with INH (mono or poly-drug) Resistant Tuberculosis.
Title: Meta-analysis of Individual patient Data (IPD) of Patients with INH (mono or poly-drug) Resistant Tuberculosis. Principal Investigator: Dick Menzies, MD Evidence base for treatment of INH resistant
More informationRecognizing MDR-TB in Children. Ma. Cecilia G. Ama, MD 23 rd PIDSP Annual Convention February 2016
Recognizing MDR-TB in Children Ma. Cecilia G. Ama, MD 23 rd PIDSP Annual Convention 17-18 February 2016 Objectives Review the definitions and categorization of drugresistant tuberculosis Understand the
More informationExpanding Latent Tuberculosis Infection Testing and Treatment to Accelerate Tuberculosis Elimination
IUATLD North American Region Conference February 24, 2017 Vancouver, BC Expanding Latent Tuberculosis Infection Testing and Treatment to Accelerate Tuberculosis Elimination Philip LoBue, MD National Center
More information2016 Annual Tuberculosis Report For Fresno County
206 Annual Tuberculosis Report For Fresno County Cases Rate per 00,000 people 206 Tuberculosis Annual Report Fresno County Department of Public Health (FCDPH) Tuberculosis Control Program Tuberculosis
More informationTransmissibility, virulence and fitness of resistant strains of M. tuberculosis. CHIANG Chen-Yuan MD, MPH, DrPhilos
Transmissibility, virulence and fitness of resistant strains of M. tuberculosis CHIANG Chen-Yuan MD, MPH, DrPhilos Transmissibility, Virulence and Fitness of resistant strains of M. tuberculosis For infectious
More informationHow Is TB Transmitted? Sébastien Gagneux, PhD 20 th March, 2008
How Is TB Transmitted? Sébastien Gagneux, PhD 20 th March, 2008 Today s Outline 1) Global spread of Mtb Comparative genomics Phylogeny 2) Transmission of drug-resistant Mtb Fitness assays Molecular epidemiology
More informationGlobal TB Burden, 2016 estimates
TUBERCULOSIS EPIDEMIOLOGY LOCAL, STATE, NATIONAL, GLOBAL Office of Communicable Disease Epidemiology Global TB Burden, 216 estimates Total TB Estimated number of TB cases 1.4 million 14 per 1, Estimated
More informationLatent Tuberculosis Infections Controversies in Diagnosis and Management Update 2016
Latent Tuberculosis Infections Controversies in Diagnosis and Management Update 2016 Randy Culpepper, MD, MPH Deputy Heath Officer/Medical Director Frederick County Health Department March 16, 2016 2 No
More informationOutline. Tuberculosis (TB) Medical Evaluation for TB 5/5/2014. Chest Radiograph with Lower Lobe Cavity
Jean Beinemann RN, Terri Boxrucker RN, and LT Dee Dee Downie MPH Outline The disease The outbreak The response The conclusions May 18, 2014 Wisconsin Public Health Association Annual Meeting Tuberculosis
More informationTUBERCULOSIS. Pathogenesis and Transmission
TUBERCULOSIS Pathogenesis and Transmission TUBERCULOSIS Pathogenesis and Transmission Infection to Disease Diagnostic & Isolation Updates Treatment Updates Pathogenesis Droplet nuclei of 5µm or less are
More informationFrances Morgan, PhD October 21, Comprehensive Care of Patients with Tuberculosis and Their Contacts October 19 22, 2015 Wichita, KS
The Laboratory s Role in Caring for Patients Diagnosed with TB Frances Morgan, PhD October 21, 2015 Comprehensive Care of Patients with Tuberculosis and Their Contacts October 19 22, 2015 Wichita, KS EXCELLENCE
More informationOsaka City is the third largest city (population
Surveillance Report Strengthened tuberculosis control programme and trend of multidrug resistant tuberculosis rate in Osaka City, Japan Akira Shimouchi, a Akihiro Ohkado, a Kenji Matsumoto, b Jun Komukai,
More informationDr Francis Ogaro MTRH ELDORET
Dr Francis Ogaro MTRH ELDORET TB in children often severe, disseminated and can progress rapidly and with poor outcome TB diagnosis in children has relied on clinical, imaging, microscopy and TST findings.
