Supplementary Figure 1. Verification of drug infusions into the IPN. a. Representative
|
|
|
- Florence Fletcher
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1. Verifiation of drug infusions into the IPN. a. Representative neutral red-stained oronal setion from a mouse with a guide annula targeting the IPN. The guide annula sar is irled in magenta (note that the infusion annula projets 0.25 mm beyond the guide annula). The stereotati oordinates from bregma in mm are indiated below the photo. Brain atlas demarations are overlaid onto the oronal setion (white lines). b. Eah magenta irle represents an individual guide annula plaement for a mouse that reeived miro-infusions into the IPN. Note that for larity, not every annula plaement is shown. Guide annula plaements were verified as indiated in Methods and Results setions.
2 Supplementary Figure 2. Meamylamine infusion into the VTA does not indue anxiety in niotine-dependent mie. a. Average number of marbles buried in ontrol and hroni niotine treated mie after saline (1.5 l, n = 9 mie/group) or meamylamine (3 g, n = 9 and 8, respetively) infusion into the VTA. b. Average time spent in the open arms of the EPM in ontrol or hroni niotine-treated mie after a VTA infusion of saline (n = 9 mie/group) or meamylamine (n = 9 and 8, respetively).. Average total arm entries in ontrol or hroni niotine treated animals after a VTA infusion of saline or meamylamine as in panel b. d. Illustration depiting a mouse brain oronal setion. Guide annula sar is irled. e. Eah magenta irle represents an individual guide annula plaement for a mouse that reeived miro-infusions into the VTA. Guide annula plaements were verified as in Fig. S2. Data are expressed as mean ± SEM.
3 Supplementary Figure 3. Meamylamine infusion into the MnR does not indue anxiety in niotine-dependent mie. a. Average number of marbles buried in ontrol and hroni niotine treated mie after saline (1.5 l, n = 8 mie/group) or meamylamine (3 g, n = 11 and 10, respetively) infusion into the MnR. Two-way ANOVA: signifiant effet of infusion (F 1,33 = 6.23, p = 0.018) but not hroni treatment nor an interation. b. Average time spent in the open arms of the EPM in ontrol or hroni niotine-treated mie after a MnR infusion of saline (n = 8 mie/group) or meamylamine (n = 11 and 10, respetively).. Average total arm entries in ontrol or hroni niotine-treated animals. d. Illustration depiting a mouse brain oronal setion. Guide annula sar is irled. e. Eah magenta irle represents an individual guide annula plaement for a mouse that reeived miro-infusions into the MnR. Guide annula plaements were verified as in Supplementary Fig. 2. Data are expressed as mean ± SEM.
4 a b Supplementary Figure 4. Systemi antalarmin redues anxiety during niotine withdrawal. a. Average number of marbles buried in ontrol and hroni niotinetreated mie after an i.p. injetion of vehile (n = 24 mie/group) or antalarmin (10 mg/kg, n = 7 mie/group) prior to i.p. saline or meamylamine (3 mg/kg). Two-way ANOVA: Chroni treatment F 1, 69 = 8.795, p = , treatment x drug interation F 2, 69 = 4.26, p = b. Average time spent in the open arms of the EPM in ontrol or hroni niotine-treated mie after an i.p. injetion of vehile (n = 10 and 11, respetively) or antalarmin prior (n = 14 and 7, respetively) to i.p. saline or meamylamine. Two-way ANOVA: Drug F 2, 50 =8.82, p = , Chroni treatment F 1, 50=4.83, p = 0.033, treatment x drug interation F 2, 50 = 4.09, p = Average total arm entries in ontrol or hroni niotine-treated animals after an i.p. injetion of saline or antalarmin prior to i.p. saline or meamylamine. Two-way ANOVA: Drug F 2, 50 =3.76, p = Data are expressed as mean ± SEM. *p<0.05, ** p < 0.01, *** p<0.01. ^p<0.05 ompared to ontrol mie under the same onditions.
