Human leukocyte antigen class II genotype in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody

Transcription

1 FERTILITY AND STERILITY VOL. 70, NO. 5, NOVEMBER 1998 Copyright 1998 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Human leukocyte antigen class II in patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody Isao Hataya, M.D., Koichi Takakuwa, M.D., and Kenichi Tanaka, M.D. Department of Obstetrics and Gynecology, Niigata University School of Medicine, Asahimachi-dori, Niigata, Japan Objective: To elucidate the relationship between human leukocyte antigen (HLA) class II s and patients with recurrent fetal miscarriage who are positive for anticardiolipin antibody. Design: Prospective clinical study. Setting: Institutional practice at the outpatient clinic for infertility, Niigata University Medical Hospital. Patient(s): with recurrent fetal miscarriage who were positive for anticardiolipin antibody and normal fertile women. Intervention(s): Genomic DNA was extracted from peripheral mononuclear cells. Main Outcome Measure(s): Human leukocyte antigen class II was determined using a polymerase chain reaction restriction fragment length polymorphism method. Result(s): The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in the patient group than in the control group. The frequency of DRB1*04 also was significantly higher in the patient group. As for HLA-DQ, the frequency of HLA-DQB1*0501 was significantly lower in the patient group. Conclusion: Human leukocyte antigen systems appear to be involved in the genesis of antiphospholipid syndrome. (Fertil Steril 1998;70: by American Society for Reproductive Medicine.) Key Words: Anticardiolipin antibody, antiphospholipid syndrome,, HLA class II, PCR-RFLP Received March 13, 1998; revised and accepted June 26, Reprint requests: Isao Hataya, M.D., Department of Obstetrics and Gynecology, Niigata University School of Medicine, 1-757, Asahimachi-dori, Niigata, , Japan (FAX: ) /98/$19.00 PII S (98) It has recently been suggested that autoimmune mechanisms are involved in the genesis of fetal miscarriage, including spontaneous abortion and intrauterine fetal demise. The concept of a new disease, the antiphospholipid syndrome or the reproductive autoimmune failure syndrome, has been proposed (1 4) and has been supported by several clinical reports (5 11), in which patients have diverse reproductive failures. These include recurrent fetal miscarriage, intrauterine fetal growth retardation, and preeclampsia, in connection with positivity for antiphospholipid antibodies. The abnormal generation of autoantibodies, such as those directed against phospholipids, in these patients is thought to suggest aberrations in immune regulation. The immunologic background of this disease entity, however, has not yet been analyzed fully. The human leukocyte antigen (HLA) systems are useful in examining the immunogenetic basis of some diseases because these systems control both the immune response to natural antigens and the susceptibility or resistance to several diseases, especially autoimmune diseases (12). It is also possible that HLA antigen systems are associated with recurrent fetal miscarriage in patients who are positive for antiphospholipid antibodies. Several reports based on serologic HLA typing have pointed out the positive association between patients with recurrent fetal miscarriage who are positive for antiphospholipid antibodies and specific HLA alleles (13, 14). A molecular genetic approach for determining HLA class II genes, however, has not yet been taken to analyze the association between the patients and specific HLA alleles. Polymerase chain reaction (PCR) in combination with restriction fragment length poly- 919