More informationLatent Tuberculosis Infection (LTBI) Questions and Answers for Health Care Providers
Latent Tuberculosis Infection (LTBI) Questions and Answers for Health Care Providers Who Should Be Screened for Latent Tuberculosis Infection (LTBI)?... 2 What tests are used to screen for LTBI?... 2 How
More informationTransmission of Mycobacterium tuberculosis
Transmission of Mycobacterium tuberculosis Charles Daley, MD National Jewish Health Disclosures Advisory Board Horizon, Johnson and Johnson, Otsuka and Spero Investigator Insmed Objectives After attending
More informationDiagnosis and Medical Management of Latent TB Infection
Diagnosis and Medical Management of Latent TB Infection Marsha Majors, RN September 7, 2017 TB Contact Investigation 101 September 6 7, 2017 Little Rock, AR EXCELLENCE EXPERTISE INNOVATION Marsha Majors,
More informationThe Epidemiology of Tuberculosis in Minnesota,
The Epidemiology of Tuberculosis in Minnesota, 2011 2015 Minnesota Department of Health Tuberculosis Prevention and Control Program (651) 201-5414 Tuberculosis surveillance data for Minnesota are available
More informationTransmission of DS-TB and MDR-TB. C. Robert Horsburgh, Jr. Boston University School of Public Health
Transmission of DS-TB and MDR-TB C. Robert Horsburgh, Jr. Boston University School of Public Health Outline Epidemiologic factors in transmission Ability of the transmitter to transmit Susceptibility of
More informationTB is Global. Latent TB Infection (LTBI) Sharing the Care: Working Together. September 24, 2014
Sharing the Care: Working Together to Meet the Challenge of TB Presented by: Barbara Cole, RN, PHN, MSN Director, Disease Control County of Riverside Department of Public Health Curry International TB
More informationTB Epidemiology. Richard E. Chaisson, MD Johns Hopkins University Center for Tuberculosis Research
This work is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike License. Your use of this material constitutes acceptance of that license and the conditions of use of materials on this
More informationNguyen Van Hung (NTP, Viet Nam)
Technical Consultation Meeting on the Programmatic Management of Latent Tuberculosis Infection 31 August-1 September 2017, Seoul, Republic Korea Adopting new LTBI diagnostics at country level: perspective
More informationMULTIDRUG- RESISTANT TUBERCULOSIS. Dean Tsukayama Hennepin County Medical Center Hennepin County Public Health Clinic
MULTIDRUG- RESISTANT TUBERCULOSIS Dean Tsukayama Hennepin County Medical Center Hennepin County Public Health Clinic I have no relevant financial relationships. Discussion includes off label use of: amikacin
More informationCommunicable Disease Control Manual Chapter 4: Tuberculosis
Provincial TB Services 655 West 12th Avenue Vancouver, BC V5Z 4R4 www.bccdc.ca Communicable Disease Control Manual Definitions Page 1 2.0 DEFINITIONS Many of the definitions that follow are taken from
More informationContact Investigation
Tuberculosis Ann Raftery, RN, PHN, MSc GHS Learning Objectives Upon completion of this session, participants will be able to: Describe the criteria used and method for determining the infectious period
More informationManaging Complex TB Cases Diana M. Nilsen, MD, RN
Managing Complex TB Cases Diana M. Nilsen, MD, RN Director of Medical Affairs NYC Department of Health & Mental Hygiene Bureau of TB Control Case #1 You are managing a patient who was seen at a private
More informationPediatric TB Lisa Armitige, MD, PhD September 28, 2011
TB Nurse Case Management Davenport, Iowa September 27 28, 2011 Pediatric TB Lisa Armitige, MD, PhD September 28, 2011 Lisa Armitige, MD, PhD has the following disclosures to make: No conflict of interest.
