DNA Microarray Analysis of the Epithelial Mesenchymal Transition of Mesothelial Cells in a Rat Model of Peritoneal Dialysis

Size: px
Start display at page:

Download "DNA Microarray Analysis of the Epithelial Mesenchymal Transition of Mesothelial Cells in a Rat Model of Peritoneal Dialysis"

Transcription

1 Advances in Peritoneal Dialysis, Vol. 27, 2011 Toshimi Imai, Ichiro Hirahara, Yoshiyuki Morishita, Akira Onishi, Makoto Inoue, Shigeaki Muto, Eiji Kusano DNA Microarray Analysis of the Epithelial Mesenchymal Transition of Mesothelial Cells in a Rat Model of Peritoneal Dialysis Long-term peritoneal dialysis induces peritoneal hyperpermeability, and the subsequent loss of ultrafiltration causes patients to discontinue peritoneal dialysis. Glucose degradation products (GDPs) in peritoneal dialysis fluids (PDFs) are probably one of the primary causes for peritoneal injury. In the present study, we used a transcriptome analysis to determine the mechanism of peritoneal injury by GDPs. Rats were administered 20 mmol/l methylglyoxal (MGO) in PDF or 20 mmol/l formaldehyde in PDF (100 ml/kg) intraperitoneally for 21 days. The peritoneal membrane in rats that received MGO showed increased thickness and fibrosis. Mesenchymal-like cells over-proliferated on the surface of the peritoneum. A DNA microarray analysis revealed that the expression of 168 genes had increased by more than a factor of 4. The upregulated genes included those that code for extracellular matrix components (such as types III and IV collagen, among others), cell division cycle 42 (Cdc42), an enabled/vasodilator stimulated phosphoprotein-like protein [Ena/VASP (Evl)], and actin-related protein 2/3 complex subunits (Arp2/3). In conclusion, a rat model of peritoneal injury by GDPs induced mesothelial cells to redifferentiate and proliferate, with upregulation of Cdc42, the Evl Ena/VASP, and Arp2/3, suggesting that GDPs induce fibrous thickening of the peritoneal membrane by redifferentiation of mesothelial cells, resulting in hyperpermeability of the peritoneum. Key words Peritoneal injury, glucose degradation products, methylglyoxal, epithelial mesenchymal transition, Cdc42 From: Division of Nephrology, Department of Medicine, Jichi Medical University, Tochigi, Japan. Introduction Peritoneal dialysis (PD) is an established therapy for patients with end-stage renal disease, but successful long-term PD is difficult because of peritonitis and peritoneal dysfunction after exposure to PD fluids (PDFs). Many PDFs contain glucose degradation products (GDPs) as a result of heat sterilization. These GDPs for example, methylglyoxal (MGO) and formaldehyde (FA) are thought to damage the peritoneum, resulting in peritoneal fibrosis and loss of ultrafiltration (1,2), but the pathogenesis remains unclear. We therefore administered PDFs with GDPs intraperitoneally to rats every day and used a transcriptome analysis to determine the mechanism of peritoneal injury by GDPs. Methods Intraperitoneal injection of PDFs in animals The experiments were performed using male Sprague Dawley Crj:(CD)SD-IGS rats, 5 weeks of age, weighing about 215 g (Charles River Japan, Kanagawa, Japan), according to the US National Institutes of Health Guide for the Care and Use of Laboratory Animals. The animals were housed in an air-conditioned room kept at a constant temperature of 23 ± 2 C, with a relative humidity of 50% ± 10%, a 12-hour light/dark cycle, and free access to sufficient pellet food and water. The PDFs were prepared by adding 20 mmol/l MGO or 20 mmol/l FA to a PDF (2.5% glucose, 100 mmol/l NaCl, 35 mmol/l sodium lactate, 2 mmol/l CaCl 2, and 0.7 mmol/l MgCl 2 at ph 5.0), which was then sterilized by filtration. The rats were divided into three groups (n = 6 per group) and given the following solutions intraperitoneally for 21 days: group 1, 100 ml/kg of PDF without

