Comparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress

Size: px
Start display at page:

Download "Comparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress"

Transcription

1 omparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress S DAL, S Sigrist, W Bietiger, Peronet, M Pinget and N Jeandidier 2 october 2012

2 ontinuous intraperitoneal insulin infusion (PII) therapy Brittle type 1 diabetes mellitus therapy More physiological, absorbed via the portal vein First hepatic insulin metabolism (Selam JL et al., Diabetes are, 1992) (Giacca A et al., J lin Endo Metab, 1993) Safety, effectiveness, reduction of blood glucose variability (Broussole et al., Lancet,1994; Pinger M and Jeandider N, Horm Metab Res, 1998; Jeandider N et al., Diabetes are, 1996) Mechanisms involved have not been precisely investigated? Role of oxidative stress?

3 Oxidative stress in diabetes Oxidative stress is enhanced in diabetic patients (Maxwell SR et al., Eur J lin Invest, 1997; Rocic B et al., Exp lin Endocrinol Diabetes, 1997) Leading to cellular injury and chronic complications (Brownlee M. Nature, 2001; Baynes JW, Diabetes, 1991; Giacco F and Brownlee M, ir Res 2010) Hyperglycemia and acute glucose fluctuations can promote oxidative stress (You Z et al., J ell Biol, 2002; hong ZZ and Maiese K, Histol Histopathol, 2004) Impact on liver?

4 Objectives of this study reate an animal model of PII onfirm the metabolic results observed in clinical trials Understand their mechanisms Highlight the role of oxidative stress ompare PII to ontinious Subcutaneous Insulin Infusion (SII) Determined the modification in signaling pathways in the liver Explain the benefit of PII

5 Experimental model Rats male Wistar ontrol rats () 24h 1 week Sacrifices 4 weeks Streptozotocine 100mg/kg Diabetic rats () Glycemia > 2,5 g/l () () Insuplant (2UI/200g/d) Diabetic rats () Intraperitoneal osmotic pump (PII) Subcutaneous osmotic pump (SII)

6 Experimental model (2) week Sacrifices 4 weeks Metabolic parameters: Weight gain Glycemia and fructosamine W eig h t (g ) P II S II S TZ Times after Stz (days) () () Liver metabolism: Hepatic glycogen IGF-1 IGF -1 (µm ) # 0 Oxidative parameters : Plasmatic oxidative stress Liver oxidative stress Expression of anti-oxidative enzyme Activation of redox sensitive pathway PII SII PII SII Inflammatory parameters : Liver macrophages Plasmatic inflammation (α2-macroglobulin)

7 PII, portal absorption and model validation Western blot Hepatic IRS activation Hepatic GH receptor expression GH R IRS P Insulin Insulin p -IR S 1/IR S 1 (r elative b an d in ten sity) $ G H R /G A P D H (r elative b an d in ten sity) # $ PII SII PII SII PII? SII? PII is a model of portal absorption of insulin p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001

8 PII and blood glucose control Metabolic parameters: Weight gain Glycemia and fructosamine Weight gain Fructosamine 400 W eig h t (g ) P II S II S TZ F r u cto sam in e (µ m o l/l ) # # 100 $ $$ T im es after S tz (d ays) 0 PII SII PII SII PII improves weight gain and blood glucose p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001

9 PII and liver metabolism Liver metabolism: Hepatic glycogen IGF-1 Glycogen quantification ELISA Plasmatic IGF-1 H ep ath ic g lyco g en (m g /m g liver ) IG F -1 (µ M ) # PII SII PII SII PII SII PII SII PII allows the restoration of liver glycogen storage and provides IGF-1 synthesis comparable to the control p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001

10 PII and plasma oxidative stress Oxidative parameters: Plasmatic oxidative stress ABTS Plasmatic antioxidant capacity TBARS Lipids peroxidation T o tal an tio xid an t cap acity (m M T E A ) PII SII PII SII L ip id s p er o xid atio n (m g /m L M D A ) # # PII SII PII $$ SII PII limits plasmatic oxidative stress induced by diabetes p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII ; p<0.05 ; p<0.01 ; p<0.001

