Comparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress
|
|
- Duane Fields
- 5 years ago
- Views:
Transcription
1 omparison between intraperitoneal and subcutaneous insulin infusion: link between routes of administration and hepatic oxidative stress S DAL, S Sigrist, W Bietiger, Peronet, M Pinget and N Jeandidier 2 october 2012
2 ontinuous intraperitoneal insulin infusion (PII) therapy Brittle type 1 diabetes mellitus therapy More physiological, absorbed via the portal vein First hepatic insulin metabolism (Selam JL et al., Diabetes are, 1992) (Giacca A et al., J lin Endo Metab, 1993) Safety, effectiveness, reduction of blood glucose variability (Broussole et al., Lancet,1994; Pinger M and Jeandider N, Horm Metab Res, 1998; Jeandider N et al., Diabetes are, 1996) Mechanisms involved have not been precisely investigated? Role of oxidative stress?
3 Oxidative stress in diabetes Oxidative stress is enhanced in diabetic patients (Maxwell SR et al., Eur J lin Invest, 1997; Rocic B et al., Exp lin Endocrinol Diabetes, 1997) Leading to cellular injury and chronic complications (Brownlee M. Nature, 2001; Baynes JW, Diabetes, 1991; Giacco F and Brownlee M, ir Res 2010) Hyperglycemia and acute glucose fluctuations can promote oxidative stress (You Z et al., J ell Biol, 2002; hong ZZ and Maiese K, Histol Histopathol, 2004) Impact on liver?
4 Objectives of this study reate an animal model of PII onfirm the metabolic results observed in clinical trials Understand their mechanisms Highlight the role of oxidative stress ompare PII to ontinious Subcutaneous Insulin Infusion (SII) Determined the modification in signaling pathways in the liver Explain the benefit of PII
5 Experimental model Rats male Wistar ontrol rats () 24h 1 week Sacrifices 4 weeks Streptozotocine 100mg/kg Diabetic rats () Glycemia > 2,5 g/l () () Insuplant (2UI/200g/d) Diabetic rats () Intraperitoneal osmotic pump (PII) Subcutaneous osmotic pump (SII)
6 Experimental model (2) week Sacrifices 4 weeks Metabolic parameters: Weight gain Glycemia and fructosamine W eig h t (g ) P II S II S TZ Times after Stz (days) () () Liver metabolism: Hepatic glycogen IGF-1 IGF -1 (µm ) # 0 Oxidative parameters : Plasmatic oxidative stress Liver oxidative stress Expression of anti-oxidative enzyme Activation of redox sensitive pathway PII SII PII SII Inflammatory parameters : Liver macrophages Plasmatic inflammation (α2-macroglobulin)
7 PII, portal absorption and model validation Western blot Hepatic IRS activation Hepatic GH receptor expression GH R IRS P Insulin Insulin p -IR S 1/IR S 1 (r elative b an d in ten sity) $ G H R /G A P D H (r elative b an d in ten sity) # $ PII SII PII SII PII? SII? PII is a model of portal absorption of insulin p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001
8 PII and blood glucose control Metabolic parameters: Weight gain Glycemia and fructosamine Weight gain Fructosamine 400 W eig h t (g ) P II S II S TZ F r u cto sam in e (µ m o l/l ) # # 100 $ $$ T im es after S tz (d ays) 0 PII SII PII SII PII improves weight gain and blood glucose p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001
9 PII and liver metabolism Liver metabolism: Hepatic glycogen IGF-1 Glycogen quantification ELISA Plasmatic IGF-1 H ep ath ic g lyco g en (m g /m g liver ) IG F -1 (µ M ) # PII SII PII SII PII SII PII SII PII allows the restoration of liver glycogen storage and provides IGF-1 synthesis comparable to the control p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001
10 PII and plasma oxidative stress Oxidative parameters: Plasmatic oxidative stress ABTS Plasmatic antioxidant capacity TBARS Lipids peroxidation T o tal an tio xid an t cap acity (m M T E A ) PII SII PII SII L ip id s p er o xid atio n (m g /m L M D A ) # # PII SII PII $$ SII PII limits plasmatic oxidative stress induced by diabetes p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII ; p<0.05 ; p<0.01 ; p<0.001
