Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
|
|
- Melvyn Lawrence
- 6 years ago
- Views:
Transcription
1 Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets determined after acid ethanol extraction (B) (n = ). *P <.5; **P <.. Values are the means ± SE. White bars, ; black bars,. Supplemental Fig.. Beta cell mass growth during days postsurgery in WT mice and WT mice. Beta cell mass (n = 5). The black line superimposed on the bars represents the theoretical beta cell mass postsurgery. Values are the means ± SE. White bars, ; black bars,. Supplemental Fig.. BrdU- and insulin-positive cells in islet and BrdU-positive cells in acinar. Representative histology of endocrine pancreas staining with BrdU and insulin antibody in WT and IRS- -/- mice (A), and in WT and Gck +/- mice (B) on postoperative day. The panels with red frame show high magnification images of BrdU- and insulinpositive cells in islets after a pancreatectomy. The panels with black flame show high magnification images of BrdU-positive cells in acinar cells after a pancreatectomy. Supplemental Fig.. The expression of phospho-histone H in the islets from WT and IRS- -/- mice after a pancreatectomy on postoperative days and. Estimation of phospho-histone H positive β cells on postoperative days and (n = 5). Values are the means ± SE. White bars, ; black bars,. Supplemental Fig. 5. No significant change was observed in islet neogenesis in WT and IRS- -/- mice after a pancreatectomy. The percentage of small insulin + cell clusters (<5 μm ) to total islet number was estimated on postoperative day (n = 5). Values are the means ± SE. White bars, more than 5 μm β cell population; black bars, less than 5 μm β cell population. Supplemental Fig.. Changes in gene expression levels in the islets from WT and IRS- -/- mice after a pancreatectomy on postoperative day. Each expression level was quantified (n = -5). *P <.5; **P <.. Values are the means ± SE. White bars, ; black bars,. Supplemental Fig. 7. Gck +/- mice developed diabetes after a % partial pancreatectomy. (A and B) Body weight gain (A) and Casual blood glucose levels (B) in WT and Gck +/- mice after surgery (n=). *P <.5 vs. Gck +/- ; **P < vs.. Gck +/- ; P <.5 vs. WT; P <. vs. WT. (C and D) Glucose tolerance in WT and Gck +/- mice on postoperative day. Blood glucose levels (C) and serum insulin levels (D) (n = 7-). (E) Casual blood glucose levels and serum insulin levels on postoperative day (n = ). (F and G) Insulin tolerance in WT and Gck +/- mice on
2 postoperative day 7 (n = 5-). Blood glucose levels and AUC (F). Glucose value is calculated as a ratio of baseline glucose value (G). **P <. vs. Gck +/- ; P <.5 vs. WT. Values are the means ± SE. Open circles, WT; closed circles, WT; open square, Gck +/- ; closed square, Gck +/- ; white bars, ; black bars,. Supplemental Fig.. Changes in gene expression levels in the islets from WT and Gck +/- mice after a pancreatectomy on postoperative day. Each expression level was quantified (n = -). *P <.5; **P <.. Values are the means ± SE. White bars, ; black bars,.