More informationTB Outbreak Investigation in Fishery Workers, Maryland. Cassandra Althauser PHASE Internship Maryland Department of Health and Human Hygiene
TB Outbreak Investigation in Fishery Workers, Maryland Cassandra Althauser PHASE Internship Maryland Department of Health and Human Hygiene Airborne Transmission Tuberculosis Small droplet nuclei (
More informationTurning Off the Spigot Reducing Nosocomial Drug Resistant TB. Edward A. Nardell, MD Harvard Medical School/PIH Brigham & Women s Hospital
Turning Off the Spigot Reducing Nosocomial Drug Resistant Transmission Edward A. Nardell, MD Harvard Medical School/PIH Brigham & Women s Hospital is an airborne infection Every case of MDR/XDR prevented
More informationOnline Annexes (2-4)
Online Annexes (2-4) to WHO Policy update: The use of molecular line probe assays for the detection of resistance to isoniazid and rifampicin THE END TB STRATEGY Online Annexes (2-4) to WHO Policy update:
More informationDiagnosis of drug resistant TB
Diagnosis of drug resistant TB Megan Murray, MD, ScD Harvard School of Public Health Brigham and Women s Hospital Harvard Medical School Broad Institute Global burden of TB 9 million new cases year 2 million
More informationThe first National TB Prevalence Survey Rwanda 2012
The first National TB Prevalence Survey Rwanda 2012 Preliminary Results 29 th April 2013 Patrick Migambi Rwanda Biomedical Centre (RBC) Background Indicator (2011) Population size(census 2012) 10,537,222
More informationTB Program and Epidemic aka B2B
TB Program and Epidemic aka B2B Nulda Beyers On behalf of DTTC BOD Workshop 30 September2013 Trend in tuberculosis incidence, selected countries in Africa 1400 1200 Rate per 100,000 1000 800 600 400 200
More informationLet s Talk TB. A Series on Tuberculosis, A Disease That Affects Over 2 Million Indians Every Year
A Series on Tuberculosis, A Disease That Affects Over 2 Million Indians Every Year Lancelot M. Pinto, MD, MSc Author Madhukar Pai, MD, PhD co-author and Series Editor Abstract Nearly 50% of patients with
More informationTB Intensive Houston, Texas. Childhood Tuberculosis Kim Connelly Smith. November 12, 2009
TB Intensive Houston, Texas November 10-12, 12 2009 Childhood Tuberculosis Kim Connelly Smith MD, MPH November 12, 2009 Childhood Tuberculosis Kim Connelly Smith MD, MPH November 12, 2009 1 OUTLINE Stages
More informationDrug Resistant Tuberculosis Biology, Epidemiology and Control Dr. Christopher Dye
Director of Health Information World Health Organization Geneva 1 1. Why TB patients are treated with drugs 2 Natural history and control of TB Fast 5/1 Slow 5/1 Uninfected Latent Active 1 1 infection/case
More informationDiagnosis of tuberculosis
Diagnosis of tuberculosis Madhukar Pai, MD, PhD Assistant Professor, Epidemiology McGill University, Montreal, Canada madhukar.pai@mcgill.ca Global TB Case Detection A major concern 2.6 million new smear
More informationTB Laboratory for Nurses
TB Laboratory for Nurses Shea Rabley, RN, MN Consultant Mayo Clinic Center for Tuberculosis 2014 MFMER slide-1 Disclosures None 2014 MFMER slide-2 Objectives Participants will be able to: 1. Name 2 safety
More informationTB: Management in an era of multiple drug resistance. Bob Belknap M.D. Denver Public Health November 2012
TB: Management in an era of multiple drug resistance Bob Belknap M.D. Denver Public Health November 2012 Objectives: 1. Explain the steps for diagnosing latent and active TB role of interferon-gamma release
More informationTB 101 Disease, Clinical Assessment and Lab Testing
TB 101 Disease, Clinical Assessment and Lab Testing Pacific Islands Tuberculosis Controllers Association Conference (PITCA) Clinical Laboratory Breakout None Disclosure Objectives Be able to list and explain
More informationSubstance Abuse and Tuberculosis Springfield, IL April 27, 2011
5/6/2011 Substance Abuse and Tuberculosis Springfield, IL April 27, 2011 Epidemiology of Substance Abuse and Tuberculosis: Where is the Problem? Debra Stephens, RN, BSN, MPH April 27, 2011 Debra Stephens,
More informationPediatric Drug-Resistant TB in China
Pediatric Drug-Resistant TB in China Shuihua Lu,Tao Li Shanghai Public Health Clinical Center Jan.18,2013 A MDR-TB CASE A four and a half years old boy, spent 4 yeas of his life in hospital. His childhood