5 a Type 1 b Type 2-60 mv -80 mv Current (pa) 1.5 s 20 Voltage (mv) Type 1 Type 2 d Current (pa) e -60 DNA ladder Type2 Type1 (-) trl f % Positive Single-ell rtpcr Reations Voltage (mv) CRF1 Reeptor Expression 0 Type 1 Type 2 Supplementary Figure 5. Charaterization of IPI neurons. Representative family of voltage traes from a. IPI Type 1 and b. IPI Type 2 neurons under urrent lamp. From resting membrane potential, urrent was injeted in 10 pa steps for 1.5 s as indiated.. Current-voltage relationship of Type 1 and Type 2 IPI neurons at hyperpolarized potentials between -70 and -120 mv (n = neurons/type). d. Current-voltage relationship of Type 1 and Type 2 IPI neurons from potentials between -60 and 120 mv
6 (n = neurons/type). e. Representative gel illustrating CRF1 reeptor expression from a single Type 1 and Type 2 neuron measured via RT-PCR after path-lamp reording. f. Bar graphs indiate perent of path-lamped Type 1 or Type 2 neurons that expressed CRF1 reeptor mrna as measured by single neuronal RT-PCR. Data are expressed as mean ± SEM.
7 a Baseline CRF b EPSC Frequeny (% of Control) * 0 Baseline CRF Wash 250 EPSC Amplitude (% of Control) Baseline CRF Wash d e Control Baseline CRF Wash AP5 Niotine Niotine + Antalarmin
8 Supplementary Figure 6. CRF modulation of sepsc and NMDA reeptors. a. Representative whole-ell voltage lamp reordings from Type 2 neurons within the IPI of niotine withdrawn slies in response to 250 nm CRF. Average sepsc (b.) frequeny and (.) amplitude at baseline, after a 5-minute appliation of CRF, and after washout from Type 2 IPI neurons (n = 5, One-way ANOVA with repeated measures: Frequeny, p = 0.024; Amplitude, NS). d. Representative eletrially evoked NMDA urrents from IPI neurons reorded in slies from niotine naïve (top, Control) and hroni niotine-treated (middle, Niotine) mie. NMDA urrent (V m = +40 mv) at baseline, after 5 min appliation of 250 nm CRF, and after 10 min washout are shown. Bottom, representative eletrially evoked NMDA urrent from IPI neurons as desribed above exept in the presene of antalarmin. Evoked urrents were abolished in the presene of AP5 (10 M, inset). Stimulation artifats were removed for larity. e. Average fold-hange of peak evoked NMDA urrent in response to CRF (CRF response normalized to baseline) for ontrol, hroni niotine slies, and hroni niotine slies in the presene of antalarmin. (n = 10, 8, and 8 neurons, respetively. Control vs. Niotine: t 16 = 3.27, p = , two-tailed Student s t-test. Niotine vs. Niotine+Antalarmin: t 14 = 3.44, p = 0.004). Data are expressed as mean ± SEM. *p < 0.05, **p <
9 a b AAV2 MHb 4 weeks ChAT-re C h r o n i d 3 days N i o t i n e e f Spontaneous/Preipitated Withdrawal Supplementary Figure 7. Experimental paradigm for Halorhodopsin expression in MHb. a. Depition of experimental strategy for expression of halorhodopsin seletively in holinergi neurons of the MHb. The AAV-Ef1A-DIO-eNpHR-eYFP plasmid (top) allows for expression of halorhodopsin in neurons that express re reombinase. The plasmid was pakaged into AAV2 viral partiles and injeted bilaterally in the MHb of ChAT-re
10 mie. Mie were then hronially treated with niotine for 4 weeks. Opti annulas targeting the MHb projetions to the IPN were implanted and experiments examining ativation of the IPI during meamylamine-preipitated withdrawal or anxiety-like behavior during spontaneous niotine withdrawal were onduted three days later. b. Representative whole-ell reordings from eyfp-positive MHb neurons under voltagelamp (top) or urrent-lamp (bottom) in slies taken from enphr-eyfp infeted ChATre mie. Halorhodopsin was ativated by 593 nm light indiated by the yellow bars. Top sale bar: x=100 pa, y=10s. Bottom sale bar: 50 mv. Baseline anxiety-like behavior in the. MBT and d. EPM. in ontrol-virus and enphr-eyfp-infeted ChATre mie during hroni niotine treatment. e. Total arm entries from mie in panel d. f. Total arm entries in the EPM for mie in Figure 6f.