2 12 Imai et al. GDPs; group2, 100 ml/kg of PDF containing MGO; group 3, 100 ml/kg of PDF containing FA. On the 22nd day of the experiment, the parietal peritoneum was sampled to perform either a histologic analysis or gene expression analysis. Analysis of gene expression by DNA microarray Gene expression in the parietal peritoneum was assessed using a DNA microarray. Total RNA was extracted from the peritoneum using the RNeasy Kit with the DNase Set (Qiagen, Hilden, Germany). Total RNA from the peritoneum was reverse transcribed using Superscript reverse transcriptase (Gibco, Rockville, MD, U.S.A.). The resulting complementary DNA was analyzed using microarrays representing approximately 24,000 rat genes (NimbleGen, Reykjavík, Iceland). Statistics Data are presented as mean ± standard deviation. Statistical comparisons use an analysis of variance. A p value less than 0.05 was considered significant. Results Cellular proliferation was prominent in the surface of the peritoneum in MGO-treated rats, with deposition of collagen fibers and neoangiogenesis [Figure 1(B,E)]. By contrast, FA-treated rats showed only mild fibrotic changes, with interstitial edema and no cellular proliferation [Figure 1(C,F)]. In control rats, the surface of the peritoneum was lined with a single layer of mesothelial cells [Figure 1(A,D)]. In MGO-treated rats, the expression of 168 genes in parietal peritoneum increased by a factor of more than 4. The upregulated genes included those coding for extracellular matrix components such as types I, III, IV, V, and VI collagen and fibronectin (Figure 2, Table I). In addition, expression of some proteins related to remodeling of the actin skeleton was upregulated. In MGO-treated rats, compared with control rats, gene expression of Cdc42, an enabled/ vasodilator stimulated phosphoprotein-like protein [Ena/VASP (Evl)], and actin-related protein 2/3 complex (Arp2/3) subunit 1B were increased by factors of 2.7, 2.2, and 6.8 respectively. The expression of many interleukins and cytokines tended to increase, but the difference was not significant, except in the case of transforming growth factor β. Discussion Long-term PD is limited by peritoneal dysfunction after exposure to dialysis solutions. Peritoneal dysfunction is associated with structural changes: mesothelial loss and thickening of the submesothelial compact zone. Glucose degradation products, one of the most harmful substances in PDFs, are thought to induce peritoneal dysfunction and structural change (1,2). The GDPs MGO and FA, which can both be found in commercially available PDFs, are characterized by severe toxicity to the peritoneum (1). Therefore, they are useful for elucidating the mechanism of peritoneal injury by GDPs. The GDPs induced increases in peritoneal thickness and decreases in peritoneal function. The peritoneal thickening was characterized by cellular and fibrous proliferation, which was consistent with the results of the DNA microarray analysis. The expression of collagen fibers and cytoskeletal proteins was enhanced in MGO-treated rats, but not in FA-treated rats. Tissue inhibitor of matrix metalloproteinase 1 inhibits the degradation of extracellular matrix by matrix metalloproteinases. Gene expression of that inhibitor was found to have significantly increased, which may account for the fibrosis and proliferation in MGO-treated rats. Mesenchymal-like cells were recognized on the surface of the peritoneum in MGO-treated rats but not in FA-treated rats. These cells are derived by the epithelial mesenchymal transition (EMT) of mesothelial cells (2). In mesothelial cells, MGO may induce EMT. Transforming growth factor β, enhanced in this study, is a master regulator of EMT (3). Protrusive structures formed by migrating and invading cells are called filopodia, lamellipodia, and invadopodia or podosomes (4). These morphology changes occur during EMT in carcinoma cells and are associated with actin cytoskeleton remodeling via Cdc42 (5), which plays an essential role in invadopodia formation. Lamellipodia contain a large actin assembly controlled mainly by Arp2/3, which is able to nucleate the polymerization of new actin filaments (6), and filopodia formation is associated with Cdc42 (5). The EMT of mesothelial cells may be accompanied by actin cytoskeleton remodeling, as occurs in carcinoma cells, because EMT gives mesothelial cells a migratory capacity (3,7). In MGO-treated rats, compared with control rats, expression of Cdc42, Evl, and Arp2/3 increased. Membrane type 1 matrix metalloproteinase

3 DNA Microarray Analysis of EMT of Mesothelium 13 1 Histopathology findings in parietal peritoneum of the study rats. (A) Control rat, hematoxylin and eosin (HE) stain. (B) Methylglyoxal (MGO) treated rat, HE stain. (C) Formaldehyde (FA) treated rat, HE stain. (D) Control rat, Azan stain. (E) MGO-treated rat, Azan stain. (F) FA-treated rat, Azan stain. All 100 magnification. figure 2 Scatter plot of gene expression in parietal peritoneum of the study rats. Gene expression levels in parietal peritoneum were analyzed using a DNA microarray. (A) Control rats compared with methylglyoxal (MGO) treated rats. (B) Control rats compared with formaldehyde (FA) treated rats. figure

4 14 Imai et al. ta b l e i Changes in gene expression of proteins in peritoneum exposed to glucose degradation products Parameter Change factor MGO vs. C FA vs. C MGO vs. FA Extracellular matrix Collagen type I α /7 8.3 Collagen type I α Collagen type III α Collagen type IV α Collagen type V α Collagen type V α Collagen type V α Collagen type VI α Collagen type VI α Collagen type VI α Fibronectin Matrix metalloproteinase (MMP) MMP Membrane type 1 MMP Tissue inhibitor of MMP Cytokine (growth factor) Epidermal growth factor Fibroblast growth factor Fibroblast growth factor Transforming growth factor β Vascular endothelial growth factor Interleukin Interleukin Interleukin Interleukin Interleukin Interleukin Interleukin Interleukin Cytoskeleton-related proteins Cdc Evl Actin-related protein 2/3 complex (Arp2/3) subunit 1B Dedicator of cytokinesis Tubulin α subunit Tubulin α Actin β Myosin, heavy polypeptide Calponin Tropomyosin Filamin A Fibulin Housekeeping protein GAPDH C = control group; MGO = methylglyoxal-treated group; FA = formaldehyde-treated group; Cdc42 = cell division cycle 42, Evl = protein of the enabled/vasodilator-stimulated phosphoprotein-like family; GAPDH = glyceraldehyde 3-phosphate dehydrogenase. (MT1-MMP) is a key enzyme in tumor-cell invasion (8), which is reported to be expressed in invadopodia after EMT. The Ena/Vasp family protein Evl, which is associated with remodeling of the actin cytoskeleton, is localized to the leading edges of lamellipodia (9). The foregoing results suggest that mesothelial