11 PII and hepatic oxidative stress Oxidative parameters: Liver oxidative stress DHE Staining PII SII 100µm 100µm 100µm 100µm 100µm 100µm 100µm 100µm PII protects the liver from diabetes induced-oxidative stress p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001

12 PII and liver inflammation Inflammatory parameters: Liver macrophages Plasmatic inflammation (α2-macroglobulin) Hepatic macrophages infiltration IH macrophages PII SII 100µm 100µm 100µm 100µm 100µm 100µm 100µm 100µm He pa tic m a c ropha ge s (pix e ls ) # PII $ SII # PII $$ SII PII protects the liver from diabetes-induced inflammation p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001

13 Mechanisms of PII hepatic oxidative stress protection Oxidative parameters: Expression of anti-oxidative enzymes Activation of redox sensitive pathway Hepatic anti-oxidante enzyme : catalase Western blot atalase/g A P D H (r elative b an d in ten sity) # PII $ SII p 38 M A P K /G A P D H (r elative b an d in ten sity Hepatic oxidant sensitive kinase p38 MAP kinase # PII # SII PII protects the liver from diabetes-induced oxidative stress by an upregulation of catalase and the prevention of p38 pathway activation p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001

14 onclusions of this study We created an animal model of PII : using osmotic pump with non-toxicity of intraperitoneal insulin no signs of phenol toxicity in the peritoneum and no focal steatosis onfirmed the metabolic results observed in clinical trials a major portal absorption (GHR,p-IRS1) a better glucose control normalization of body weight gain Understood, in part, their mechanisms improvement of liver proteins synthesis (IGF-1) improved glycemic fluctuations could be explained by an increased in glycogen hepatic content

15 onclusions of this study (2) Highlighted the role of oxidative stress which is generalized (plasmatic, tissu) in diabetic rats specific beneficial effect of PII on the liver ROS level upregulation of antioxidant enzyme and status downregulation of pro-oxidant pathway Highlighted liver consequences PII protected against diabetes-induced apoptosis and aginst liver macrophages infiltration Importance of focusing on the first hepatic bypass of insulin Limitation/prevention of diabetic complications

16 THANKS Donaubauer Hans Heinrich from Sanofi-Aventis, Germany Dali-Youcef Ahmed Nassim from IGBM-UMR7014-U964, France

Diabetes and oxidative stress: impact of natural antioxydants consumption

Diabetes and oxidative stress: impact of natural antioxydants consumption Diabetes and oxidative stress: impact of natural antioxydants consumption Dal-Ros S., Van Der Werf R., Walter C., Bietiger W., Seyfritz E., Mura C., Peronet C., Legrandois J., Werner D., Ennahar S., Digel

More information

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice

Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland

More information

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and

Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic

More information

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells

Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gérald J. Prud homme, MD, FRCPC Keenan Research Centre for Biomedical

More information

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath

Inflammation & Type 2 Diabetes Prof. Marc Y. Donath Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic

More information

Dr. Hany M. Abo-Haded

Dr. Hany M. Abo-Haded BY Dr. Hany M. Abo-Haded Pediatric Cardiology Unit, Mansoura Universty Children Hospital, Mansoura, Egypt Co-authors: Dina S El-Agamy and Mohamed A Elkablawy Background Doxorubicin (DOX) is an anthracycline

More information

Kefir intake as adjuvant onto glycemic control in diabetic rats. Cristina Stewart Bogsan Pharmaceutical-Biochemical Technology Department

Kefir intake as adjuvant onto glycemic control in diabetic rats. Cristina Stewart Bogsan Pharmaceutical-Biochemical Technology Department Kefir intake as adjuvant onto glycemic control in diabetic rats Cristina Stewart Bogsan Pharmaceutical-Biochemical Technology Department Outline Type I Diabettes Mellitus Kefir; Aim; Protocol; Oxidative