11 a b MHb d MHb IPN e 4 weeks ChAT-re C h r o n i 3 days N i o t i n e f Spontaneous Withdrawal Supplementary Figure 8. Stimulation of MHb-IPN terminals does not redue anxietylike behavior in niotine dependent mie. a. Experimental strategy for expression of hannelrhodopsin in MHb ChAT neurons. AAV-Ef1A-DIO-ChR2-eYFP plasmid was pakaged into AAV2 viral partiles and injeted into the MHb of ChAT-re mie. b. Representative photomirographs from representative MHb (top) and IPN (bottom)
12 oronal setions from ChAT-re mie expressing ChR2-eYFP four weeks post-injetion.. Blue light-indued (blue bar = 2 ms light pulse) ation potentials in MHb neurons expressing ChR2. Reordings were done in ell-attahed path-lamp mode. Sale bar: x = 50 ms, y = 20 pa. d. Number of marbles buried in niotine-dependent, nonwithdrawn (Niotine) or niotine-dependent, spontaneous withdrawn ChAT-re mie (Withdrawal) expressing either ontrol virus (Control, n = 9 and 12, respetively) or hannelrhodopsin (ChR2-eYFP, n = 9). Behaviors in all groups were measured during light stimulation. Stimulation paradigm: 5 Hz, 50 ms pulse width, 35 m light-on epohs. e. Time spent on the open arms of the EPM in niotine-dependent, non-withdrawn (Niotine) or niotine-dependent, spontaneous withdrawn ChAT-re mie (Withdrawal) expressing either ontrol virus (Control, n = 9 and 12, respetively) or ChR2-eYFP (n = 9 and 8, respetively). Behaviors in all groups were done during light stimulation. f. total arm entries in the EPM for eah group. Data are expressed as mean ± SEM. Two-way ANOVA. ***p < 0.001, signifiant main effet of withdrawal state only (MBT: F 1, 34 = EPM: F 1, 34 = 187.7).
13 a VTA DAergi Neuron TH-re b VTA VTA IPDL IPR IPDL IPL IPI IPC IPL IPI Supplementary Figure 9. A population of DAergi VTA neurons projet to ventral IPN forming a meso-interpedunular iruit. a. Experimental strategy for expression of hannelrhodopsin in VTA DAergi neurons. AAV-Ef1A-DIO-ChR2-eYFP plasmid was pakaged into AAV2 viral partiles and injeted into the VTA of TH-re mie. Three to four weeks post-injetion, VTA DAergi neurons robustly expressed ChR2 as indiated by blue light-indued inward urrents under voltage-lamp at -70 mv (right). Sale bar: y = 200 pa, x = 1 s. b. Photomirographs depiting eyfp signal in the VTA and IPN of TH-re mie after unilateral injetion of AAV2-ChR2-eYFP viral partiles in the VTA. Sale bar: 200 m.
14 Supplementary Table 1. Average sepsc frequeny and amplitude from data in Figure 4 Neuron Type 1 Neuron Type 2 Mean sepsc Frequeny ± SEM (Hz) Treatment Baseline Response Wash Baseline Response Wash CRF 4.43± ± ± ± ±1.25* 2.36±0.92 Antalarmin 2.58± ± ± ± ±0.43** 1.99±0.55 Mean sepsc Amplitude ± SEM (pa) CRF 10.76± ± ±1.82 Antalarmin 12.03± ± ± ± ± ± 1.97** 10.86± ± 1.01** 12.57±1.90 * p < 0.05, ** p < 0.01, drug treatment ompared to baseline, One-way ANOVA with repeated measures, Bonferroni post-ho
Supplementary Information
Supplementary Information Optial ontrolling reveals time-dependent roles for adult-orn dentate granule ells Yan Gu, Maithe Arruda-Carvalho 3,4, Jia Wang, Stephen Janoshka,, Sheena Josselyn 3-5, Paul Frankland
Learned spatiotemporal sequence recognition and prediction in primary visual cortex
Supplementary Materials for Learned spatiotemporal sequene reognition and predition in primary visual ortex Jeffrey P. Gavornik and Mark F. Bear Howard Hughes Medial Institute Piower Institute for Learning
Supplementary Figure 1
Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,
Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons
Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),
Supplementary Figure 1. Schematic illustrating major conclusions of this study.