11 PII and hepatic oxidative stress Oxidative parameters: Liver oxidative stress DHE Staining PII SII 100µm 100µm 100µm 100µm 100µm 100µm 100µm 100µm PII protects the liver from diabetes induced-oxidative stress p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001
12 PII and liver inflammation Inflammatory parameters: Liver macrophages Plasmatic inflammation (α2-macroglobulin) Hepatic macrophages infiltration IH macrophages PII SII 100µm 100µm 100µm 100µm 100µm 100µm 100µm 100µm He pa tic m a c ropha ge s (pix e ls ) # PII $ SII # PII $$ SII PII protects the liver from diabetes-induced inflammation p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001
13 Mechanisms of PII hepatic oxidative stress protection Oxidative parameters: Expression of anti-oxidative enzymes Activation of redox sensitive pathway Hepatic anti-oxidante enzyme : catalase Western blot atalase/g A P D H (r elative b an d in ten sity) # PII $ SII p 38 M A P K /G A P D H (r elative b an d in ten sity Hepatic oxidant sensitive kinase p38 MAP kinase # PII # SII PII protects the liver from diabetes-induced oxidative stress by an upregulation of catalase and the prevention of p38 pathway activation p<0.05 vs ; # p<0.05 vs ; $ p<0.05 PII vs SII; p<0.05 ; p<0.01 ; p<0.001
14 onclusions of this study We created an animal model of PII : using osmotic pump with non-toxicity of intraperitoneal insulin no signs of phenol toxicity in the peritoneum and no focal steatosis onfirmed the metabolic results observed in clinical trials a major portal absorption (GHR,p-IRS1) a better glucose control normalization of body weight gain Understood, in part, their mechanisms improvement of liver proteins synthesis (IGF-1) improved glycemic fluctuations could be explained by an increased in glycogen hepatic content
15 onclusions of this study (2) Highlighted the role of oxidative stress which is generalized (plasmatic, tissu) in diabetic rats specific beneficial effect of PII on the liver ROS level upregulation of antioxidant enzyme and status downregulation of pro-oxidant pathway Highlighted liver consequences PII protected against diabetes-induced apoptosis and aginst liver macrophages infiltration Importance of focusing on the first hepatic bypass of insulin Limitation/prevention of diabetic complications
16 THANKS Donaubauer Hans Heinrich from Sanofi-Aventis, Germany Dali-Youcef Ahmed Nassim from IGBM-UMR7014-U964, France
Diabetes and oxidative stress: impact of natural antioxydants consumption
Diabetes and oxidative stress: impact of natural antioxydants consumption Dal-Ros S., Van Der Werf R., Walter C., Bietiger W., Seyfritz E., Mura C., Peronet C., Legrandois J., Werner D., Ennahar S., Digel
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationDietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
More informationGamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells
Gamma-aminobutyric acid (GABA) treatment blocks inflammatory pathways and promotes survival and proliferation of pancreatic beta cells Gérald J. Prud homme, MD, FRCPC Keenan Research Centre for Biomedical
More informationInflammation & Type 2 Diabetes Prof. Marc Y. Donath
Inflammation & Type 2 Diabetes 1, MD Chief Endocrinology, Diabetes & Metabolism University Hospital Basel Petersgraben 4 CH-431 Basel, Switzerland MDonath@uhbs.ch Innate immunity as a sensor of metabolic
More informationDr. Hany M. Abo-Haded
BY Dr. Hany M. Abo-Haded Pediatric Cardiology Unit, Mansoura Universty Children Hospital, Mansoura, Egypt Co-authors: Dina S El-Agamy and Mohamed A Elkablawy Background Doxorubicin (DOX) is an anthracycline
More informationKefir intake as adjuvant onto glycemic control in diabetic rats. Cristina Stewart Bogsan Pharmaceutical-Biochemical Technology Department
Kefir intake as adjuvant onto glycemic control in diabetic rats Cristina Stewart Bogsan Pharmaceutical-Biochemical Technology Department Outline Type I Diabettes Mellitus Kefir; Aim; Protocol; Oxidative
More informationBiomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in treatment Professor Grace George
Division of Medical Biochemistry, Department of Human Biology, Faculty of Health Sciences, Mthatha, South Africa Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More informationAnnals of RSCB Vol. XVI, Issue 1
THE STUDY OF PROTHROBOTIC STATE IN PATIENTS WITH TYPE 2 DIABETES MELLITUS AND CARDIOVASCULAR DISEASES Oana Bădulescu 1, Codruţa Bădescu 2, Manuela Ciocoiu 1, Magda Bădescu 1 1 DEPARTMENT OF PATHOPHYSIOLOGY;
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationDiabetes Mellitus Type 2 Evidence-Based Drivers
This module is supported by an unrestricted educational grant by Aventis Pharmaceuticals Education Center. Copyright 2003 1 Diabetes Mellitus Type 2 Evidence-Based Drivers Driver One: Reducing blood glucose
More informationInsulin Pump Therapy for Type 2
9501172-011 Insulin Pump Therapy for Type 2 Objective To show the effectiveness of CSII for insulin-taking type 2 patients Key Points Tight glycemic control decreases risk of diabetes-related complications
More informationSupplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationLecture 19 Summary Gestational Diabetes and Complications of Diabetes. Gestational diabetes;
Lecture 19 Summary Gestational Diabetes and Complications of Diabetes Gestational diabetes; - Type of diabetes that only develops during pregnancy Usually diagnosed in late pregnancy Causes high blood
More informationBIOM2010 (till mid sem) Endocrinology. e.g. anterior pituitary gland, thyroid, adrenal. Pineal Heart GI Female
BIOM2010 (till mid sem) Endocrinology Endocrine system Endocrine gland : a that acts by directly into the which then to other parts of the body to act on (cells, tissues, organs) : found at e.g. anterior
More informationΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )
More informationLipid (Oil Red O) staining Kit
Lipid (Oil Red O) staining Kit Catalog Number KA4541 1 Kit Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationAT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY
AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY SA Oliveira Jr, MP Okoshi, PF Martinez, DM Guizoni, BP Torres, M Dal Pai-Silva, K Okoshi,
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationIso-Insulin ELISA ( ), Brochure
Iso-Insulin ELISA (10-1128-01), Brochure Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53
More informationPXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes
PXL770, a novel direct AMPK activator, improves metabolic disorders in a diet-induced mice model of obesity and diabetes Sébastien Bolze 1 ; Sophie Hallakou-Bozec 1 ; Michael Roden 2, 3,4 ; Julien Roux
More informationAlpha-Lipoic Acid: A Versatile Antioxidant VRM
Alpha-Lipoic Acid: A Versatile Antioxidant VRM By Yousry Naguib, PhD Alpha-lipoic acid (also known as thioctic acid) is produced in the body, and found in food sources such as liver, brewer's yeast, and
More informationPharmaceutics I صيدالنيات 1. Unit 2 Route of Drug Administration
Pharmaceutics I صيدالنيات 1 Unit 2 Route of Drug Administration 1 Routs of Drug administration The possible routes of drug entry into the body may be divided into two classes: Parenteral Rout Enteral Rout
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationESPEN Congress Madrid 2018
ESPEN Congress Madrid 2018 Dysglycaemia In Acute Patients With Nutritional Therapy Mechanisms And Consequences Of Dysglycaemia In Patients Receiving Nutritional Therapy M. León- Sanz (ES) Mechanisms and
More informationMouse Models for Studying Human Islet Transplantation
Mouse Models for Studying Human Islet Transplantation Ronald G. Gill, Joshua Beilke,, Nathan Kuhl,, Michelle Kerklo, and Mark M. Nicolls Barbara Davis Center for Childhood Diabetes University of Colorado
More informationRelative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationContinuous intraperitoneal insulin infusion in the treatment of type 1 diabetes mellitus van Dijk, P.R.