2 TABLE 1 Polymerase chain reaction primers for amplification of DRB1, DQB1, and DPB1 genes. Gene Primer Sequences (5 to 3 ) No. of base pairs Denaturing Annealing Extension DRB1 for DR2 5 primer 5 R2 TTCCTGTGGCAGCCTAAGAGG C 60 C 72 C for DR4 5 primer 5 R4 GTTTCTTGGAGCAGGTTAAAC C 60 C 72 C for DR1 5 primer 5 R1 GGTTGCTGGAAAGATGCATCT C 55 C 72 C for DR7 5 primer 5 R7 AGTTCCTGGAAAGACTCTTCT C 60 C 72 C for DR10 5 primer 5 R10 GGTTGCTGGAAAGACGCGTCC C 60 C 72 C for DR3 5 primer 5 R3568 ACGTTTCTTGGAGTACTCTACG C 60 C 72 C DR5 DR6 DR8 3 primer 3 R* CCGCTGCACTGTGAAGCTCT for DR9 5 primer 5 R9 GGACGGAGCGGGTGCGGTATC C 63 C 72 C 3 primer CCGTAGTTGTGTCTGCACACGG DQB1 for DQ1 5 primer GH28NL GCATGTGCTACTTCACCAACG C 55 C 72 C 3 primer QB202 CACCTGCAGATCCCGCGGTACGCCACCTC for DQ2 5 primer GH28NL GCATGTGCTACTTCACCAACG C 55 C 72 C DQ3 3 primer QB204 CACCTGCAGTGCGGAGCTCCAACTGGTA DQ4 DPB1 5 primer DPB101N GTGAAGCTTTCCCCGCAGAGAATTAC C 62 C 72 C 3 primer DPB201 CACCTGCAGTCACTCACCTCGGCGCTG * Common for DRB1 alleles except DR9 allele. morphism (RFLP) recently has become available for use in typing HLA class II genes at the nucleotide sequence level, thus enabling us to determine accurately two alleles of HLA class II genes in individuals (15 17). In this study, the frequency of s of HLA-DR, HLA-DQ, and HLA-DP antigens was evaluated by means of the PCR- RFLP method. This was done to clarify the role of the HLA class II antigens in patients positive for anticardiolipin antibody who repeatedly have fetal miscarriages. MATERIALS AND METHODS Fifty-six patients who experienced two or more recurrent abortions or fetal deaths and who were positive for anticardiolipin antibodies were enrolled in this study; all patients gave informed consent. with autoimmune disease, such as systemic lupus erythematosus (SLE), were excluded from the study. The control group consisted of 76 women who had not had recurrent fetal miscarriage and who had had at least two normal deliveries; these women were examined for HLA class II s after informed consent was obtained. All women in the control group were negative for anticardiolipin antibody. All individuals were Japanese women, and the difference between the mean age of the individuals in the two groups was not statistically significant. Measurement of Anticardiolipin Antibody Levels of anticardiolipin antibody were determined with use of an ELISA according to the modified method of Loizou et al. (18). Details of the method have been described elsewhere (9). GPL units in the test serum were estimated according to the standard curve drawn from the titration of control serum, and the cutoff value was 20 GPL units of the anticardiolipin antibody. Analyses of HLA Class II Genotypes Analyses of HLA-DRB1 s, HLA-DQB1 s, and HLA-DPB1 s were performed with use of the PCR-RFLP method. Primers used in this study are listed in Table 1, and endonucleases are listed in Table 2. TABLE 2 Restriction endonucleases for genotyping of DRB1, DQB1, and DPB1 alleles. Allele Antigen Restriction endonuclease DRB1 DR1 AvaII, PstI DR2 FokI, Cfr13I, HphI DR3, DR5, DR6, DR8 AvaII, FokI, KpnI, HaeII, Cfr13I, SfaNI, SacII, BsaJI, ApaI, HphI, RsaI DR4 Sac II, AvaII, HinfI, HaeII, HphI, MnlI DQB1 DQ1 FokI, ApaI, HaeII, StaNI, BssHII, HphI DQ2, DQ3, DQ4 FokI, BglI, SacI, AcyI, HpaII DPB1 Bsp1286I, FokI, DdeI, BsaJI, BssHII, Cfr13I, RsaI, EcoNI, AvaII 920 Hataya et al. HLA class II and antiphospholipid syndrome Vol. 70, No. 5, November 1998

3 Genomic DNA extracted from peripheral lymphocytes was amplified by the PCR procedure. The second exon of DRB1 genes for DR2, DR4, DR1, DR7, DR10, DR3, DR5, DR6, and DR8 was amplified using one of six group-specific 5 primers along with the common 3 primer. The second exon of the DRB1 gene for DR9 was amplified using a specific 5 primer and a 3 primer (15). A 241 base pair fragment from the second exon of the HLA-DQB1 gene was amplified by using DQ1 group-specific primers, and a 237 base pair fragment was amplified using DQ2, DQ3, and DQ4 group-specific primers, according to the methods described by Nomura et al. (16). A 299 base pair fragment from the second exon of the HLA- DPB1 gene was amplified with use of PCR primers according to the methods described by Ota et al. (17). After amplification, aliquots