5 DNA Microarray Analysis of EMT of Mesothelium 15 cells undergo EMT and acquire motility by a mechanism similar to that in carcinoma cells, and that they move from the surface of the peritoneum to the submesothelial compact zone. Conclusions Glucose degradation products induced mesothelial cells to redifferentiate and proliferate, with upregulation of Cdc42, Arp2/3, MT1-MMP, and Evl. These results suggest that GDPs in PDFs induce peritoneal fibrous thickening through redifferentiation of mesothelial cells, resulting in hyperpermeability of the peritoneum. A Western blot analysis of these proteins is necessary to reveal the mechanisms of morphology change in mesothelial cells. Acknowledgment This study was funded by Terumo, Tokyo, Japan. Disclosures There was no financial involvement that might raise any question of bias in regard to this work or the conclusions, implications, and opinions stated therein. References 1 Hirahara I, Kusano E, Yanagiba S, et al. Peritoneal injury by methylglyoxal in peritoneal dialysis. Perit Dial Int 2006;26: Hirahara I, Ishibashi Y, Kaname S, Kusano E, Fujita T. Methylglyoxal induces peritoneal thickening by mesenchymal-like mesothelial cells in rats. Nephrol Dial Transplant 2009;4: Yáñez Mó M, Lara Pezzi E, Selgas R, et al. Peritoneal dialysis and epithelial-to-mesenchymal transition of mesothelial cells. N Engl J Med 2003;348: Yamaguchi H, Condeelis J. Regulation of the actin cytoskeleton in cancer cell migration and invasion. Biochim Biophys Acta 2007;1773: Yilmaz M, Christofori G. EMT, the cytoskeleton, and cancer cell invasion. Cancer Metastasis Rev 2009;28: Pollard TD. Regulation of actin filament assembly by Arp2/3 complex and formins. Annu Rev Biophys Biomol Struct 2007;36: Margetts PJ, Bonniaud P, Liu L, et al. Transient overexpression of TGF-β1 induces epithelial mesenchymal transition in the rodent peritoneum. J Am Soc Nephrol 2005;16: Poincloux R, Lizárraga F, Chavrier P. Matrix invasion by tumour cells: a focus on MT1 MMP trafficking to invadopodia. J Cell Sci 2009;122: Kwiatkowski AV, Gertler FB, Loureiro JJ. Function and regulation of Ena/VASP. Trends Cell Biol 2003;13: Corresponding author: Ichiro Hirahara, Division of Nephrology, Department of Medicine, Jichi Medical University, Yakushiji, Shimotsuke-shi, Tochigi Japan. hirahara@rpf.jp

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

Molecular Cell Biology - Problem Drill 20: Cytoskeleton and Cellular Mobility

Molecular Cell Biology - Problem Drill 20: Cytoskeleton and Cellular Mobility Molecular Cell Biology - Problem Drill 20: Cytoskeleton and Cellular Mobility Question No. 1 of 10 1. Which of the following statements about cytoskeletal filaments is correct? Question #1 (A) The Cytoskeleton

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

Manuel López Cabrera. Modelos experimentales para la investigación en DP

Manuel López Cabrera. Modelos experimentales para la investigación en DP Manuel López Cabrera Modelos experimentales para la investigación en DP Manuel López Cabrera Transición Mesotelio Mesénquima (MMT) como Marcador de Enfermedad y como Diana Terapéutica en Fibrosis Peritoneal

More information

Encapsulating Peritoneal Sclerosis (EPS)

Encapsulating Peritoneal Sclerosis (EPS) Encapsulating Peritoneal Sclerosis (EPS) Joni H. Hansson 1 Scott F. Cameron 1 Zenon Protopapas 1 Rajnish Mehrotra 2 1 Hospital of Saint Raphael/Yale University, New Haven, CT 2 Harbor-UCLA Medical Center,

More information

Peritoneal dialysis fluid-induced changes of the peritoneal membrane are reversible after peritoneal rest in rats

Peritoneal dialysis fluid-induced changes of the peritoneal membrane are reversible after peritoneal rest in rats Nephrol Dial Transplant (2005) 20: 189 193 doi:10.1093/ndt/gfh559 Advance Access publication 30 November 2004 Brief Report Peritoneal dialysis fluid-induced changes of the peritoneal membrane are reversible

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2610 Figure S1 FSMCs derived from MSLN CLN transgenic mice express smooth muscle-specific proteins. Beta-galactosidase is ubiquitously expressed within cultured FSMCs derived from MSLN

More information

Strategies to Preserve the Peritoneal Membrane. Reusz GS Ist Dept of Pediatrics Semmelweis University, Budapest

Strategies to Preserve the Peritoneal Membrane. Reusz GS Ist Dept of Pediatrics Semmelweis University, Budapest Strategies to Preserve the Peritoneal Membrane Reusz GS Ist Dept of Pediatrics Semmelweis University, Budapest Outline 1. Structure of the peritoneal membrane 2. Mechanisms of peritoneal injury 3. Signs