More informationMycobacterium tuberculosis
Mycobacterium tuberculosis Mycobacterium tuberculosis Ø small, aerobic, nonmotile bacteria Ø Gram-positive bacillus Ø can survive in a dry state for weeks Ø grow only within the cells of a host organism
More informationTB Control in Finland - the role of THL
TB Control in Finland - the role of THL Hanna Soini THL, Department of Health Security 1 TB in Finland 1950-2014 12000 10000 8000 6000 TB ulkomaalaiset TB yhteensä 4000 2000 0 1950 1955 1960 1965 1970
More informationTB EPIDEMIOLOGY. Outline. Estimated Global TB Burden, TB epidemiology
TB EPIDEMIOLOGY TB Clinical Intensive Course Curry International Tuberculosis Center September 30, 2015 Varsha Nimbal, MPH Tuberculosis Control Branch California Department of Public Health 1 Outline TB
More informationDiagnosing Xpert MTB/RIF negative TB suspects: Impact and cost of an alternative algorithm
Diagnosing Xpert MTB/RIF negative TB suspects: Impact and cost of an alternative algorithm Kathryn Schnippel 1, Gesine Meyer-Rath 1,2, Lawrence Long 1, Wendy Stevens 3,4, Ian Sanne 1,2, and Sydney Rosen
More informationBackground paper number 7
Background paper number 7 Lessons learnt and policy implications from recently completed TB disease prevalence surveys and their interpretation - Vietnam Binh Hoa Nguyen Prevalence survey in Vietnam 2006-2007
More informationPREVALENCE OF HIV INFECTION AND RISK FACTORS OF TUBERCULIN INFECTION AMONG HOUSEHOLD CONTACTS IN AN HIV EPIDEMIC AREA: CHIANG RAI PROVINCE, THAILAND
JOURNAL OF SCIENCE, Hue University, N 0 61, 2010 PREVALENCE OF HIV INFECTION AND RISK FACTORS OF TUBERCULIN INFECTION AMONG HOUSEHOLD CONTACTS IN AN HIV EPIDEMIC AREA: CHIANG RAI PROVINCE, THAILAND Pornnapa
More informationAT HIGH RISK OF PROGRESSING TO ACTIVE TB? Senior Lecturer and Consultant Physician University Hospitals of Leicester UK
HOW WELL DO IGRAS PERFORM IN THE IDENTIFICATION OF PERSONS WHO ARE AT HIGH RISK OF PROGRESSING TO ACTIVE TB? Dr Pranab Haldar MD MRCP Senior Lecturer and Consultant Physician University Hospitals of Leicester
More informationYakima Health District BULLETIN
Yakima Health District BULLETIN Summary Volume 13, Issue 1 February, 2014 Tuberculosis in Yakima County The rate of active tuberculosis (TB) in Yakima County has declined by about two-thirds over the past
More informationHaley Blake Sage Nagai, MPH. Disease Investigation and Intervention Specialists Tuberculosis Treatment and Control Clinic
Haley Blake Sage Nagai, MPH Disease Investigation and Intervention Specialists Tuberculosis Treatment and Control Clinic Discuss the prevalence of tuberculosis in Clark County Describe factors influencing
More informationContact Investigation San Antonio, Texas January 14-15, 2013
Contact Investigation San Antonio, Texas January 14-15, 2013 Detecting and Handling a TB Outbreak Jessica Quintero, BAAS January 15, 2013 Jessica Quintero, BAAS has the following disclosures to make: No
More informationTB/HIV 2 sides of the same coin. Dr. Shamma Shetye, MD Microbiology Metropolis Healthcare, Mumbai
TB/HIV 2 sides of the same coin Dr. Shamma Shetye, MD Microbiology Metropolis Healthcare, Mumbai Global- Tb new cases Diagnosis-Microscopy ZN,Flourescent microscopy(fm) Rapid, inexpensive test Specificity>95%
More informationAll you need to know about Tuberculosis
All you need to know about Tuberculosis What is tuberculosis? Tuberculosis is an infectious disease that usually affects the lungs. Doctors make a distinction between two kinds of tuberculosis infection:
More informationMycobacteria Diagnostic Testing in Manitoba. Dr. Michelle Alfa Medical Director, DSM Clin Micro Discipline
Mycobacteria Diagnostic Testing in Manitoba Dr. Michelle Alfa Medical Director, DSM Clin Micro Discipline Acknowlegements: Assunta Rendina: Charge Tech HSC Lab Joyce Wolf & Dr. Meenu Sharma: NML Dr. Kanchana
More informationTB Disease Prevalence Survey - Overview and Introduction of the TF
TB Disease Prevalence Survey - Overview and Introduction of the TF Ikushi Onozaki MD, MPH Team Leader, TB Prevalence Survey WHO Global Task Force on TB Impact Measurement Stop TB Department, WHO onozakii@who.int
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Churchyard GJ, Stevens WS, Mametja LD, et al.
More information