EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE

Transcription

1 Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J. C. Nietfeld 2, nd J. E. Minton Summry Eighteen pigs (initil weight 25 l nd pproximtely 5 wk of ge) were used in 14-d tril to determine the effects of n cute Slmonell enteric serotype typhimurium (ST) disese chllenge on oth circulting insulinlike growth fctor-1 (IGF-1) nd insulin-like growth fctor inding protein-3 (IGFBP-3) nd stedy-stte IGF-1 nd IGFBP-3 mrna levels in skeletl muscle. Muscle iopsies nd lood smples were otined from ll pigs on d, 3, 7, nd 14 reltive to ST-chllenge. Results suggest tht n cute ST-chllenge decresed circulting IGF-1 levels on d 3 nd 7 ut did not ffect circulting IGFBP-3 concentrtions. Additionlly, ST-chllenge hd no effect on stedy-stte IGF-1 nd IGFBP-3 mrna levels in skeletl muscle following the onset of disese. These dt suggest tht n cute enteric disese insult cn lower circulting IGF-1 ut more chronic conditions my e necessry to ffect locl IGF-1 levels in skeletl muscle. Additionlly, the incresed muscle IGF-1 mrna without incresed IGFBP-3 levels on d 14 most likely results in incresed IGF-1 synthesis tht contriutes to circulting IGF-1 concentrtions. (Key Words: Pigs, Slmonell, Muscle, IGF- 1, IGFBP-3.) Introduction Our previous dt with n cute enteric disese (Slmonell enteric serotype typhimurium, ST) chllenge showed precipitous decrese in circulting IGF-1 nd IGFBP-3 concentrtions 48 h fter chllenge. These dt suggest tht ltertions in IGF/IGFBP levels during disesed-stte my contriute to the reduced skeletl muscle protein ccretion. To our knowledge no one hs scertined the effect of n cute enteric disese chllenge on locl IGF-1 nd IGFBP-3 synthesis in skeletl muscle tissue. A more thorough understnding of ltertions in locl IGF-1 nd IGFBP-3 mrna levels in skeletl muscles of pigs during n cute disese chllenge will increse our understnding of the effect of disese on these importnt growth meditors nd, ultimtely, protein synthesis nd degrdtion in skeletl muscle. The ojective of the current study ws to determine the effect of n infectious dose of ST on chnges in stedy-stte IGF-1 nd IGFBP-3 mrna of porcine skeletl muscle. Procedures The experimentl protocol used in this study ws pproved y the KSU Institutionl Animl Cre nd Use Committee. A totl of 18 pigs (initil weight 25 l nd pproxi- 1 Food Animl Helth nd Mngement Center. 2 Dignostic Medicine/Pthoiology. 48