More information

Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in treatment Professor Grace George

Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in treatment Professor Grace George Division of Medical Biochemistry, Department of Human Biology, Faculty of Health Sciences, Mthatha, South Africa Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in

More information

METABOLIC SYNDROME AND HCV: FROM HCV

METABOLIC SYNDROME AND HCV: FROM HCV METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,

More information

Annals of RSCB Vol. XVI, Issue 1

Annals of RSCB Vol. XVI, Issue 1 THE STUDY OF PROTHROBOTIC STATE IN PATIENTS WITH TYPE 2 DIABETES MELLITUS AND CARDIOVASCULAR DISEASES Oana Bădulescu 1, Codruţa Bădescu 2, Manuela Ciocoiu 1, Magda Bădescu 1 1 DEPARTMENT OF PATHOPHYSIOLOGY;

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Diabetes Mellitus Type 2 Evidence-Based Drivers

Diabetes Mellitus Type 2 Evidence-Based Drivers This module is supported by an unrestricted educational grant by Aventis Pharmaceuticals Education Center. Copyright 2003 1 Diabetes Mellitus Type 2 Evidence-Based Drivers Driver One: Reducing blood glucose

More information

Insulin Pump Therapy for Type 2

Insulin Pump Therapy for Type 2 9501172-011 Insulin Pump Therapy for Type 2 Objective To show the effectiveness of CSII for insulin-taking type 2 patients Key Points Tight glycemic control decreases risk of diabetes-related complications

More information

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA

More information

Metabolic Syndrome. DOPE amines COGS 163

Metabolic Syndrome. DOPE amines COGS 163 Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance

More information

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia

More information

Effect of BI-1 on insulin resistance through regulation of CYP2E1

Effect of BI-1 on insulin resistance through regulation of CYP2E1 Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Lecture 19 Summary Gestational Diabetes and Complications of Diabetes. Gestational diabetes;

Lecture 19 Summary Gestational Diabetes and Complications of Diabetes. Gestational diabetes; Lecture 19 Summary Gestational Diabetes and Complications of Diabetes Gestational diabetes; - Type of diabetes that only develops during pregnancy Usually diagnosed in late pregnancy Causes high blood

More information

BIOM2010 (till mid sem) Endocrinology. e.g. anterior pituitary gland, thyroid, adrenal. Pineal Heart GI Female

BIOM2010 (till mid sem) Endocrinology. e.g. anterior pituitary gland, thyroid, adrenal. Pineal Heart GI Female BIOM2010 (till mid sem) Endocrinology Endocrine system Endocrine gland : a that acts by directly into the which then to other parts of the body to act on (cells, tissues, organs) : found at e.g. anterior

More information

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )

More information

Lipid (Oil Red O) staining Kit

Lipid (Oil Red O) staining Kit Lipid (Oil Red O) staining Kit Catalog Number KA4541 1 Kit Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY

AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY SA Oliveira Jr, MP Okoshi, PF Martinez, DM Guizoni, BP Torres, M Dal Pai-Silva, K Okoshi,

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Iso-Insulin ELISA ( ), Brochure

Iso-Insulin ELISA ( ), Brochure Iso-Insulin ELISA (10-1128-01), Brochure Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53

More information

PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes

PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux

More information

Alpha-Lipoic Acid: A Versatile Antioxidant VRM

Alpha-Lipoic Acid: A Versatile Antioxidant VRM Alpha-Lipoic Acid: A Versatile Antioxidant VRM By Yousry Naguib, PhD Alpha-lipoic acid (also known as thioctic acid) is produced in the body, and found in food sources such as liver, brewer's yeast, and