of the reaction mixture were digested by allele-specific restriction endonucleases. The samples were subjected to electrophoresis in a minigel apparatus (AE6450; Atto Corporation, Tokyo, Japan). HLA- DRB1 gene, HLA-DQB1 gene, and HLA-DPB1 gene types were determined by comparing the patterns of RFLP obtained in tested individuals with those of amplified DRB1, DQB1, and DPB1 genes, as reported by Ota et al. (15), Nomura et al. (16) and Ota et al. (17), respectively. Institutional review board approval was obtained for this study. Statistical Analysis The relative risk (RR) was calculated with a 95% confidence interval (CI) to analyze whether there was a statistically significant difference between the frequency of a certain HLA in the patient group and that in the control group. RESULTS The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in the patient group than in the control group (RR 4.44, 95% CI ; and RR 8.55, 95% CI , respectively). The frequency of DRB1*04 also was significantly higher in the patient group (RR 2.44, 95% CI ) (Table 3). As for HLA-DQ, the frequency of DQB1*0501 was significantly lower in the patient group (RR 0.21, 95% CI ). The frequencies of other s of HLA-DQ antigens were not significantly different between the groups (Table 4). No statistically significant difference in the frequency of HLA-DP s was observed between the groups (Table 5). DISCUSSION In studying the immunologic background of the patients with recurrent fetal miscarriage who were positive for anticardiolipin antibody, we found that the frequency of certain TABLE 3 Frequency of HLA-DRB1 in patients and DRB1 Percentage of indicated * (no. of loci with indicated ) HLA class II s in the patient group was significantly different from that in the normal fertile female population. It has recently been suggested that autoimmune factors, especially newly defined autoantibodies such as antiphospholipid antibodies, are implicated in such adverse outcomes of pregnancy as spontaneous abortion, fetal death, fetal growth retardation, and preeclampsia. Hughes et al. (1) first described the antiphospholipid syndrome, in which patients had general thrombosis and recurrent fetal miscarriage and showed positivity for antiphospholipid antibodies. Gleicher and colleagues (2 4) postulated a reproductive autoimmune failure syndrome in which autoimmune factors, such as lupus anticoagulant or antiphospholipid antibodies, are implicated in the genesis of unexplained recurrent fetal miscarriage. It has recently been shown that most autoimmune dis- RR 95% CI (1) 6.6 (10) (2) 2.0 (3) (12) 2.6 (4) (1) (10) 8.6 (13) (3) 0.7 (1) (1) (6) 0.7 (1) (2) (1) (2) 5.3 (8) (8) 8.6 (13) (14) 13.2 (20) (1) 0.7 (1) (2) 0.7 (1) (4) 2.6 (4) (1) 2.0 (3) (3) 5.3 (8) (6) 7.9 (12) (6) 2.6 (4) (1) 0.7 (1) (6) (1) (4) 3.9 (6) (1) (8) 5.9 (9) (14) 11.2 (17) (4) (34) 15.1 (23) Note: All values for the RR and 95% CI were not statistically significant, with the exception of those indicated. FERTILITY & STERILITY 921

4 TABLE 4 Frequency of HLA-DQB1 in patients and DQB1 Percentage of indicated * (no. of loci with indicated ) eases have a significant relationship with the HLA antigen system; in particular, HLA class II antigens were found to be related closely to diseases. For example, Badenhoop et al. (19) noted the association of DQA1*0201/*0301 heterozygotes and Hashimoto s disease. They also demonstrated the involvement of the HLA-DQ gene in the genesis of a typical endocrine autoimmune disease, type I diabetes mellitus, and Graves disease using the PCR and sequence-specific oligonucleotide hybridization method (20). RR 95% CI (1) 0.7 (1) (8) 9.9 (15) (16) 10.5 (16) (16) 12.5 (19) (10) 7.9 (12) (8) 2.6 (4) (2) 7.9 (12) (4) 4.6 (7) (7) 4.6 (7) (25) 17.8 (27) (9) 11.2 (17) (6) 9.9 (15) Note: All values for the RR and 95% CI were not statistically significant, with the exception of those indicated. TABLE 5 Frequency of HLA-DPB1 in patients and DPB1 Percentage of indicated * (no. of loci with indicated ) (29) 22.4 (34) (3) 3.3 (5) (9) 2.6 (4) (2) 4.6 (7) (9) 9.2 (14) (39) 38.8 (59) (1) 2.0 (3) (11) 9.9 (15) (2) 0.7 (1) (5) 2.6 (4) (1) 1.3 (2) (2) (1) 1.3 (2) Note: The RR with 95% CI of each HLA-DP was not significant. In this study, we investigated the s of HLA class II antigens HLA-DR, HLA-DQ, and HLA-DP using the PCR-RFLP method in patients with recurrent fetal miscarriage who were positive for anticardiolipin antibody. The frequencies of DRB1*0403 and DRB1*0410 were significantly higher in patients than in the control group. As for HLA-DQ, the frequency of HLA-DQB1*0501 was significantly lower in the patient group. Granados et al. (13) reported that Mexican patients with SLE who were positive for anticardiolipin antibody had significantly increased corrected frequencies of the HLA- DR3, HLA-DR7, and HLA-DQ2 antigens. Sebastiani et al. (14) reported that the antiphospholipid antibody and the lupus anticoagulant occurred in families carrying haplotypes that contain HLA-DR4, HLA-DR7, and HLA-DR53. In this study, the relationship between the HLA-DR3 and HLA-DR7 antigens and patients with the anticardiolipin antibody was not detected because these antigens are rare in the Japanese population. The known higher frequency of HLA-DR4 is reflected in the findings of our study. The finding of a significantly lower frequency of HLA- DQB1*0501 is unique to our study. Although recent investigation has indicated the critical role of specific HLA-DQ polymorphisms in establishing the nature of bound antigens, thereby influencing the potential immune repertoire (21), the mechanisms behind the significantly lower frequency of HLA-DQB1*0501 in patients with this disease have not been understood. The etiologic agent that triggers the generation of the anticardiolipin antibody in susceptible individuals has not been identified. The possibility of direct involvement of the non-hla gene, which is linked strongly to the class II region, cannot be excluded in the generation of the anticardiolipin antibody in these patients. Recent genetic analysis by van Endert et al. (22) demonstrated that the genes in the class II region are involved in the processing of antigenic proteins for presentation by major histocompatibility complex class I molecules. The analysis indicated a strong linkage disequilibrium between TAP (the transporter associated with antigen processing) genes and LMP (the low-molecular-mass polypeptide) genes and class II regions. Their allelic polymorphism should be studied in patients positive for anticardiolipin antibody to determine the primary locus within the class II region that is responsible for genetic susceptibility to disease. There is also the possibility that patients become positive for anticardiolipin antibodies because of amino acid residues in DRB1 molecules. It is also possible that a specially processed epitope on a foreign or self-triggered antigen may have a specific, unusual affinity for the DRB1 molecule with DR4 specificities, leading to the generation of the anticardiolipin antibody in these patients. Examination of amino acid residues from the DRB1 al- 922 Hataya et al. HLA class II and antiphospholipid syndrome Vol. 70, No. 5, November 1998

5 leles has shown that histidine at position 13 is specific to DR4, the frequency of which was increased in our patients. The first hypervariable region (amino acid residues at positions 9 to 13) is located on the beta-strands of the sheet at the bottom of the antigen binding groove described by Brown et al. (23, 24); amino acids residing at positions 9, 11, and 13 display a high degree of polymorphism. Therefore, it seems likely that histidine at position 13 contributed to the predisposition toward production of the anticardiolipin antibody in our patients. References 1. Hughes GRV, Harris EN, Gharavi AE. The anticardiolipin syndrome. J Rheumatol 1986;13: Gleicher N, El-Roeiy A. The reproductive autoimmune failure syndrome. Am J Obstet Gynecol 1988;159: Gleicher N. Antiphospholipid