3 Supplemental Fig. A WT IRS- -/- WT IRS- -/- WT IRS- -/- Insulin (ng/ islets). mm. mm. mm B * Insulin content (ng/ islets) ** WT IRS- -/-
4 Supplemental Fig. β-cell mass (mg).5.5 d d d Days post-
5 Supplemental Fig. A WT IRS- -/- B WT Gck +/-
6 Supplemental Fig. phospho-histone H-positive β-cell (%) WT IRS- -/- day WT IRS- -/- day
7 Supplemental Fig. 5 Number % of the total islet μm < 5 μm WT IRS- -/-
8 Supplemental Fig..5.5 PDX WT IRS- -/- FoxM AurkB WT IRS- -/- WT IRS- -/- survivin WT IRS- -/- Cyclin A WT IRS- -/- Cyclin B Cyclin B Cyclin D Cyclin D Cyclin D 5 5 WT IRS- -/- WT IRS- -/-.5.5 WT IRS- -/ WT IRS- -/- WT IRS- -/- Cyclin E Cyclin E p p p p=.9 p=.7 p=. WT IRS- -/- WT IRS- -/- WT IRS- -/- WT IRS- -/- WT IRS- -/- p7 Ezh IRS- INS INS.5.5 WT IRS- -/- WT IRS- -/- WT IRS- -/-.5.5 WT IRS- -/-.5.5 WT IRS- -/-
9 Supplemental Fig. 7 A B Body weight (g) WT WT Gck +/- Gck +/- d d d d9 d d Blood glucose (mg/dl) d d d d9 d d Days post- Days post- C D Blood glucose (mg/dl) 5 Insulin (ng/ml) 5 5 Time (minutes) Time (minutes) E Blood glucose (mg/dl) 5 Insulin (ng/ml) F Blood glucose (mg/dl) AUC[ (mg/l) h] 5 9 Time (minutes)
10 Supplemental Fig. Glucokinase IRS-.5.5 PDX FoxM 7 5 AurkB survivin Cyclin A Cyclin B Cyclin B Cyclin D Cyclin D.5.5 Cyclin D Cyclin E Cyclin E p p=. p=..5.5 p=.7 p p p
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationBPA exposure during pregnancy: risk for gestational diabetes and diabetes following pregnancy
BPA exposure during pregnancy: risk for gestational diabetes and diabetes following pregnancy Paloma Alonso-Magdalena Applied Biology Department and CIBERDEM, Miguel Hernández University, Elche, Spain
More informationDiabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment
Supplementary Information Diabetic pdx1-mutant zebrafish show conserved responses to nutrient overload and anti-glycemic treatment Robin A. Kimmel, Stefan Dobler, Nicole Schmitner, Tanja Walsen, Julia
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationPolycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus
Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino
More informationSupplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance
Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationβ-cell Preservation and Regeneration After Islet Transplantation
β-cell Preservation and Regeneration After Islet Transplantation Jyuhn-Huarng Juang, MD Division of Endocrinology and Metabolism, Department of Internal Medicine, Chang Gung University and Memorial Hospital,
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationControl of Glucose Metabolism
Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream
More informationInhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationThe Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis
The Effects of Exenatide on the Autoimmune Development of Diabetes A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for Graduation with Distinction in Microbiology in the Undergraduate
More informationGlucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x
Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationFig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
More informationMaternal malnutrition programmes a prediabetic phenotype in the progeny
Note: for non-commercial purposes only Maternal malnutrition programmes a prediabetic phenotype in the progeny Brigitte Reusens Institut des Sciences de la vie, Université catholique de Louvain, Louvain-la-Neuve,
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Baidal DA, Ricordi C, Berman DM, et al. Bioengineering of an
More informationCell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue
Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Kevin Docherty University of Aberdeen ELRIG Drug Discovery 2016 ACC Liverpool 14 th October 2016 Autoimmune destruction
More informationSupplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with
More informationAbnormal endocrine pancreas function at birth in cystic fibrosis ferrets
Technical advance Abnormal endocrine pancreas function at birth in cystic fibrosis ferrets Alicia K. Olivier, 1 Yaling Yi, 2 Xingshen Sun, 2 Hongshu Sui, 2 Bo Liang, 2 Shanming Hu, 3 Weiliang Xie, 2 John
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. SemaB / mice have normal immune cell populations. Cells were prepared from the spleens of WT and SemaB / mice, stained with various antibodies and then
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
More informationSecondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan
Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal
More informationMPB333:Molecular Endocrinology of Obesity and Diabetes
MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and
More informationOnline Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
More informationFigure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei.
Figure S1. Standard curves for amino acid bioassays. (A) The standard curve for leucine concentration versus OD600 values for L. casei. (B) The standard curve for lysine concentrations versus OD600 values
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationAtg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
More informationInhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors
Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors Ka-Cheuk Liu, Gunter Leuckx, Daisuke Sakano, Philip A. Seymour, Charlotte L. Mattsson, Linn Rautio, Willem Staels, Yannick Verdonck,
More informationControlled induction of human pancreatic progenitors produces functional beta-like cells in vitro.