ORNs GABA A GABA B glomeruli LN PNs Supplementary Figure 1. Shemati illustrating major onlusions of this study. This study represents the most diret evidene to date of inhiitory interations etween olfatory
Supplementary Figure 1
Supplementary Figure 1 Miniature microdrive, spike sorting and sleep stage detection. a, A movable recording probe with 8-tetrodes (32-channels). It weighs ~1g. b, A mouse implanted with 8 tetrodes in
Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior
Supplementary Figure 1 Trial structure for go/no-go behavior a, Overall timeline of experiments. Day 1: A1 mapping, injection of AAV1-SYN-GCAMP6s, cranial window and headpost implantation. Water restriction
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
Social transmission and buffering of synaptic changes after stress
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0044-6 In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee
Short- and long-lasting consequences of in vivo nicotine treatment
Short- and long-lasting consequences of in vivo nicotine treatment on hippocampal excitability Rachel E. Penton, Michael W. Quick, Robin A. J. Lester Supplementary Figure 1. Histogram showing the maximal
Supplementary Figure 1
Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in
Cytomegalovirus and tumor stress-surveillance by human γδ T cell receptor binding to Endothelial Protein C Receptor
Cytomegalovirus and tumor stress-surveillane y human γδ T ell reeptor inding to Endothelial Protein C Reeptor Carrie R. Willox, Vinent Pitard, Sonia Netzer, Lionel Couzi, Mahoo Salim, Toias Silerzahn,
PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT. Keywords: Medical, Optimization, Modelling, Oscillation, Noise characteristics.
PARKINSON S DISEASE: MODELING THE TREMOR AND OPTIMIZING THE TREATMENT Mohammad Haeri, Yashar Sarbaz and Shahriar Gharibzadeh Advaned Control System Lab, Eletrial Engineering Department, Sharif University
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
Hormonal gain control of a medial preoptic area social reward circuit
CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,
LHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
Astrocyte signaling controls spike timing-dependent depression at neocortical synapses
Supplementary Information Astrocyte signaling controls spike timing-dependent depression at neocortical synapses Rogier Min and Thomas Nevian Department of Physiology, University of Berne, Bern, Switzerland
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in
Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex
Supplementary Information Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex Luc Gentet, Yves Kremer, Hiroki Taniguchi, Josh Huang, Jochen Staiger and Carl
Supplementary Figure 1. Implants derived from human embryoid body preparations contain non-cardiac structures. In early studies, infarcted hearts
a Supplementary Figure 1. Implants derived from human emryoid ody preparations ontain non-ardia strutures. In early studies, infarted hearts reeived ell preparations of low ardia purity (
Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses
Cell Reports, Volume 26 Supplemental Information Dorsal Raphe Dual Serotonin-Glutamate Neurons Drive Reward by Establishing Excitatory Synapses on VTA Mesoaccumbens Dopamine Neurons Hui-Ling Wang, Shiliang
Supplemental Information. A Visual-Cue-Dependent Memory Circuit. for Place Navigation
Neuron, Volume 99 Supplemental Information A Visual-Cue-Dependent Memory Circuit for Place Navigation Han Qin, Ling Fu, Bo Hu, Xiang Liao, Jian Lu, Wenjing He, Shanshan Liang, Kuan Zhang, Ruijie Li, Jiwei
Two distinct mechanisms for experiencedependent
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0150-0 In the format provided by the authors and unedited. Two distinct mechanisms for experiencedependent homeostasis Michelle C.