More information

Pharmaceutics I صيدالنيات 1. Unit 2 Route of Drug Administration

Pharmaceutics I صيدالنيات 1. Unit 2 Route of Drug Administration Pharmaceutics I صيدالنيات 1 Unit 2 Route of Drug Administration 1 Routs of Drug administration The possible routes of drug entry into the body may be divided into two classes: Parenteral Rout Enteral Rout

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

ESPEN Congress Madrid 2018

ESPEN Congress Madrid 2018 ESPEN Congress Madrid 2018 Dysglycaemia In Acute Patients With Nutritional Therapy Mechanisms And Consequences Of Dysglycaemia In Patients Receiving Nutritional Therapy M. León- Sanz (ES) Mechanisms and

More information

Mouse Models for Studying Human Islet Transplantation

Mouse Models for Studying Human Islet Transplantation Mouse Models for Studying Human Islet Transplantation Ronald G. Gill, Joshua Beilke,, Nathan Kuhl,, Michelle Kerklo, and Mark M. Nicolls Barbara Davis Center for Childhood Diabetes University of Colorado

More information

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC

Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative

More information

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao

More information

Continuous intraperitoneal insulin infusion in the treatment of type 1 diabetes mellitus van Dijk, P.R.

Continuous intraperitoneal insulin infusion in the treatment of type 1 diabetes mellitus van Dijk, P.R. University of Groningen Continuous intraperitoneal insulin infusion in the treatment of type 1 diabetes mellitus van Dijk, P.R. IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's

More information

298 Biomed Environ Sci, 2015; 28(4):

298 Biomed Environ Sci, 2015; 28(4): 298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK

More information

Paneth Cells. Road Map to the Finish. No Review this Friday. Today 11/29 Finish digestion/accessory organs. Wednesday 12/1 Immune System I

Paneth Cells. Road Map to the Finish. No Review this Friday. Today 11/29 Finish digestion/accessory organs. Wednesday 12/1 Immune System I Road Map to the Finish No Review this Friday Today 11/29 Finish digestion/accessory organs Wednesday 12/1 Immune System I Paneth Cells - base of intestinal glands -! large -! intense acidophilic granules

More information

Effects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy

Effects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy Effects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy J. Guan 1,2, L. Long 1, Y.-Q. Chen 1, Y. Yin 1, L. Li 1, C.-X. Zhang 1, L. Deng 1 and L.-H. Tian

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Defects in glucose utilization & GLP-1

Defects in glucose utilization & GLP-1 Defects in glucose utilization & GLP-1 Song, Dae-Kyu Department of Physiology & Chronic Disease Research Center Keimyung University School of Medicine 2800 dalgubeol-daero, Dalseo-gu, Daegu, 704-701, Korea

More information

Journal Club WS 2012/13 Stefanie Nickl

Journal Club WS 2012/13 Stefanie Nickl Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,

More information

Pharmacologyonline 1: (2010)

Pharmacologyonline 1: (2010) THERAPEUTIC ROLE OF ANTI-OXIDANT PROPERTIES OF EMBLICA OFFICINALIS (AMLA) IN STREPTOZOTOCIN INDUCED TYPE I DIABETIC RATS P. R. Tirgar* 1, P. D. Jadav 2, D. B. Sheth 3, T. R. Desai 4 Authors addresses Pravin

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Beneficial effects of cherry consumption as a dietary intervention for metabolic, hepatic and vascular complications in type 2 diabetic rats

Beneficial effects of cherry consumption as a dietary intervention for metabolic, hepatic and vascular complications in type 2 diabetic rats https://doi.org/10.1186/s12933-018-0744-6 Cardiovascular Diabetology ORIGINAL INVESTIGATION Open Access Beneficial effects of cherry consumption as a dietary intervention for metabolic, hepatic and vascular

More information

Pathogenesis of Type 1 Diabetes. Diabetes Mellitus Type 1. Pathogenesis. Pathogenesis of DM1. Type 2. Type 1. Genetics of Type 1 Diabetes