antibodies and reproductive failure: what they do and what they do not do; how to, and how not to treat. Hum Reprod 1997;1: Gleicher N, Harlow L, Zilberstein M. Regulatory effect of antiphospholipid antibodies on signal transduction: a possible model for autoantibody-induced reproductive failure. Am J Obstet Gynecol 1992;167: Lubbe WF, Butler WS, Palmer SJ, Liggins GC. Fetal survival after prednisone suppression of maternal lupus-anticoagulant. Lancet 1983; 1: Branch DW, Scott JR, Kochenour NK, Hershgold E. Obstetric complications associated with the lupus anticoagulant. N Engl J Med 1985; 313: Hasegawa I, Takakuwa K, Goto S, Yamada K, Kanazawa K, Tanaka K, et al. Effectiveness of prednisolone/aspirin therapy for recurrent aborters with antiphospholipid antibodies. Hum Reprod 1992;7: Takakuwa K, Asano K, Arakawa M, Yasuda M, Hasegawa I, Tanaka K. Chromosome analysis of aborted conceptuses of recurrent aborters positive for anticardiolipin antibody. Fertil Steril 1997;68: Yasuda M, Takakuwa K, Tokunaga A, Tanaka K. Prospective studies of the association between anticardiolipin antibody and outcome of pregnancy. Obstet Gynecol 1995;86: Yasuda M, Takakuwa K, Higashino M, Ishii S, Kazama Y, Tanaka K, et al. A typical case of reproductive autoimmune failure syndrome in which a patient experienced recurrent abortion, preeclampsia, and intrauterine growth retardation. Am J Reprod Immunol 1993;29: Takakuwa K, Yasuda M, Hataya I, Tamura M, Arakawa M, Tanaka K, et al. Treatment for patients with recurrent abortion with positive antiphospholipid antibodies using a traditional Chinese herbal medicine. J Perinat Med 1996;24: Thomson G. Human HLA genetics and disease associations. In: Weir DM, ed. Handbook of experimental immunology. Vol. 3. Genetics and molecular immunology. Oxford: Blackwell Scientific, 1986: Granados J, Vargas-Alarcon G, Drenkard C, Andrade F, Melin-Aldana H, Alcocer-Varela J, et al. Relationship between anticardiolipin antibodies and antiphospholipid syndrome to HLA-DR7 in Mexican patients with systemic lupus erythematosus (SLE). Lupus 1997;6: Sebastiani GD, Galeazzi M, Morozzi G, Marcolongo R. The immunogenetics of the antiphospholipid syndrome, anticardiolipin antibodies, and lupus anticoagulant. Semin Arthritis Rheum 1996;25: Ota M, Seki T, Fukushima H, Tsuji K, Inoko H. HLA-DRB1 genotyping by modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1992;39: Nomura N, Ota M, Tsuji K, Inoko H. HLA-DQB1 genotyping by a modified PCR-RFLP method combined with group-specific primers. Tissue Antigens 1991;38: Ota M, Seki T, Nomura N, Sugimura K, Mizuki N, Fukushima H, et al. Modified PCR-RFLP method for HLA-DPB1 and -DQA1 genotyping. Tissue Antigens 1991;38: Loizou S, MacCrea JD, Rudge AC. Measurement of anticardiolipin antibodies by an enzyme-linked immunosorbent assay (ELISA). Clin Exp Immunol 1985;62: Badenhoop K, Schwarz G, Walfish PG, Drummond V, Usadel KH, Bottazzo GF. Susceptibility to thyroid autoimmune disease: molecular analysis of HLA-D region genes identifies new markers for goitrous Hashimoto s thyroiditis. J Clin Endocrinol Metab 1990;71: Badenhoop K, Walfish PG, Rau H, Fischer S, Nicolay A, Bogner U, et al. Susceptibility and resistance alleles of human leukocyte antigen (HLA) DQA1 and HLA DQB1 are shared in endocrine autoimmune disease. J Clin Endocrinol Metab 1995;80: Kwok WW, Nepom GT, Raymond FC. HLA-DQ polymorphisms are highly selective for peptide binding interactions. J Immunol 1995;155: van Endert PM, Lopez MT, Patel SD, Monaco JJ, McDevitt HO. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes. Proc Natl Acad Sci USA 1992;89: Brown JH, Jardetzky TS, Saper MA, Samraoui B, Bjorkman PJ, Wiley CD. A hypothetical model of the foreign antigen binding site of class II histocompatibility molecules. Nature 1988;332: Brown JH, Jardetzky TS, Gorga JC, Stern LJ, Urban RG, Strominger JL, et al. Three dimensional structure of the human class II histocompatibility antigen HLA-DR1. Nature 1993;364:33 9. FERTILITY & STERILITY 923