Deficits in amygdaloid camp-responsive element binding protein signaling play a role in genetic predisposition to anxiety and alcoholism
Research article Related Commentary, page 2697 Deficits in amygdaloid camp-responsive element binding protein signaling play a role in genetic predisposition to anxiety and alcoholism Subhash C. Pandey,
Nucleus Accumbens Subnuclei Regulate Motivated Behavior via Direct Inhibition and Disinhibition of VTA Dopamine Subpopulations
Article Nucleus Accumbens Subnuclei Regulate Motivated Behavior via Direct Inhibition and Disinhibition of VTA Dopamine Subpopulations Highlights d Mesolimbic DA subpopulations are embedded within different
Spleen VAT FMO. Nature Immunology: doi: /ni Ki67 DX5 CD27. CD11b 2B4 KLRG1 CD69 NKG2D CXCR3 CD44 NKG2A/C/E CD62L CD103 CD94 CD48.
IFN (% of ells) CD7 Marophages Medium NCR LPS PMA/Ionomyin CD IFN (% of ells) T ells Marophages B ells DX CD9 KLRG NKGD B CDL CD CD CXCR CD9 CD NKGA/C/E NCR Ly9h Ly9G Ly9d Ly9i Ly9/i/h FMO CD7 CD9a CD7
Data Retrieval Methods by Using Data Discovery and Query Builder and Life Sciences System
Appendix E1 Data Retrieval Methods by Using Data Disovery and Query Builder and Life Sienes System All demographi and linial data were retrieved from our institutional eletroni medial reord databases by
-80 Figure 1. Identification of dopaminergic neurons in. VTA slices (a) Micrographs demonstrate the location of the VTA with
Potential (mv) A B C Potential (mv) D E F Biocytin TH Merge R 12 12 1 1 8 G 6 4 8 6 4 H 2 2-2 -2-4 -4-6 -6 Supplemental -8-8 Figure 1. Identification of dopaminergic neurons in -1 VTA slices. -1 (a) Micrographs
Nature Neuroscience: doi: /nn Supplementary Figure 1. Confirmation that optogenetic inhibition of dopaminergic neurons affects choice
Supplementary Figure 1 Confirmation that optogenetic inhibition of dopaminergic neurons affects choice (a) Sample behavioral trace as in Figure 1d, but with NpHR stimulation trials depicted as green blocks
PRESENCE OF A GASTRIC MOTOR-STIMULATING PROPERTY IN DUODENAL EXTRACTS
GASTRONTROLOGY opyright 1967 by The Williams & Wilkins o. Vol. 52, No.2, Pat 1 Printed in U.S.A. PRSN OF A GASTR MOTOR-STMULATNG PROPRTY N DUODNAL XTRATS JOHN. BROWN, PH.D. Department of Physiology, University
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
Measurement of Dose Rate Dependence of Radiation Induced Damage to the Current Gain in Bipolar Transistors 1
Measurement of Dose Rate Dependene of Radiation Indued Damage to the Current Gain in Bipolar Transistors 1 D. Dorfan, T. Dubbs, A. A. Grillo, W. Rowe, H. F.-W. Sadrozinski, A. Seiden, E. Spener, S. Stromberg,
100 μm. Axon growth cones. Tubulin (red) + scr (green)
Supplementary Figures mirorna-9 regulates axon extension an ranhing y targeting Map1 in mouse ortial neurons Dajas-Bailaor, F., Bonev, B., Garez, P., Stanley, P., Guillemot, F., Papalopulu, N. a 2 μm 1
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
% of Nestin-EGFP (+) cells
8 7 6 3 Nestin CD % of Nestin-EGFP (+) ells 8 6 Nestin-EGFP Marge Nestin-EGFP Marge Expression levels of Expression levels of Tumorigeniity y stemness markers ifferentiation markers limiting ilution assay
SUPPLEMENTARY INFORMATION. Supplementary Figure 1
SUPPLEMENTARY INFORMATION Supplementary Figure 1 The supralinear events evoked in CA3 pyramidal cells fulfill the criteria for NMDA spikes, exhibiting a threshold, sensitivity to NMDAR blockade, and all-or-none
Nature Neuroscience: doi: /nn Supplementary Figure 1. ACx plasticity is required for fear conditioning.