More information

European Respiratory Society Annual Congress. Presented at: of new drugs for respiratory diseases. Barcelona, Spain, September 7-11, 2013 Page 1

European Respiratory Society Annual Congress. Presented at: of new drugs for respiratory diseases. Barcelona, Spain, September 7-11, 2013 Page 1 PBI-4050, a novel first-in-class anti-fibrotic compound, reduces lung fibrosis in the bleomycin-induced lung fibrosis model: a comparative study with pirfenidone Presented at: Thematic Poster Session:

More information

MCB Topic 19 Regulation of Actin Assembly- Prof. David Rivier

MCB Topic 19 Regulation of Actin Assembly- Prof. David Rivier MCB 252 -Topic 19 Regulation of Actin Assembly- Prof. David Rivier MCB 252 Spring 2017 MCB 252 Cell Biology Topic 19 Regulation of Actin Assembly Reading: Lodish 17.2-17.3, 17.7 MCB 252 Actin Cytoskeleton

More information

Tissue renewal and Repair. Nisamanee Charoenchon, PhD Department of Pathobiology, Faculty of Science

Tissue renewal and Repair. Nisamanee Charoenchon, PhD   Department of Pathobiology, Faculty of Science Tissue renewal and Repair Nisamanee Charoenchon, PhD Email: nisamanee.cha@mahidol.ac.th Department of Pathobiology, Faculty of Science Topic Objectives 1. Describe processes of tissue repair, regeneration

More information

CMB621: Cytoskeleton. Also known as How the cell plays with LEGOs to ensure order, not chaos, is temporally and spatially achieved

CMB621: Cytoskeleton. Also known as How the cell plays with LEGOs to ensure order, not chaos, is temporally and spatially achieved CMB621: Cytoskeleton Also known as How the cell plays with LEGOs to ensure order, not chaos, is temporally and spatially achieved Lecture(s) Overview Lecture 1: What is the cytoskeleton? Membrane interaction

More information

Supporting Information

Supporting Information Supporting Information Desnues et al. 10.1073/pnas.1314121111 SI Materials and Methods Mice. Toll-like receptor (TLR)8 / and TLR9 / mice were generated as described previously (1, 2). TLR9 / mice were

More information

cell movement and neuronal migration

cell movement and neuronal migration cell movement and neuronal migration Paul Letourneau letou001@umn.edu Chapter 16; The Cytoskeleton; Molecular Biology of the Cell, Alberts et al. 1 Cell migration Cell migration in 3 steps; protrusion,

More information

Examination of the light microscopic slide of renal biopsy specimens by utilizing Low-vacuum scanning electron microscope

Examination of the light microscopic slide of renal biopsy specimens by utilizing Low-vacuum scanning electron microscope SCIENTIFIC INSTRUMENT NEWS 2017 Vol. 9 SEPTEMBER Technical magazine of Electron Microscope and Analytical Instruments. Article Examination of the light microscopic slide of renal biopsy specimens by utilizing

More information

Actin structure. Actin a highly conserved gene. Molecular Cell Biology

Actin structure. Actin a highly conserved gene. Molecular Cell Biology Harvey Lodish Arnold Berk Paul Matsudaira Chris A. Kaiser Monty Krieger Matthew P. Scott Lawrence Zipursky James Darnell Molecular Cell Biology Fifth Edition Chapter 19: Cytoskeleton I: Microfilaments

More information

Uncovering the mechanisms of wound healing and fibrosis

Uncovering the mechanisms of wound healing and fibrosis Any Questions??? Ask now or contact support support@sabiosciences.com 1-888-503-3187 International customers: SABio@Qiagen.com Uncovering the mechanisms of wound healing and fibrosis Webinar related questions:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Loss of Ena/VASP proteins inhibits filopodia and neuritogenesis. (a) Bar graph of filopodia number per stage 1 control and mmvvee (Mena/ VASP/EVL-null) neurons at 40hrs in culture. Loss of all

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

Actin binding proteins

Actin binding proteins Cell Adhesion & Migration ISSN: 1933-6918 (Print) 1933-6926 (Online) Journal homepage: http://www.tandfonline.com/loi/kcam20 Actin binding proteins Stephane R. Gross To cite this article: Stephane R. Gross

More information

Effect of a nutrient mixture on the localization of extracellular matrix proteins in HeLa human cervical cancer xenografts in female nude mice

Effect of a nutrient mixture on the localization of extracellular matrix proteins in HeLa human cervical cancer xenografts in female nude mice Effect of a nutrient mixture on the localization of extracellular matrix proteins in HeLa human cervical cancer xenografts in female nude mice Publication from the Dr. Rath Research Institute Experimental

More information

ORIGINAL PAPER DISRUPTION OF CELL SPREADING BY THE ACTIVATION OF MEK/ERK PATHWAY IS DEPENDENT ON AP-1 ACTIVITY

ORIGINAL PAPER DISRUPTION OF CELL SPREADING BY THE ACTIVATION OF MEK/ERK PATHWAY IS DEPENDENT ON AP-1 ACTIVITY Nagoya J. Med. Sci. 72. 139 ~ 144, 1 ORIGINAL PAPER DISRUPTION OF CELL SPREADING BY THE ACTIVATION OF MEK/ERK PATHWAY IS DEPENDENT ON AP-1 ACTIVITY FENG XU, SATOKO ITO, MICHINARI HAMAGUCHI and TAKESHI