Pathogenesis of Type 1 Diabetes. Diabetes Mellitus Type 1. Pathogenesis. Pathogenesis of DM1. Type 2. Type 1. Genetics of Type 1 Diabetes Pathogenesis of Type 1 Diabetes Diabetes Mellitus Type 1 D G V A N ZYL Genetics of Type 1 Diabetes Pathogenesis Complex and poorly understood interplay between genetics and environmental factors Monozycotic

More information

Studies on the breakdown of glycogen in the lysosomes: The effects of hydrocortisone

Studies on the breakdown of glycogen in the lysosomes: The effects of hydrocortisone Histol Histopathol (2000) 15: 29-35 http://www.ehu.es/histol-histopathol Histology and Histopathology Cellular and Molecular Biology Studies on the breakdown of glycogen in the lysosomes: The effects of

More information

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119 Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Co-stimulation with IGF-1 and TLR ligands induces a pro-inflammatory response in PBMCs via activation of the MAPK pathway

Co-stimulation with IGF-1 and TLR ligands induces a pro-inflammatory response in PBMCs via activation of the MAPK pathway Co-stimulation with IGF-1 and TLR ligands induces a pro-inflammatory response in PBMCs via activation of the MAPK pathway Thalijn LC Wolters, MD 1 ; Mihai G Netea, Prof MD 2 ; Ad RMM Hermus, Prof MD 1

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

DEVELOPMENT OF NEW ANIMAL MODELS FOR TYPE 2 DIABETES MELLITUS AND PHARMACOLOGICAL SCREENING

DEVELOPMENT OF NEW ANIMAL MODELS FOR TYPE 2 DIABETES MELLITUS AND PHARMACOLOGICAL SCREENING 2) LITERATURE REVIEW 1. Srinivasan et al., (2005) developed a new rat model that replicates the natural history and metabolic characteristics of human type 2 diabetes and is also suitable for pharmacological

More information

Title: Assessment of the post-exercise glycemic response to food: considering prior

Title: Assessment of the post-exercise glycemic response to food: considering prior Title: Assessment of the post-exercise glycemic response to food: considering prior nutritional status. Authors: Javier T. Gonzalez BSc. MRes., and Emma J. Stevenson BSc. Phd. Brain, Performance and Nutrition

More information

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents

Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko

More information

Olympic diabetes What have we learned over the last decade? Ian Gallen Jephcott Symposium 9 th May 2012

Olympic diabetes What have we learned over the last decade? Ian Gallen Jephcott Symposium 9 th May 2012 Olympic diabetes What have we learned over the last decade? Ian Gallen Jephcott Symposium 9 th May 2012 Diabetes and exercise Ian Gallen Challenges in the management SR s diabetes prior to 2000 Olympic

More information

Journal Club: The Use of Fish Oil Lipid Emulsion for Gastrointestinal Surgery Patients

Journal Club: The Use of Fish Oil Lipid Emulsion for Gastrointestinal Surgery Patients S a m m i M o n t a g F i s h O i l E m u l s i o n J o u r n a l C l u b - P a g e 1 Journal Club: The Use of Fish Oil Lipid Emulsion for Gastrointestinal Surgery Patients Introduction/Background I. Surgical

More information

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies

Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin

More information

Pancreas Fox Chapter 18 part 2 (also Chapter 19.3 & 19.4)

Pancreas Fox Chapter 18 part 2 (also Chapter 19.3 & 19.4) Vert Phys PCB3743 Pancreas Fox Chapter 18 part 2 (also Chapter 19.3 & 19.4) T. Houpt, Ph.D. Anatomy of Digestive System Peristalsis Stomach and Acid Secretion Liver and Bile Secretion Pancreas and pancreatic

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTRY INFORMTION doi:10.1038/nature11808 NT Phen Met ICR Oligo FCCP pmpk tmpk Supplemental figure 1. -. Primary hepatocytes were treated with 250 um Phenformin, 1 mm Metformin 250 um ICR, 100 nm