2 mtely 5 wk of ge) were rndomly llotted to one of two tretments (n=9 pigs per tretment) with weight lnced cross the tretments in 14-d experiment. The two tretments were control or Slmonell-chllenged (ST). Preceding the study fecl smples were otined nd cultured using stndrd microiologicl direct plting nd enrichment techniques t the Knss Stte University Veterinry Dignostic Lortory to ensure tht pigs were not shedding ST prior to chllenge. On d, nine pigs were chllenged with ST using chllenge model descried previously. Pigs were chllenged orlly with cfu of ST. The control pigs received sterile medium orlly. Pigs were weighed nd feed disppernce ws mesured on d, 7, nd 14. On d 7 fter chllenge, fecl smples were otined from ll pigs nd cultured for ST t the Knss Stte University Veterinry Dignostic Lortory. Rectl temperture ws mesured on pigs dily from d to 7. Blood smples were otined vi venipuncture on d (prior to chllenge), 3, 7, nd 14. Muscle smples (.5 g) were otined from the gluteus medius of pigs on d, 3, 7, nd 14, reltive to disese chllenge using iopsy technique. Briefly, pigs were dministered generl nesthesi. Once pigs reched surgicl plne of nesthesi (pproximtely 1 min.) the iopsy site ws scrued thoroughly nd 1-cm incision ws performed. A Bergstrom iopsy needle ws inserted to otin pproximtely.5 g of muscle tissue. The incision site ws closed with tissue dhesive. Pigs fully recovered within 1.5 hr of the procedure. Muscle smples were immeditely homogenized in 1 ml of preservtive solution, followed y rpid freezing in liquid nitrogen nd stored t -8 C for susequent nlysis. Totl RNA ws isolted ccording to estlished procedures. RNA integrity ws determined y electrophoresis of totl RNA through 1% grose formldehyde gel followed y ethidium romide stining to visulize 28 nd 18S riosoml RNA (rrna). Once RNA integrity ws ssessed, ny contminting DNA ws removed. The RNA (1 ug) ws reverse trnscried to synthesize the firststrnd of cdna. All rel-time quntittive (RTQ-PCR) rections were performed on ABI Prism 7 sequence detection system, (Applied Biosystems, Foster City, CA). Specific cdna sequence, forwrd nd reverse primer sequences, nd Tq Mn detection proe sequences were: IGF-1: Gennk Accession # M31175, forwrd primer (38) TCTTCTACTTGGCCCTGTGCTT, reverse primer (11) GCCCCACAGAGGGTCTCA, nd TqMn proe (65) CCTTCAC- CAGCTCTGCCACGGC IGFBP-3: Gennk Accession #AF85482, forwrd primer (692) AGCACG- GACACCCAGAACTT, reverse primer (753) CGGCAAGGCCCGTATTC, nd TqMn proe (713) TCCTCTGAGTCCAAGCGCGAGA Reltive expression of IGF-1 nd IGFBP-3 were normlized to 18S rrna with the eukryotic 18S rrna endogenous control (ABI Ct. # E; Gennk Accession # X325) nd were reported s ritrry units. Blood collected on d, 3, 7, nd 14 ws llowed to clot t 4 C for 48 h nd serum hrvested y centrifugtion. Serum IGF-1 ws determined vi immunordiometric ssy s descried previously for use in pigs. Circulting concentrtions of IGFBP-3 were lso determined with commercilly ville im- 49