Manuscript EMBO-2015-91058 Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro. Holger A Russ, Audrey V Parent, Jennifer J Ringler, Thomas G Hennings, Gopika
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationBeyond the Naked Eye: A Case Presentation on a Rare Form of Congenital Hyperinsulinism (HI) Patient Demographics 5/12/2016
Beyond the Naked Eye: A Case Presentation on a Rare Form of Congenital Hyperinsulinism (HI) Pediatric Endocrine Nursing Society May 14, 2016 Enyo Dzata, MSN, CRNP Congenital Hyperinsulinism Center Division
More informationClonetics Cells in Pancreatic Cancer Research
Pharma&Biotech BioResearch Clonetics Cells in Pancreatic Cancer Research 1 April 2014 / Speaker: Andrew Winner 2 April 2014 / Speaker: Dr. Nazim El-Andaloussi Lonza Cologne GmbH, Cologne / 28 March 2013
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSupplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationDefects in glucose utilization & GLP-1
Defects in glucose utilization & GLP-1 Song, Dae-Kyu Department of Physiology & Chronic Disease Research Center Keimyung University School of Medicine 2800 dalgubeol-daero, Dalseo-gu, Daegu, 704-701, Korea
More informationAn Unexpected Cause of Hypoglycemia
An Unexpected Cause of Hypoglycemia Stacey A. Milan, MD FACS Surgical Oncology Nothing to disclose Disclosures Objectives Identify indications for workup of hypoglycemia Define work up for hypoglycemic
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More information(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),
Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells
More informationDiabetes appears when b-cell mass is insufficient
ORIGINAL ARTICLE Activation of Protein Kinase C-z in Pancreatic b-cells In Vivo Improves Glucose Tolerance and Induces b-cell Expansion via mtor Activation Silvia Velazquez-Garcia, 1 Shelley Valle, 1 Taylor
More informationLai et al 2008 JCI RG-Revision 2
Lai et al 2008 JCI 36612-RG-Revision 2 Suppmentary Table 1. Epitope specific dystrophin antibodies Name Epitope Dilution Source Dys-3* Hinge 1 1:20 Novocastra Dys-1 Repeats 6-8 1:100 Novocastra Mandys8
More informationMetabolic Disease drug discovery at Evotec
Metabolic Disease drug discovery at Evotec Evotec, Metabolic Disease Drug Discovery, 2016 Evotec, an ideal partner in metabolic disease drug discovery The different ways to work with us On your specific
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 2 3 4 SUPPLEMENTARY TABLES Supplementary Table S1. Brain Tumors used in the study Code Tumor Classification Age Gender HuTuP51 Glioblastoma 57 Male HuTuP52 Glioblastoma 53 Male
More informationLab Activity 21. Endocrine System Glucometer. Portland Community College BI 232
Lab Activity 21 Endocrine System Glucometer Portland Community College BI 232 2 Hormone Functions ACTH (adrenocorticotropic hormone) Regulates the activity of the cortex of the adrenal gland TSH (thyroid
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
More informationXenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationEndocrine Histology Lab GUIDE TO MICROSCOPES IN LAB
Endocrine Histology Lab GUIDE TO MICROSCOPES IN LAB The micrographs that appear on this review page are typical views of the tissues seen in the laboratory. The descriptions that accompany them are designed
More informationReport on Pathology. Study: The effect of Compound X on pancreatic islets in rhesus macaques
Report on Pathology Study: The effect of Compound X on pancreatic islets in rhesus macaques Prepared for: Client Name Client Address January 1, 2013 Prepared by: Charter Preclinical Services 21 Main St.,
More informationPANCREATIC BETA CELLS PRODUCE AND SECRETE
15 March, 2018 PANCREATIC BETA CELLS PRODUCE AND SECRETE Document Filetype: PDF 374.06 KB 0 PANCREATIC BETA CELLS PRODUCE AND SECRETE Among the oldest and cheapest drugs for diabetes are the drugs that
More informationLab 14 Endocrine System
Lab 14 Endocrine System Laboratory Objectives Identify the location of the primary endocrine organs. List the hormones produced by the endocrine organs. Relate the mechanisms of up-regulation and down-regulation
More informationSupplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A)
Supplementary Figure 1: Characterisation of phospho-fgfr-y463 antibody. (A) Cells over-expressing hfgfr1-pcdna3 (+) or pcdna3 (-) were stimulated for 10 minutes with 50ng/ml FGF2 and lysates immunoblotted
More informationWhat is Diabetes Mellitus?
Normal Glucose Metabolism What is Diabetes Mellitus? When the amount of glucose in the blood increases, After a meal, it triggers the release of the hormone insulin from the pancreas. Insulin stimulates
More informationCell therapeutics for the Insulin-Dependent Diabetes Mellitus
Cell therapeutics for the Insulin-Dependent Diabetes Mellitus Haekwon Kim Dept. of Biotechnology Seoul Women s University Introduction Type I diabetes is caused by the autoimmune destruction of pancreatic
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationIMIDIA IMPROVING BETA-CELL FUNCTION AND IDENTIFICATION OF DIAGNOSTIC BIOMARKERS FOR TREATMENT MONITORING IN DIABETES. A. Ktorza, B.