More information

8. OXIDATIVE STRESS IN DIABETICS

8. OXIDATIVE STRESS IN DIABETICS 8. OXIDATIVE STRESS IN DIABETICS Prof. Victor Blaton, Ph.D. Department of Clinical Chemistry, Hospital AZ Sint-Jan AV, Brugge, Belgium 1.1. Introduction Diabetes mellitus is a major source of morbidity

More information

Appetite, Glycemia and Entero-Insular Hormone Responses Differ Between Oral, Gastric-Remnant and Duodenal Administration of a Mixed Meal Test After

Appetite, Glycemia and Entero-Insular Hormone Responses Differ Between Oral, Gastric-Remnant and Duodenal Administration of a Mixed Meal Test After Appetite, Glycemia and Entero-Insular Hormone Responses Differ Between Oral, Gastric-Remnant and Duodenal Administration of a Mixed Meal Test After Roux-en-Y Gastric Bypass June 2018 How a surgical complication

More information

Discussion & Conclusion

Discussion & Conclusion Discussion & Conclusion 7. Discussion DPP-4 inhibitors augment the effects of incretin hormones by prolonging their half-life and represent a new therapeutic approach for the treatment of type 2 diabetes

More information

Metabolomics in nutrition research: biomarkers predicting mortality in children with severe acute malnutrition

Metabolomics in nutrition research: biomarkers predicting mortality in children with severe acute malnutrition Metabolomics in nutrition research: biomarkers predicting mortality in children with severe acute malnutrition Michael Freemark Department of Pediatrics, Duke University Medical Center, the Duke Molecular

More information

The Growth Hormone/Insulin-Like Growth Factor-1 Axis in Health and Disease Prof. Derek LeRoith

The Growth Hormone/Insulin-Like Growth Factor-1 Axis in Health and Disease Prof. Derek LeRoith The Growth Hormone/Insulin-Like Growth Factor-1 Axis in Health and Disease Derek LeRoith MD PhD Division of Endocrinology, Diabetes and Bone Diseases Mt Sinai School of Medicine, NY 1 GH/IGF-1 axis Agenda:

More information

Metabolic Issues in Transgender Women Living With HIV. Jordan E. Lake, MD, MSc 2 November 2018

Metabolic Issues in Transgender Women Living With HIV. Jordan E. Lake, MD, MSc 2 November 2018 Metabolic Issues in Transgender Women Living With HIV Jordan E. Lake, MD, MSc 2 November 2018 Disclosures -No relevant financial disclosures Learning Objectives Understand metabolic issues relevant to

More information

Diabetes mellitus. Treatment

Diabetes mellitus. Treatment Diabetes mellitus Treatment Recommended glycemic targets for the clinical management of diabetes(ada) Fasting glycemia: 80-110 mg/dl Postprandial : 100-145 mg/dl HbA1c: < 6,5 % Total cholesterol: < 200

More information

Data from an epidemiologic analysis of

Data from an epidemiologic analysis of CLINICAL TRIAL RESULTS OF GLP-1 RELATED AGENTS: THE EARLY EVIDENCE Lawrence Blonde, MD, FACP, FACE ABSTRACT Although it is well known that lowering A 1c (also known as glycated hemoglobin) is associated

More information

Chapter 37: Exercise Prescription in Patients with Diabetes

Chapter 37: Exercise Prescription in Patients with Diabetes Chapter 37: Exercise Prescription in Patients with Diabetes American College of Sports Medicine. (2010). ACSM's resource manual for guidelines for exercise testing and prescription (6th ed.). New York:

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

Hyperglycemia: Type I Diabetes Mellitus

Hyperglycemia: Type I Diabetes Mellitus 296 PHYSIOLOGY CASES AND PROBLEMS Case 53 Hyperglycemia: Type I Diabetes Mellitus David Mandel was diagnosed with type I (insulin-dependent) diabetes mellitus when he was 12 years old (see Cases 30 and