University of Groningen Continuous intraperitoneal insulin infusion in the treatment of type 1 diabetes mellitus van Dijk, P.R. IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's
More information298 Biomed Environ Sci, 2015; 28(4):
298 Biomed Environ Sci, 2015; 28(4): 298-302 Letter to the Editor Effects of Maternal Linseed Oil Supplementation on Metabolic Parameters in Cafeteria Diet-induced Obese Rats * BENAISSA Nawel 1, MERZOUK
More informationPaneth Cells. Road Map to the Finish. No Review this Friday. Today 11/29 Finish digestion/accessory organs. Wednesday 12/1 Immune System I
Road Map to the Finish No Review this Friday Today 11/29 Finish digestion/accessory organs Wednesday 12/1 Immune System I Paneth Cells - base of intestinal glands -! large -! intense acidophilic granules
More informationEffects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy
Effects of beraprost sodium on renal function and inflammatory factors of rats with diabetic nephropathy J. Guan 1,2, L. Long 1, Y.-Q. Chen 1, Y. Yin 1, L. Li 1, C.-X. Zhang 1, L. Deng 1 and L.-H. Tian
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationDefects in glucose utilization & GLP-1
Defects in glucose utilization & GLP-1 Song, Dae-Kyu Department of Physiology & Chronic Disease Research Center Keimyung University School of Medicine 2800 dalgubeol-daero, Dalseo-gu, Daegu, 704-701, Korea
More informationJournal Club WS 2012/13 Stefanie Nickl
Journal Club WS 2012/13 Stefanie Nickl Background Mesenchymal Stem Cells First isolation from bone marrow 30 ys ago Isolation from: spleen, heart, skeletal muscle, synovium, amniotic fluid, dental pulp,
More informationPharmacologyonline 1: (2010)
THERAPEUTIC ROLE OF ANTI-OXIDANT PROPERTIES OF EMBLICA OFFICINALIS (AMLA) IN STREPTOZOTOCIN INDUCED TYPE I DIABETIC RATS P. R. Tirgar* 1, P. D. Jadav 2, D. B. Sheth 3, T. R. Desai 4 Authors addresses Pravin
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationBeneficial effects of cherry consumption as a dietary intervention for metabolic, hepatic and vascular complications in type 2 diabetic rats
https://doi.org/10.1186/s12933-018-0744-6 Cardiovascular Diabetology ORIGINAL INVESTIGATION Open Access Beneficial effects of cherry consumption as a dietary intervention for metabolic, hepatic and vascular
More informationPathogenesis of Type 1 Diabetes. Diabetes Mellitus Type 1. Pathogenesis. Pathogenesis of DM1. Type 2. Type 1. Genetics of Type 1 Diabetes
Pathogenesis of Type 1 Diabetes Diabetes Mellitus Type 1 D G V A N ZYL Genetics of Type 1 Diabetes Pathogenesis Complex and poorly understood interplay between genetics and environmental factors Monozycotic
More informationStudies on the breakdown of glycogen in the lysosomes: The effects of hydrocortisone
Histol Histopathol (2000) 15: 29-35 http://www.ehu.es/histol-histopathol Histology and Histopathology Cellular and Molecular Biology Studies on the breakdown of glycogen in the lysosomes: The effects of
More informationSubject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119
Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationCo-stimulation with IGF-1 and TLR ligands induces a pro-inflammatory response in PBMCs via activation of the MAPK pathway
Co-stimulation with IGF-1 and TLR ligands induces a pro-inflammatory response in PBMCs via activation of the MAPK pathway Thalijn LC Wolters, MD 1 ; Mihai G Netea, Prof MD 2 ; Ad RMM Hermus, Prof MD 1
More informationSupplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
More informationDEVELOPMENT OF NEW ANIMAL MODELS FOR TYPE 2 DIABETES MELLITUS AND PHARMACOLOGICAL SCREENING