More information

The cytoskeleton and cell movement. (Actin microfilaments)

The cytoskeleton and cell movement. (Actin microfilaments) The cytoskeleton and cell movement (Actin microfilaments) What is the cytoskeleton? A dynamic network of protein filaments extending throughout the cytoplasm Three types: microfilaments (actin), microtubules

More information

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D. Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications

More information

EPS meeting. Post-transplant EPS. Naarden, The Netherlands February 4 th 2010

EPS meeting. Post-transplant EPS. Naarden, The Netherlands February 4 th 2010 Naarden, The Netherlands February 4 th 2010 EPS meeting Post-transplant EPS Guido Garosi U.O.C. Nefrologia, Dialisi e Trapianto Azienda Ospedaliera Universitaria Senese Siena, Italy is post-transplant

More information

Plasticity of Tumor Cell Migration: Acquisition of New Properties or Return to the Past?

Plasticity of Tumor Cell Migration: Acquisition of New Properties or Return to the Past? ISSN 0006-2979, Biochemistry (Moscow), 2014, Vol. 79, No. 9, pp. 947-963. Pleiades Publishing, Ltd., 2014. Published in Russian in Biokhimiya, 2014, Vol. 79, No. 9, pp. 1169-1187. REVIEW Plasticity of

More information

encouraged to use the Version of Record that, when published, will replace this version. The most /BSR

encouraged to use the Version of Record that, when published, will replace this version. The most /BSR Bioscience Reports: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date

More information

A Role for Adseverin in the Invasion and Migration of. MCF7 Breast Adenocarcinoma Cells

A Role for Adseverin in the Invasion and Migration of. MCF7 Breast Adenocarcinoma Cells A Role for Adseverin in the Invasion and Migration of MCF7 Breast Adenocarcinoma Cells by Jelena Tanic A thesis submitted in conformity with the requirements for the degree of Master of Science Department

More information

Cytoskeleton and cell communication

Cytoskeleton and cell communication Cytoskeleton and cell communication Actin monomer has subdomains 1-4. A simplified cartoon is at right. ATP binds, along with Mg ++, within a deep cleft between subdomains 2 & 4. G-actin (globular actin),

More information

Long-term peritoneal dialysis and encapsulating peritoneal sclerosis in children

Long-term peritoneal dialysis and encapsulating peritoneal sclerosis in children Pediatr Nephrol (2010) 25:75 81 DOI 10.1007/s00467-008-0982-z EDUCATIONAL REVIEW Long-term peritoneal dialysis and encapsulating peritoneal sclerosis in children Masataka Honda Bradley A. Warady Received:

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence

More information

How to evaluate the peritoneal membrane?

How to evaluate the peritoneal membrane? How to evaluate the peritoneal membrane? B. Bammens Brussels, May 12 2016 BELGIUM How to evaluate a hemodialyzer? How to evaluate a hemodialyzer? How to evaluate a hemodialyzer? From: Robert W. Schrier

More information

A Mena Invasion Isoform Potentiates EGF-Induced Carcinoma Cell Invasion and Metastasis

A Mena Invasion Isoform Potentiates EGF-Induced Carcinoma Cell Invasion and Metastasis A Mena Invasion Isoform Potentiates EGF-Induced Carcinoma Cell Invasion and Metastasis The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters.

More information

Evaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL

Evaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL 12th symposium of the Association of Korean Dermatologists (2009) 1 Evaluation of the wound healing response post - deep dermal heating by fractional RF: INTRACEL Un-Cheol.Yeo, MD S&U Dermatologic Clinic,

More information

Evaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel

Evaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel 12th symposium of the Association of Korean Dermatologists (2009) 1 Evaluation of the wound healing response post deep dermal heating by fractional RF: INTRAcel Un-Cheol.Yeo, M.D. S&U Dermatologic Clinic,

More information

Top 10 Contributions on Biomedical Sciences: 2nd Edition. St Vincent s Hospital, The University of Melbourne, Australia 2

Top 10 Contributions on Biomedical Sciences: 2nd Edition. St Vincent s Hospital, The University of Melbourne, Australia 2 Chapter 06 Cancer Progression: The Impact of Cytoskeletal Molecules Sam L Francis 1 and Juliana Antonipillai 2 * 1 St Vincent s Hospital, The University of Melbourne, Australia 2 School of Health and Biomedical

More information

The renin angiotensin aldosterone system in peritoneal dialysis: is what is good for the kidney also good for the peritoneum?

The renin angiotensin aldosterone system in peritoneal dialysis: is what is good for the kidney also good for the peritoneum? http://www.kidney-international.org & 2010 International Society of Nephrology mini review The renin angiotensin aldosterone system in peritoneal dialysis: is what is good for the kidney also good for

More information

INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for

INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for INTRODUCTION Ovarian cancer is the leading cause of mortality from gynecologic malignancies in the industrialized countries and is responsible for more deaths than both cervical and endometrial tumours.