More information

NASH Bench to Bedside

NASH Bench to Bedside NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent

More information

METABOLISMO E VITAMINA D

METABOLISMO E VITAMINA D CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster

More information

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China

More information

ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary

ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU PhD THESIS Summary INVOLVEMENT OF ALARMIN HMGB1 IN INFLAMMATORY PROCESSES ASSOCIATED WITH VASCULAR DYSFUNCTION IN HYPERLIPIDEMIA

More information

Improving Access to Quality Medical Care Webinar Series

Improving Access to Quality Medical Care Webinar Series Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX

More information

Diabetes and Inflammasomes in the Bladder

Diabetes and Inflammasomes in the Bladder Diabetes and Inflammasomes in the Bladder J Todd Purves MD, PhD Duke University Medical Center Division of Urology Disclosures: None Introduction Diabetic Bladder Dysfunction (DBD) is the most common

More information

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,

More information

Journal of Chemical and Pharmaceutical Research, 2014, 6(5): Research Article

Journal of Chemical and Pharmaceutical Research, 2014, 6(5): Research Article Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2014, 6(5):173-179 Research Article ISS : 0975-7384 CDE(USA) : JCPRC5 In vitro and in vivo evaluation of antioxidant activity

More information

Increased oxidative stress according to number of risk factors in metabolic syndrome patients

Increased oxidative stress according to number of risk factors in metabolic syndrome patients University of Londrina, Paraná, Brazil Increased oxidative stress according to number of risk factors in metabolic syndrome patients Danielle Venturini, PhD 2016 Venturini, Danielle 1*, Alves, Caroline

More information

The potential role of sitagliptin as an oral treatment regimen for type I diabetes mellitus

The potential role of sitagliptin as an oral treatment regimen for type I diabetes mellitus World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original

More information

28 Regulation of Fasting and Post-

28 Regulation of Fasting and Post- 28 Regulation of Fasting and Post- Prandial Glucose Metabolism Keywords: Type 2 Diabetes, endogenous glucose production, splanchnic glucose uptake, gluconeo-genesis, glycogenolysis, glucose effectiveness.

More information

The Realities of Technology in Type 1 Diabetes

The Realities of Technology in Type 1 Diabetes The Realities of Technology in Type 1 Diabetes May 6, 2017 Rosanna Fiallo-scharer, MD Margaret Frederick, RN Disclosures I have no conflicts of interest to disclose I will discuss some unapproved treatments

More information

Relationship between Energy Expenditure Related Factors and Oxidative Stress in Follicular Fluid

Relationship between Energy Expenditure Related Factors and Oxidative Stress in Follicular Fluid Original Article Relationship between Energy Expenditure Related Factors and Oxidative Stress in Follicular Fluid Abstract This study evaluated the impact of body mass index (BMI), total calorie intake

More information

Obesity Management in Patients with Diabetes Jamy D. Ard, MD Sunday, February 11, :15 a.m. 11:00 a.m.

Obesity Management in Patients with Diabetes Jamy D. Ard, MD Sunday, February 11, :15 a.m. 11:00 a.m. Obesity Management in Patients with Diabetes Jamy D. Ard, MD Sunday, February 11, 2018 10:15 a.m. 11:00 a.m. Type 2 diabetes mellitus (T2DM) is closely associated with obesity, primarily through the link

More information

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD

Week 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD Week 3, Lecture 5a Pathophysiology of Diabetes Simin Liu, MD, ScD General Model of Peptide Hormone Action Hormone Plasma Membrane Activated Nucleus Cellular Trafficking Enzymes Inhibited Receptor Effector

More information

Targeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study

Targeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study Targeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study Professor Gary Ford Chief Executive Officer, Oxford Academic Health Science Network Consultant Stroke Physician, Oxford

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Progestin-only methods Type or dose of progestagen

Progestin-only methods Type or dose of progestagen Progestin-only contraception and beneficial effects on migraine Conflicts of interest A d v ise r a n d le ctu re r fo r E X E LT IS Le ctu re s a n d A d v iso ry b o a rd s B aye r Le ctu re s a n d