2) LITERATURE REVIEW 1. Srinivasan et al., (2005) developed a new rat model that replicates the natural history and metabolic characteristics of human type 2 diabetes and is also suitable for pharmacological
More informationTitle: Assessment of the post-exercise glycemic response to food: considering prior
Title: Assessment of the post-exercise glycemic response to food: considering prior nutritional status. Authors: Javier T. Gonzalez BSc. MRes., and Emma J. Stevenson BSc. Phd. Brain, Performance and Nutrition
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationOlympic diabetes What have we learned over the last decade? Ian Gallen Jephcott Symposium 9 th May 2012
Olympic diabetes What have we learned over the last decade? Ian Gallen Jephcott Symposium 9 th May 2012 Diabetes and exercise Ian Gallen Challenges in the management SR s diabetes prior to 2000 Olympic
More informationJournal Club: The Use of Fish Oil Lipid Emulsion for Gastrointestinal Surgery Patients
S a m m i M o n t a g F i s h O i l E m u l s i o n J o u r n a l C l u b - P a g e 1 Journal Club: The Use of Fish Oil Lipid Emulsion for Gastrointestinal Surgery Patients Introduction/Background I. Surgical
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More informationPancreas Fox Chapter 18 part 2 (also Chapter 19.3 & 19.4)
Vert Phys PCB3743 Pancreas Fox Chapter 18 part 2 (also Chapter 19.3 & 19.4) T. Houpt, Ph.D. Anatomy of Digestive System Peristalsis Stomach and Acid Secretion Liver and Bile Secretion Pancreas and pancreatic
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTRY INFORMTION doi:10.1038/nature11808 NT Phen Met ICR Oligo FCCP pmpk tmpk Supplemental figure 1. -. Primary hepatocytes were treated with 250 um Phenformin, 1 mm Metformin 250 um ICR, 100 nm
More information8. OXIDATIVE STRESS IN DIABETICS
8. OXIDATIVE STRESS IN DIABETICS Prof. Victor Blaton, Ph.D. Department of Clinical Chemistry, Hospital AZ Sint-Jan AV, Brugge, Belgium 1.1. Introduction Diabetes mellitus is a major source of morbidity
More informationAppetite, Glycemia and Entero-Insular Hormone Responses Differ Between Oral, Gastric-Remnant and Duodenal Administration of a Mixed Meal Test After
Appetite, Glycemia and Entero-Insular Hormone Responses Differ Between Oral, Gastric-Remnant and Duodenal Administration of a Mixed Meal Test After Roux-en-Y Gastric Bypass June 2018 How a surgical complication
More informationDiscussion & Conclusion
Discussion & Conclusion 7. Discussion DPP-4 inhibitors augment the effects of incretin hormones by prolonging their half-life and represent a new therapeutic approach for the treatment of type 2 diabetes
More informationMetabolomics in nutrition research: biomarkers predicting mortality in children with severe acute malnutrition
Metabolomics in nutrition research: biomarkers predicting mortality in children with severe acute malnutrition Michael Freemark Department of Pediatrics, Duke University Medical Center, the Duke Molecular
More informationThe Growth Hormone/Insulin-Like Growth Factor-1 Axis in Health and Disease Prof. Derek LeRoith
The Growth Hormone/Insulin-Like Growth Factor-1 Axis in Health and Disease Derek LeRoith MD PhD Division of Endocrinology, Diabetes and Bone Diseases Mt Sinai School of Medicine, NY 1 GH/IGF-1 axis Agenda:
More informationMetabolic Issues in Transgender Women Living With HIV. Jordan E. Lake, MD, MSc 2 November 2018
Metabolic Issues in Transgender Women Living With HIV Jordan E. Lake, MD, MSc 2 November 2018 Disclosures -No relevant financial disclosures Learning Objectives Understand metabolic issues relevant to