3 munordiometric ssy (Dignostic Systems Lortories, Inc., Wester, TX, Ct. # DSL 66). All dt were nlyzed with the PROC MIXED procedure of SAS s completely rndomized design with repeted mesures over time. The model included terms for the fixed effects of tretment, dy, nd tretment dy interction. Unless noted on figures, comprisons of tretment or time were conducted only when significnt min effect or interction ws found. Results nd Discussion None of the pigs were shedding ST prior to chllenge. On d 7 following chllenge, 77.8 % (7/9) of pigs orlly-chllenged with ST were shedding ST in their feces s compred to % (/9) in the control group. Rectl temperture in ST-chllenged pigs did not differ from control pigs during the 14-d tril (dt not shown). However, dily feed intke ws drmticlly reduced in pigs chllenged with ST the first week following chllenge s compred to control pigs (.84 l/d ±.15 vs l/d ±.11). Circulting IGF-1 levels did not differ (P>.1) etween control nd ST-chllenged pigs prior to chllenge (Figure 1). Following the orl ST-chllenge, infected pigs exhiited precipitous drop in circulting IGF-1 levels on d 3 s compred to the d vlue (33 vs. 97 ng/ml). Ser from pigs chllenged with ST hd reduced (P<.5) IGF-1 on d 3 nd 7 s compred to ser from control pigs (Figure 1). However, y d 14 following chllenge, ser from ST-infected pigs hd similr circulting IGF-1 s compred to ser from control pigs, suggesting the pigs were recovering from the cute disese chllenge (Figure 1). The circulting IGF-1 results need to e viewed with some cution. While the tretment dy interction tended to e significnt (P=.9) in this study, we elieve the tretment comprisons within dy re representtive. First, the chnges reported here mirror results pulished previously which were otined from the sme ST- disese chllenge model. Furthermore, due to the precipitous drop in feed intke the first week following ST-chllenge, we would fully expect circulting IGF-1 concentrtions to e reduced during this period. Serum concentrtions of IGFBP-3 re illustrted in Figure 2. No significnt (P>.1) tretment dy interction ws oserved for circulting IGFBP-3. We did oserve significnt dy effect (P<.1). Circulting IGFBP-3 in ser from pigs on d 7 nd 14 were elevted (P<.1) s compred to smples otined on d nd 3. The effects of ST-chllenge on stedystte IGF-1 mrna levels in muscle re illustrted in Figure 3. No significnt tretment dy interction ws oserved for stedy-stte IGF-1 mrna levels in muscle of pigs. However, we did detect significnt dy effect. Stedy-stte IGF-1 mrna in muscle smples otined on d 14 were significntly greter (P<.1) thn d, 3, nd 7. In this study, skeletl muscle IGF-1 mrna levels were unffected y ST-chllenge even though circulting IGF-1 levels were reduced following the cute ST-chllenge. These dt suggest tht n cute disese chllenge my not e sufficient to lter locl IGF-1 levels in skeletl muscle. However, more chronic disese chllenge could lower IGF-1 levels in skeletl muscle which would ffect protein synthesis nd degrdtion rtes. No tretment effect ws oserved for stedy-stte IGFBP-3 mrna levels in muscle smples otined y iopsy (Figure 3). It is noteworthy tht during the period of incresing muscle IGF-1 mrna concentrtions (d 14) locl muscle IGFBP-3 mrna levels were unffected. This difference etween responses 5

4 etween muscle IGF-1 nd IGFBP-3 gene expression on d 14 my contriute to incresed skeletl muscle protein synthesis during periods of rpid muscle ccretion in the growing pig. The incresed muscle IGF-1 mrna without incresed IGFBP-3 levels on d 14 most likely results in incresed IGF-1 synthesis. It is likely tht this IFG-1 production exits the muscle nd contriutes to the incresed circulting IGF-1 levels. Serum IGF-1 (ng/ml) 2 Control ST Trt P=.79 Trt x Dy P=.97 P<.5 P<.5 Averge c Dy P<.1 Dy Figure 1. Serum Insulin-Like Growth Fctor 1 (IGF-1) Concentrtions in ST-Chllenged nd Control Pigs (n=9). Ser were otined on d, 3, 7, nd 14 following chllenge. Serum IGFBP-3 (ng/ml) 1 Control ST Averge Trt P=.23 Dy P<.1 Trt x Dy P=.16 Dy Figure 2. Serum Insulin-Like Growth Fctor Binding Protein 3 (IGFBP-3) Concentrtions in ST-Chllenged nd Control Pigs (n=9). Ser were otined on d, 3, 7, nd 14 following chllenge. Averge (dy) vlues with different superscripts differ P<.5. 51

5 Aritrry Unit (AU 1 6 ) A Control Trt P=.65 Dy P<.1 Trt Dy P=.87 ST Averge c Dy Aritrry Units (AU 1 6 ) B 5 Control ST Averge Trt P=.97 Dy P<.5 Trt Dy P=.17 Dy Figure 3. A) Stedy-Stte Muscle IGF-1 mrna Levels in Muscle Biopsy Smples Otined from ST-Chllenged nd Control Pigs on D, 3, 7, nd 14 Reltive to Disese Chllenge. IGF-1 mrna levels were normlized to 18S rrna nd expressed s ritrry units. B) Stedy-stte muscle IGFBP-3 mrna levels in muscle iopsy smples otined from ST-chllenged nd control pigs. IGFBP-3 mrna levels were normlized to 18S rrna nd expressed s ritrry units similr to IGF-1. 52