Supplementary Figure 1 ACx plasticity is required for fear conditioning. (a) Freezing time of conditioned and control mice before CS presentation and during CS presentation in a new context. Student s
Dep. Control Time (min)
aa Control Dep. RP 1s 1 mv 2s 1 mv b % potentiation of IPSP 2 15 1 5 Dep. * 1 2 3 4 Time (min) Supplementary Figure 1. Rebound potentiation of IPSPs in PCs. a, IPSPs recorded with a K + gluconate pipette
Conduction Properties of the Cloned Shaker K+ Channel
Biophysial Journal Volume 65 November 1993 89-96 Condution Properties of the Cloned Shaker K+ Channel 89 Lise Heginbotham and Roderik MaKinnon Department of Neurobiology, Harvard Medial Shool, Boston,
clinical conditions using a tape recorder system
Thorax (1964), 19, 125 Objetive assessment of ough suppressants under linial onditions using a tape reorder system C. R. WOOLF AND A. ROSENBERG From the Respiratory Unit, Sunnybrook Hospital (Department
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06310 SUPPLEMENTARY INFORMATION www.nature.com/nature 1 www.nature.com/nature 2 www.nature.com/nature 3 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Drd1a-Cre driven ChR2 expression in the SCN. (a) Low-magnification image of a representative Drd1a-ChR2 coronal brain section (n = 2) showing endogenous tdtomato fluorescence (magenta).
Nature Neuroscience: doi: /nn.4335
Supplementary Figure 1 Cholinergic neurons projecting to the VTA are concentrated in the caudal mesopontine region. (a) Schematic showing the sites of retrograde tracer injections in the VTA: cholera toxin
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
Tuning properties of individual circuit components and stimulus-specificity of experience-driven changes.
Supplementary Figure 1 Tuning properties of individual circuit components and stimulus-specificity of experience-driven changes. (a) Left, circuit schematic with the imaged component (L2/3 excitatory neurons)
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g)
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) In four mice, cre-dependent expression of the hyperpolarizing opsin Arch in pyramidal cells
Amplitude and time course of evoked and spontaneous synaptic currents in rat submandibular ganglion cells
4372 Journal of Physiology (1996), 49.1, pp. 149-157 Amplitude and time ourse of evoked and spontaneous synapti urrents in rat submandibular ganglion ells Robert J. allister and Brue Walmsley * The Neurosiene
Nature Neuroscience: doi: /nn Supplementary Figure 1. Lick response during the delayed Go versus No-Go task.
Supplementary Figure 1 Lick response during the delayed Go versus No-Go task. Trial-averaged lick rate was averaged across all mice used for pyramidal cell imaging (n = 9). Different colors denote different
Rho-kinase Regulates Energy Balance by Targeting Hypothalamic Leptin Receptor Signaling
Rho-kinase Regulates Energy Balane y Targeting Hypothalami Leptin Reeptor Signaling Hu Huang 1, Dong Kong 1, Kyung Hee Byun 2, Chianping Ye 1, Shuihi Koda 1, Dae Ho Lee 1, Byung-Chul Oh 2, Sam W Lee 3,
Supplementary Figure 1
8w Pia II/III IV V VI PV EYFP EYFP PV EYFP PV d PV EYFP Supplementary Figure a Spike probability x - PV-Cre d Spike probability x - RS RS b e Spike probability Spike probability.6......8..... FS FS c f
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12024 entary Figure 1. Distribution of the number of earned cocaine Supplementary Figure 1. Distribution of the number of earned cocaine infusions in Shock-sensitive
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay. Nucleotide sequence
Supplemental Table 1. Primers used for real-time quantitative RT-PCR assay Name FoxO1 forward FoxO1 reverse GK forward GK reverse INS-1 forward INS-1 reverse INS-2 forward INS-2 reverse Glut2 forward Glut2
Supplemental Figure 1
A C E Supplemental Figure 1 AP 1mm A+C 1mm Apo 1mm B D 1mm CGS F 1mm All 1mm Supplemental Figure 1. The locations of microinfusion cannulae. Each dot represents the cannula tip of a given rat in Figure.