More informationDiabetes mellitus. Treatment
Diabetes mellitus Treatment Recommended glycemic targets for the clinical management of diabetes(ada) Fasting glycemia: 80-110 mg/dl Postprandial : 100-145 mg/dl HbA1c: < 6,5 % Total cholesterol: < 200
More informationData from an epidemiologic analysis of
CLINICAL TRIAL RESULTS OF GLP-1 RELATED AGENTS: THE EARLY EVIDENCE Lawrence Blonde, MD, FACP, FACE ABSTRACT Although it is well known that lowering A 1c (also known as glycated hemoglobin) is associated
More informationChapter 37: Exercise Prescription in Patients with Diabetes
Chapter 37: Exercise Prescription in Patients with Diabetes American College of Sports Medicine. (2010). ACSM's resource manual for guidelines for exercise testing and prescription (6th ed.). New York:
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationHyperglycemia: Type I Diabetes Mellitus
296 PHYSIOLOGY CASES AND PROBLEMS Case 53 Hyperglycemia: Type I Diabetes Mellitus David Mandel was diagnosed with type I (insulin-dependent) diabetes mellitus when he was 12 years old (see Cases 30 and
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationMETABOLISMO E VITAMINA D
CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary
ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU PhD THESIS Summary INVOLVEMENT OF ALARMIN HMGB1 IN INFLAMMATORY PROCESSES ASSOCIATED WITH VASCULAR DYSFUNCTION IN HYPERLIPIDEMIA
More informationImproving Access to Quality Medical Care Webinar Series
Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX
More informationDiabetes and Inflammasomes in the Bladder
Diabetes and Inflammasomes in the Bladder J Todd Purves MD, PhD Duke University Medical Center Division of Urology Disclosures: None Introduction Diabetic Bladder Dysfunction (DBD) is the most common
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationJournal of Chemical and Pharmaceutical Research, 2014, 6(5): Research Article
Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2014, 6(5):173-179 Research Article ISS : 0975-7384 CDE(USA) : JCPRC5 In vitro and in vivo evaluation of antioxidant activity
More informationIncreased oxidative stress according to number of risk factors in metabolic syndrome patients
University of Londrina, Paraná, Brazil Increased oxidative stress according to number of risk factors in metabolic syndrome patients Danielle Venturini, PhD 2016 Venturini, Danielle 1*, Alves, Caroline
More informationThe potential role of sitagliptin as an oral treatment regimen for type I diabetes mellitus
World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original
More information28 Regulation of Fasting and Post-
28 Regulation of Fasting and Post- Prandial Glucose Metabolism Keywords: Type 2 Diabetes, endogenous glucose production, splanchnic glucose uptake, gluconeo-genesis, glycogenolysis, glucose effectiveness.
More informationThe Realities of Technology in Type 1 Diabetes
The Realities of Technology in Type 1 Diabetes May 6, 2017 Rosanna Fiallo-scharer, MD Margaret Frederick, RN Disclosures I have no conflicts of interest to disclose I will discuss some unapproved treatments
More informationRelationship between Energy Expenditure Related Factors and Oxidative Stress in Follicular Fluid
Original Article Relationship between Energy Expenditure Related Factors and Oxidative Stress in Follicular Fluid Abstract This study evaluated the impact of body mass index (BMI), total calorie intake
More informationObesity Management in Patients with Diabetes Jamy D. Ard, MD Sunday, February 11, :15 a.m. 11:00 a.m.