IMIDIA IMPROVING BETA-CELL FUNCTION AND IDENTIFICATION OF DIAGNOSTIC BIOMARKERS FOR TREATMENT MONITORING IN DIABETES A. Ktorza, B. Thorens DIABETES Definition Diabetes is a metabolic disease characterized
More informationIslets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled
Are adult pancreatic beta cells formed by self-duplication or stem cell differentiation? Introduction Researchers have long been interested in how tissues produce and maintain the correct number of cells
More informationImpact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice
Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki
More information18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin
18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function
More informationThyroid Gland. Chapter 18 Part 2. Thyroid gland. Thyroid Gland. Thyroid Gland. Parathyroid Gland. Adrenal Gland. Pancreas
Thyroid Gland Chapter 18 Part 2 Synthesis and function of Thyroid hormone Calcitonin and Calcium regulation Parathyroid Gland PTH and Calcium regulation Adrenal Gland The corticosteroids Pancreas Regulation
More informationInterleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
More informationβ cell replication is the primary mechanism for maintaining postnatal β cell mass
Research article β cell replication is the primary mechanism for maintaining postnatal β cell mass Senta Georgia and Anil Bhushan Department of Biochemistry and Molecular Biology, University of Southern
More informationsyx M18 M13 M18 M13 E *** M18 M13
syx D syx M13 F % with cluster 8 6 4 G 3 rnd Syx rnd M13 ** rnd M13 H E % with anule 8 6 4 bg syx rnd F cell S a c Supplementary Fig 1. Quantification of membrane protein clusters beneath anules. TIRF-M
More informationChapter 13 worksheet
Name: Chapter 13 worksheet The Endocrine System Please label the: hypothalamus pineal gland pituitary gland thyroid gland parathyroid gland thymus heart stomach liver adrenal glands kidneys pancreas small
More informationPancreas Quizzes c. Both A and B a. Directly into the blood stream (not using ducts)
Pancreas Quizzes Quiz 1 1. The pancreas produces hormones. Which type of hormone producing organ is the pancreas? a. Endocrine b. Exocrine c. Both A and B d. Neither A or B 2. Endocrine indicates hormones
More informationMouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were
Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according
More informationTitle: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
More informationFigure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice.
Figure S1. Body composition, energy homeostasis and substrate utilization in LRH-1 hep+/+ (white bars) and LRH-1 hep-/- (black bars) mice. (A) Lean and fat masses, determined by EchoMRI. (B) Food and water
More informationEndocrine System. Regulating Blood Sugar. Thursday, December 14, 17
Endocrine System Regulating Blood Sugar Stress results in nervous and hormonal responses. The adrenal glands are located above each kidney. Involved in stress response. Stress Upsets Homeostasis Stress
More informationFigure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)
Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice
More informationSupplementary Information
Supplementary Information Astrocytes regulate adult hippocampal neurogenesis through ephrin-b signaling Randolph S. Ashton, Anthony Conway, Chinmay Pangarkar, Jamie Bergen, Kwang-Il Lim, Priya Shah, Mina
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSupplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
More informationEffects of Novel Growth Hormone Secretagogues on Growth Hormone Secretion in Farm Animals
Beef Research Report, 1996 Animal Science Research Reports 1997 Effects of Novel Growth Hormone Secretagogues on Growth Hormone Secretion in Farm Animals Lloyd L. Anderson Iowa State University Follow
More informationBody Mass Index Chart = overweight; = obese; >40= extreme obesity
Pathophysiology of type 2 diabetes mellitus R. Leibel Naomi Berrie Diabetes Center 26 February 2007 Body Mass Index Chart 25-29.9 = overweight; 30-39.9= obese; >40= extreme obesity 5'0" 5'2" 5'4" Weight
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationOsteocalcin and DM 정호연 강동경희대병원
Osteocalcin and DM 정호연 강동경희대병원 leptin osteoporosis fractures Endocrine feedback? Obesity, DM Osteocalcin OC is osteoblast specific protein OC -/- shows abnomal visceral fat Is Osteocalcin a candidate?
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationSupplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
More informationCD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
More informationRole of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationGFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
More informationDuctal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids
Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More information