Nature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
Regulation of spike timing in visual cortical circuits
Regulation of spike timing in visual ortial iruits Paul Tiesinga*, Jean-Mar Fellous and Terrene J. Sejnowski Abstrat A train of ation potentials (a spike train) an arry information in both the average
Supplementary Information
Supplementary Information D-Serine regulates cerebellar LTD and motor coordination through the 2 glutamate receptor Wataru Kakegawa, Yurika Miyoshi, Kenji Hamase, Shinji Matsuda, Keiko Matsuda, Kazuhisa
LETTER. Synaptic potentiation onto habenula neurons in the learned helplessness model of depression
doi:.38/nature974 Synapti potentiation onto habenula neurons in the learned helplessness model of depression Bo Li,, Joaquin Piriz, Martine Mirrione,3, ChiHye Chung, Christophe D. Proulx, Daniela Shulz
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission
Supplementary Materials for VAMP4 directs synaptic vesicles to a pool that selectively maintains asynchronous neurotransmission Jesica Raingo, Mikhail Khvotchev, Pei Liu, Frederic Darios, Ying C. Li, Denise
Opening and Closing Transitions for BK Channels Often Occur in Two
72 Biophysial Journal Volume 65 August 1993 72-714 Opening and Closing Transitions for BK Channels Often Our in Two Steps via Sojourns through a Brief ifetime Subondutane State William B. Ferguson, Owen
1.0. FSL NMDAR-fEPSP 0.8. amplitude (mv) Intensity (µa) 2.0 SD FSL Time (ms)
a 2.5 1. AMPAR-fEPSP slope (mv/ms) 2. 1. NMDAR-fEPSP amplitude (mv).8.6.4.5.2. 2 4 6 8. 1 2 3 4 5 Intensity (µa) Intensity (µa) b 2. PPF Ratio (fepsp2/fepsp1) 1..5. 5 1 2 5 Time (ms) Supplementary Figure
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol.
Supplementary Figures 1-11 Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol. (a), Voltage-clamp recordings from CA1 pyramidal neurons
Original Articles. Experimental disciform edema and necrotizing keratitis in the rabbit. Joseph F. Metcalf, James I. McNeill, and Herbert E.
Original Artiles Experimental disiform edema and nerotizing keratitis in the rabbit Joseph F. Metalf, James I. MNeill, and Herbert E. Kaufman The development of experimental disiform edema and nerotizing
Dopamine in Ube3a m-/p+ mice. Online Supplemental Material
Online Supplemental Material S1 Supplemental Figure 1. Schematic of rate-dependent intracranial self-stimulation (ICSS) (A) Mice implanted with monopolar stimulating electrodes to the medial forebrain
Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.
Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates
Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke
SUPPLEMENTARY INFORMATION doi:10.1038/nature09511 Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke Pre Post 7-days Systolic Diastolic BPM Systolic Diastolic BPM Systolic
affecting conductance
Pro. Nati. Aad. Si. USA Vol. 81, pp. 2929-2933, May 1984 Neurobiology Halothane shortens aetylholine reeptor hannel kinetis without affeting ondutane (general anesthetis/path lamp/myoytes/ell ulture) JAMES
Lack of GPR88 enhances medium spiny neuron activity and alters. motor- and cue- dependent behaviors
Lack of GPR88 enhances medium spiny neuron activity and alters motor- and cue- dependent behaviors Albert Quintana, Elisenda Sanz, Wengang Wang, Granville P. Storey, Ali D. Güler Matthew J. Wanat, Bryan
Supplementary Figure 1. Basic properties of compound EPSPs at
Supplementary Figure 1. Basic properties of compound EPSPs at hippocampal CA3 CA3 cell synapses. (a) EPSPs were evoked by extracellular stimulation of the recurrent collaterals and pharmacologically isolated
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Mineral Oil Application Experiments: Reducing Current Season PVY
Mineral Oil Appliation Experiments: Reduing Current Season PVY Prinipal Investigator(s). Russell L. Groves, Assistant Professor and Entomology Extension Speialist, Department of Entomology, 537 Russell
Supplementary Figure 1. Microdialysis measurements of extracellular dopamine in ventral and dorsal striatum.