More information

A Case of Encapsulating Peritoneal Sclerosis Suspected to Result from the Use of Icodextrin Peritoneal Solution

A Case of Encapsulating Peritoneal Sclerosis Suspected to Result from the Use of Icodextrin Peritoneal Solution Advances in Peritoneal Dialysis, Vol. 25, 2009 Hideki Kawanishi, Sadanori Shintaku, Masayuki Shishida, Misaki Morrishi, Shinichiro Tsuchiya, Kiyohiko Dohi A Case of Encapsulating Peritoneal Sclerosis Suspected

More information

Fundamental research on breast cancer in Belgium. Rosita Winkler

Fundamental research on breast cancer in Belgium. Rosita Winkler Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -

More information

Advances in Peritoneal Dialysis, Vol. 27, 2011

Advances in Peritoneal Dialysis, Vol. 27, 2011 Advances in Peritoneal Dialysis, Vol. 27, 2011 Eriko Kojima, Tsutomu Inoue, Keita Sueyoshi, Takahiko Sato, Masahiro Tsuda, Tomohiro Kikuta, Yusuke Watanabe, Hiroshi Takane, Tsuneo Takenaka, Hiromichi Suzuki

More information

Cell Polarity and Cancer

Cell Polarity and Cancer Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways

More information

Rearrangements of the Actin Cytoskeleton and E-Cadherin Based Adherens Junctions Caused by Neoplasic Transformation Change Cell Cell Interactions

Rearrangements of the Actin Cytoskeleton and E-Cadherin Based Adherens Junctions Caused by Neoplasic Transformation Change Cell Cell Interactions Rearrangements of the Actin Cytoskeleton and E-Cadherin Based Adherens Junctions Caused by Neoplasic Transformation Change Cell Cell Interactions Dmitry V. Ayollo., Irina Y. Zhitnyak., Jury M. Vasiliev,

More information

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9

Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9 Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis

More information

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier

Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier Supplementary Figure S1 Expression of mir-181b in EOC (A) Kaplan-Meier curves for progression-free survival (PFS) and overall survival (OS) in a cohort of patients (N=52) with stage III primary ovarian

More information

MOLECULAR MEDICINE REPORTS 8: , 2013

MOLECULAR MEDICINE REPORTS 8: , 2013 MOLECULAR MEDICINE REPORTS 8: 1663-1668, 2013 Transforming growth factor β1 induces bronchial epithelial cells to mesenchymal transition by activating the Snail pathway and promotes airway remodeling in

More information

OPEN.

OPEN. www.nature.com/scientificreports Received: 17 October 2017 Accepted: 26 January 2018 Published: xx xx xxxx OPEN Acidic organelles mediate TGF-β1-induced cellular fibrosis via (pro)renin receptor and vacuolar

More information

Construction of Nephron by Fusion of Adult Glomeruli to Ureteric Buds with Type V Collagen. Yusuke Murasawa, Pi-chao Wang

Construction of Nephron by Fusion of Adult Glomeruli to Ureteric Buds with Type V Collagen. Yusuke Murasawa, Pi-chao Wang Construction of Nephron by Fusion of Adult Glomeruli to Ureteric Buds with Type V Collagen Yusuke Murasawa, Pi-chao Wang Abstract Although tissue engineering of artificial organs such as skin or cartilage

More information

Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C.

Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C. AD Award Number: W81XWH-08-1-0306 TITLE: Characterizing an EMT Signature in Breast Cancer PRINCIPAL INVESTIGATOR: Melanie C. Bocanegra CONTRACTING ORGANIZATION: Leland Stanford Junior University Stanford,

More information

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department

More information

Assembly of the Contractile System In Nonmuscle Cells. Tanya SVITKINA

Assembly of the Contractile System In Nonmuscle Cells. Tanya SVITKINA Assembly of the Contractile System In Nonmuscle Cells Tanya SVITKINA ACTIN MHC phosphorylation, S100A4 (Mts1) binding MYOSIN II QUASI-SARCOMERIC ORGANIZATION OF STRESS FIBERS Myosin and actin REF-52 fibroblasts

More information

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES. !! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions

More information

cells ISSN

cells ISSN Cells 2015, 4, 631-652; doi:10.3390/cells4040631 Review OPEN ACCESS cells ISSN 2073-4409 www.mdpi.com/journal/cells Epithelial-to-Mesenchymal Transition in Diabetic Nephropathy: Fact or Fiction? Ivonne

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach

Impact of NM23-M1 knock-out on metastatic potential of hepatocellular carcinoma: a transgenic approach Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical

More information

What Does Peritoneal Thickness in Peritoneal Dialysis Patients Tell Us?

What Does Peritoneal Thickness in Peritoneal Dialysis Patients Tell Us? Advances in Peritoneal Dialysis, Vol. 23, 2007 Soner Duman, 1 Suha Sureyya Ozbek, 2 Ebru Sevinc Gunay, 1 Devrim Bozkurt, 1 Gulay Asci, 1 Savas Sipahi, 1 Fatih Kirçelli, 1 Muhittin Ertilav, 1 Mehmet Özkahya,

More information

Metastasis: tumor cells becoming MENAcing

Metastasis: tumor cells becoming MENAcing Metastasis: tumor cells becoming MENAcing The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As Published Publisher Gertler,

More information

Prof. Sandrine Florquin Department of Pathology Academic Medical Center University of Amsterdam Amsterdam, The Netherlands. Slide 1.