More information

Intraperitoneal (IP) insulin absorption

Intraperitoneal (IP) insulin absorption Emerging Treatments and Technologies O R I G I N A L A R T I C L E Comparison of Antigenicity of Hoechst 21PH Insulin Using Either Implantable Intraperitoneal Pump or Subcutaneous External Pump Infusion

More information

Pathogenesis of Diabetes Mellitus

Pathogenesis of Diabetes Mellitus Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia

More information

perk/erk STAT5B

perk/erk STAT5B pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,

More information

Anti-Diabetic Blueberries. Dixon Springs Summer Internship Program Anita Lucius

Anti-Diabetic Blueberries. Dixon Springs Summer Internship Program Anita Lucius Anti-Diabetic Blueberries Dixon Springs Summer Internship Program Anita Lucius Background Diabetes 6 th leading cause of death in US Affects over 18 million people Complications Renal disease Ophthalmic

More information

Hypoglycemia a barrier to normoglycemia Are long acting analogues and pumps the answer to the barrier??

Hypoglycemia a barrier to normoglycemia Are long acting analogues and pumps the answer to the barrier?? Hypoglycemia a barrier to normoglycemia Are long acting analogues and pumps the answer to the barrier?? Moshe Phillip Institute of Endocrinology and Diabetes National Center of Childhood Diabetes Schneider

More information

Role of incretins in the treatment of type 2 diabetes

Role of incretins in the treatment of type 2 diabetes Role of incretins in the treatment of type 2 diabetes Jens Juul Holst Department of Medical Physiology Panum Institute University of Copenhagen Denmark Diabetes & Obesity Spanish Society of Internal Medicine

More information

Metabolic diseases of the liver

Metabolic diseases of the liver Metabolic diseases of the liver Central role in metabolism Causes and mechanisms of dysfunction Clinical patterns of metabolic disease Clinical approach to problem-solving Specific disorders Liver s central

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

Involvement of n-3 PUFA-derived lipid mediators in the resolution of brain inflammation

Involvement of n-3 PUFA-derived lipid mediators in the resolution of brain inflammation The 1 th Nutrition-Neuroscience meeting The 27 th of march 217 Involvement of n-3 PUFA-derived lipid mediators in the resolution of brain inflammation Charlotte Rey- PhD student Acute inflammatory response

More information

INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE

INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE EVALUATION OF CARDIO PROTECTIVE EFFECT OF LINAGLIPTIN A NOVEL DPP-4 INHIBITOR IN NORMAL AND STREPTOZOTOCIN INDUCED TYPE-2 DIABETIC RATS

More information

Open-label study to assess the safety and pharmacodynamics of five oral insulin formulations in healthy subjects

Open-label study to assess the safety and pharmacodynamics of five oral insulin formulations in healthy subjects Diabetes, Obesity and Metabolism 12: 219 223, 2010. 2010 Blackwell Publishing Ltd Open-label study to assess the safety and pharmacodynamics of five oral insulin formulations in healthy subjects R. Eldor

More information

International Journal of Allied Medical Sciences and Clinical Research (IJAMSCR)

International Journal of Allied Medical Sciences and Clinical Research (IJAMSCR) International Journal of Allied Medical Sciences and Clinical Research (IJAMSCR) IJAMSCR Volume 4 Issue 3 July - Sep - 2016 www.ijamscr.com ISSN:2347-6567 Research article Medical research Astashine capsules:

More information

Non alcoholic fatty liver and Non alcoholic Steatohepatitis. By Dr. Seham Seif

Non alcoholic fatty liver and Non alcoholic Steatohepatitis. By Dr. Seham Seif Non alcoholic fatty liver and Non alcoholic Steatohepatitis By Dr. Seham Seif Definition NAFL describe a common clinicopathological conditions characterized by significant lipid deposition in the hepatocytes

More information