Obesity Management in Patients with Diabetes Jamy D. Ard, MD Sunday, February 11, 2018 10:15 a.m. 11:00 a.m. Type 2 diabetes mellitus (T2DM) is closely associated with obesity, primarily through the link
More informationWeek 3, Lecture 5a. Pathophysiology of Diabetes. Simin Liu, MD, ScD
Week 3, Lecture 5a Pathophysiology of Diabetes Simin Liu, MD, ScD General Model of Peptide Hormone Action Hormone Plasma Membrane Activated Nucleus Cellular Trafficking Enzymes Inhibited Receptor Effector
More informationTargeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study
Targeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study Professor Gary Ford Chief Executive Officer, Oxford Academic Health Science Network Consultant Stroke Physician, Oxford
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationProgestin-only methods Type or dose of progestagen
Progestin-only contraception and beneficial effects on migraine Conflicts of interest A d v ise r a n d le ctu re r fo r E X E LT IS Le ctu re s a n d A d v iso ry b o a rd s B aye r Le ctu re s a n d
More informationIntraperitoneal (IP) insulin absorption
Emerging Treatments and Technologies O R I G I N A L A R T I C L E Comparison of Antigenicity of Hoechst 21PH Insulin Using Either Implantable Intraperitoneal Pump or Subcutaneous External Pump Infusion
More informationPathogenesis of Diabetes Mellitus
Pathogenesis of Diabetes Mellitus Young-Bum Kim, Ph.D. Associate Professor of Medicine Harvard Medical School Definition of Diabetes Mellitus a group of metabolic diseases characterized by hyperglycemia
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationAnti-Diabetic Blueberries. Dixon Springs Summer Internship Program Anita Lucius
Anti-Diabetic Blueberries Dixon Springs Summer Internship Program Anita Lucius Background Diabetes 6 th leading cause of death in US Affects over 18 million people Complications Renal disease Ophthalmic
More informationHypoglycemia a barrier to normoglycemia Are long acting analogues and pumps the answer to the barrier??
Hypoglycemia a barrier to normoglycemia Are long acting analogues and pumps the answer to the barrier?? Moshe Phillip Institute of Endocrinology and Diabetes National Center of Childhood Diabetes Schneider
More informationRole of incretins in the treatment of type 2 diabetes
Role of incretins in the treatment of type 2 diabetes Jens Juul Holst Department of Medical Physiology Panum Institute University of Copenhagen Denmark Diabetes & Obesity Spanish Society of Internal Medicine
More informationMetabolic diseases of the liver
Metabolic diseases of the liver Central role in metabolism Causes and mechanisms of dysfunction Clinical patterns of metabolic disease Clinical approach to problem-solving Specific disorders Liver s central
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationInvolvement of n-3 PUFA-derived lipid mediators in the resolution of brain inflammation
The 1 th Nutrition-Neuroscience meeting The 27 th of march 217 Involvement of n-3 PUFA-derived lipid mediators in the resolution of brain inflammation Charlotte Rey- PhD student Acute inflammatory response
More informationINTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE
INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH AND BIO-SCIENCE EVALUATION OF CARDIO PROTECTIVE EFFECT OF LINAGLIPTIN A NOVEL DPP-4 INHIBITOR IN NORMAL AND STREPTOZOTOCIN INDUCED TYPE-2 DIABETIC RATS
More informationOpen-label study to assess the safety and pharmacodynamics of five oral insulin formulations in healthy subjects
Diabetes, Obesity and Metabolism 12: 219 223, 2010. 2010 Blackwell Publishing Ltd Open-label study to assess the safety and pharmacodynamics of five oral insulin formulations in healthy subjects R. Eldor
More informationInternational Journal of Allied Medical Sciences and Clinical Research (IJAMSCR)
International Journal of Allied Medical Sciences and Clinical Research (IJAMSCR) IJAMSCR Volume 4 Issue 3 July - Sep - 2016 www.ijamscr.com ISSN:2347-6567 Research article Medical research Astashine capsules:
More informationNon alcoholic fatty liver and Non alcoholic Steatohepatitis. By Dr. Seham Seif
Non alcoholic fatty liver and Non alcoholic Steatohepatitis By Dr. Seham Seif Definition NAFL describe a common clinicopathological conditions characterized by significant lipid deposition in the hepatocytes
More information