Prof. Sandrine Florquin Department of Pathology Academic Medical Center University of Amsterdam Amsterdam, The Netherlands. Slide 1. Interleukin 17 in renal biopsies as risk factor for progression Sandrine Florquin, Amsterdam, The Netherlands Chairs: Mohamed R. Daha, Leiden, The Netherlands Pierre Ronco, Paris, France Prof. Sandrine

More information

Quantitative Data Analysis Assignment Sample Newessays.co.uk

Quantitative Data Analysis Assignment Sample Newessays.co.uk Absorbance Quantitative Data Analysis Assignment Sample Newessays.co.uk Part A: Results of the Study Is there a difference of curve profile between the MTT assay and the cell number? What do the different

More information

The biocompatibility of neutral ph, low-gdp peritoneal dialysis solutions: benefit at bench, bedside, or both?

The biocompatibility of neutral ph, low-gdp peritoneal dialysis solutions: benefit at bench, bedside, or both? http://www.kidney-international.org & 2011 International Society of Nephrology The biocompatibility of neutral ph, low-gdp peritoneal dialysis solutions: benefit at bench, bedside, or both? Jeffrey Perl

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

Cell Motility. Junfeng Ji ( 纪俊峰 ), PhD

Cell Motility.   Junfeng Ji ( 纪俊峰 ), PhD Cell Motility Junfeng Ji ( 纪俊峰 ), PhD Professor Laboratory of Somatic Reprogramming and Stem Cell Aging Center for Stem Cell and Tissue Engineering School of Medicine Zhejiang University Email: jijunfeng@zju.edu.cnedu

More information

Introduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats

Introduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium

More information

High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis

High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis Supplementary Material Supplementary Figure S1. Representative CRBP-1 immunostaining of non-neoplastic

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

Connective Tissue Response in IBD

Connective Tissue Response in IBD Connective Tissue Response in IBD Dr I C Lawrance MB BS, PhD FRACP School of Medicine and Pharmacology, University of Western Australia, Fremantle Hospital Intestinal response to Chronic Inflammation Control

More information

Research Article mirna589 Regulates Epithelial-Mesenchymal Transition in Human Peritoneal Mesothelial Cells

Research Article mirna589 Regulates Epithelial-Mesenchymal Transition in Human Peritoneal Mesothelial Cells Hindawi Publishing Corporation Journal of Biomedicine and Biotechnology Volume 212, Article ID 67396, 6 pages doi:1.1155/212/67396 Research Article mirna589 Regulates Epithelial-Mesenchymal Transition

More information

Citation Acta medica Nagasakiensia. 1997, 42

Citation Acta medica Nagasakiensia. 1997, 42 NAOSITE: Nagasaki University's Ac Title Author(s) Ultrastructural Study of the Perito Ambulatory Peritoneal Dialysis Horita, Yoshio Citation Acta medica Nagasakiensia. 1997, 42 Issue Date 1997-06-20 URL

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

Differential Remodeling of Actin Cytoskeleton Architecture by Profilin Isoforms Leads to Distinct Effects on Cell Migration and Invasion

Differential Remodeling of Actin Cytoskeleton Architecture by Profilin Isoforms Leads to Distinct Effects on Cell Migration and Invasion Differential Remodeling of Actin Cytoskeleton Architecture by Profilin Isoforms Leads to Distinct Effects on Cell Migration and Invasion The MIT Faculty has made this article openly available. Please share

More information

Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury

Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Bastian OW, Koenderman L, Alblas J, Leenen LPH, Blokhuis TJ. Neutrophils contribute to

More information

vi Preface Table 2 Association of Fibrosis With Types of Injury: Representative Examples

vi Preface Table 2 Association of Fibrosis With Types of Injury: Representative Examples Fibrosis or scar, defined pathologically as inappropriate repair by connective tissue, is increasingly recognized as an important feature of many chronic diseases (Table 1), and as such, represents an

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

UNIVERSITY OF YORK BSc Stage 2 Degree Examinations Department: BIOLOGY. Title of Exam: Cell Biology

UNIVERSITY OF YORK BSc Stage 2 Degree Examinations Department: BIOLOGY. Title of Exam: Cell Biology Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BSc Stage 2 Degree Examinations 2017-18 Department: BIOLOGY Title of Exam: Cell Biology Time allowed: 1 hour and 30 minutes Total marks available

More information

Advances in Peritoneal Dialysis, Vol. 29, 2013

Advances in Peritoneal Dialysis, Vol. 29, 2013 Advances in Peritoneal Dialysis, Vol. 29, 2013 Takeyuki Hiramatsu, 1 Takahiro Hayasaki, 1 Akinori Hobo, 1 Shinji Furuta, 1 Koki Kabu, 2 Yukio Tonozuka, 2 Yoshiyasu Iida 1 Icodextrin Eliminates Phosphate

More information

Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats

Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats Analysis on the mechanism of reduced nephron number and the pathological progression of chronic renal failure in Astrin deficient rats Summary of Doctoral Thesis Hidenori Yasuda Graduate School of Veterinary

More information

Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model

Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model Averi Leahy, Andrea Foote, Tomoya Uchimura, Li Zeng, PhD. Tufts University, Boston, MA, USA. Disclosures: A. Leahy: None.

More information

A RENAISSANCE FOR SRC

A RENAISSANCE FOR SRC A RENAISSANCE FOR SRC Timothy J. Yeatman The c-src non-receptor tyrosine kinase is overexpressed and activated in a large number of human malignancies and has been linked to the development of cancer and

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±

More information

BioScience Trends. 2017; 11(1):

BioScience Trends. 2017; 11(1): Original Article BioScience Trends. 2017; 11(1):77-84. 77 DOI: 10.5582/bst.2016.01224 Knocking down TCF8 inhibits high glucose- and angiotensin IIinduced epithelial to mesenchymal transition in podocytes

More information

The natural course of peritoneal membrane biology during peritoneal dialysis

The natural course of peritoneal membrane biology during peritoneal dialysis Kidney International, Vol. 64, Supplement 88 (2003), pp. S43 S49 The natural course of peritoneal membrane biology during peritoneal dialysis JOHN D. WILLIAMS, KATHRINE J. CRAIG, CHRIS VON RUHLAND, NICHOLAS

More information

BIOCHEMICAL INVESTIGATIONS IN THE DIAGNOSTICS OF CARDIOVASCULAR DISORDERS. As. MARUSHCHAK M.I.

BIOCHEMICAL INVESTIGATIONS IN THE DIAGNOSTICS OF CARDIOVASCULAR DISORDERS. As. MARUSHCHAK M.I. BIOCHEMICAL INVESTIGATIONS IN THE DIAGNOSTICS OF CARDIOVASCULAR DISORDERS As. MARUSHCHAK M.I. Heart attack symptoms Acute MI Measurement of cardiac enzyme levels Measure cardiac enzyme levels at regular

More information

Effects of Everolimus as an Antiproliferative Agent on Regression of Encapsulating Peritoneal Sclerosis in a Rat Model

Effects of Everolimus as an Antiproliferative Agent on Regression of Encapsulating Peritoneal Sclerosis in a Rat Model Advances in Peritoneal Dialysis, Vol. 24, 2008 Soner Duman, 1 Devrim Bozkurt, 1 Savas Sipahi, 1 Murat Sezak, 2 Sultan Özkan, 1 Muhittin Ertilav, 1 Sait Sen, 2 Ercan Ok 1 Effects of Everolimus as an Antiproliferative

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

Free water transport: Clinical implications. Sodium sieving during short very hypertonic dialysis exchanges

Free water transport: Clinical implications. Sodium sieving during short very hypertonic dialysis exchanges Free water transport: Clinical implications Raymond T Krediet, MD,PhD University of Amsterdam Sodium sieving during short very hypertonic dialysis exchanges Nolph KD et al. Ann Int Med 1969;70:931-947

More information

Healing & Repair. Tissue Regeneration

Healing & Repair. Tissue Regeneration Healing & Repair Dr. Srikumar Chakravarthi Repair & Healing: Are they same? Repair :Regeneration of injured cells by cells of same type, as with regeneration of skin/oral mucosa (requires basement membrane)

More information

Invited Revie W. Diabetic nephropathy: the modulating influence of glucose on transforming factor D production

Invited Revie W. Diabetic nephropathy: the modulating influence of glucose on transforming factor D production Histol Histopathol (1 998) 13: 565-574 Histology and Histopathology Invited Revie W Diabetic nephropathy: the modulating influence of glucose on transforming factor D production A.O. Phillips lnstitute

More information

Immunological Lung Diseases

Immunological Lung Diseases Emphysema and Fibrosis Universitätsklinik für Pneumologie Prof. Thomas Geiser Head Div. of Pulmonary Medicine and Laboratory of Lung Research, MU50 thomas.geiser@insel.ch The healthy lung: The pathway

More information

Supplemental Information

Supplemental Information Supplemental Information Prediction of Prostate Cancer Recurrence using Quantitative Phase Imaging Shamira Sridharan 1, Virgilia Macias 2, Krishnarao Tangella 3, André Kajdacsy-Balla 2 and Gabriel Popescu

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Review Article Mesenchymal Migration as a Therapeutic Target in Glioblastoma

Review Article Mesenchymal Migration as a Therapeutic Target in Glioblastoma Journal of Oncology Volume 2010, Article ID 430142, 17 pages doi:10.1155/2010/430142 Review Article Mesenchymal Migration as a Therapeutic Target in Glioblastoma Jessie Zhong, 1, 2 Andre Paul, 1 Stewart

More information

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation

The recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm

More information

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD

Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Stem cells in endometriosis: pathogenetic factors and target for new medical treatments? Alberto Revelli MD PhD Gyn/Obst 1U, Physiopathology of Reproduction and IVF Unit Dept. Surgical Sciences, S. Anna

More information

Cells. Variation and Function of Cells

Cells. Variation and Function of Cells Cells Variation and Function of Cells Cell Theory states that: 1. All living things are made of cells 2. Cells are the basic unit of structure and function in living things 3. New cells are produced from

More information

Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia!

Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Lorenz Poellinger! Dept. of Cell and Molecular Biology! Karolinska Institutet, Stockholm, Sweden! Normoxia - O 2 availability is in balance

More information