Supplementary Figure 1 Microdialysis measurements of extracellular dopamine in ventral and dorsal striatum. A. Behavioural preparation. Mice are placed in an operant box where a spout containing the artificial
Ube3a is required for experience-dependent maturation of the neocortex
Ube3a is required for experience-dependent maturation of the neocortex Koji Yashiro, Thorfinn T. Riday, Kathryn H. Condon, Adam C. Roberts, Danilo R. Bernardo, Rohit Prakash, Richard J. Weinberg, Michael
Granulocytosis and Lymphocytopenia in the Blood as Indicators for Drug Adverse Reaction during Calcitonin
Ata Media et Biologia Vol. 44, No.4, 209-213, 1996 Granuloytosis and Lymphoytopenia in the Blood as Indiators for Drug Adverse Reation during Calitonin Therapy in Patients with Osteoporosis after Gastretomy
100 osimertinib. concentration of drugs (nm) Ba/F3 C797S/del19. concentration of drugs (nm) Ba/F3 C797S/T790M/L858R. relative cell vaibility (% of
Ba/F3 del19 Ba/F3 L858R a afatini afatini EGF-816 EGF-816 ty (% of ontrol) relative ell vaiilit elative ell vaiility (% of ontrol) 5 1 1 5 ty (% of ontrol) relative ell vaiilit 5 1 1 Ba/F3 T79M/L858R Ba/F3
Light-evoked hyperpolarization and silencing of neurons by conjugated polymers
Light-evoked hyperpolarization and silencing of neurons by conjugated polymers Paul Feyen 1,, Elisabetta Colombo 1,2,, Duco Endeman 1, Mattia Nova 1, Lucia Laudato 2, Nicola Martino 2,3, Maria Rosa Antognazza
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
Reversal of ammonia coma in rats by L-dopa: a peripheral effect
Gut, 1979, 2, 28-32 Reversal of ammonia oma in rats by L-dopa: a peripheral effet L. ZV1, W. M. DOZAK, AND R. F. DRR From the Department of Mediine, Hennepin ounty Medial enter and Minneapolis Veterans
Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu
Distinct contributions of Na v 1.6 and Na v 1.2 in action potential initiation and backpropagation Wenqin Hu, Cuiping Tian, Tun Li, Mingpo Yang, Han Hou & Yousheng Shu Supplementary figure and legend Supplementary
Supporting Information
Supporting Information Gerasimenko et al..73/pnas.39 SI Materials and Methods Reagents used in this study include Fluo-4/Fura- (Invitrogen), thapsigargin (albiochem), collagenase (Worthington), palmitoleic
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Closed-loop optogenetic control of thalamus as a tool for interrupting seizures after cortical injury
a r t i l e s Closed-loop optogeneti ontrol of thalamus as a tool for interrupting seizures after ortial injury Jeanne T Paz 1, Thomas J Davidson 2, Eri S Frehette 1, Bruno Delord 3, Isael Parada 1, Kathy
Nature Neuroscience doi: /nn Supplementary Figure 1. Characterization of viral injections.
Supplementary Figure 1 Characterization of viral injections. (a) Dorsal view of a mouse brain (dashed white outline) after receiving a large, unilateral thalamic injection (~100 nl); demonstrating that
CHOLINERGIC ACTION IN THE NUCLEUS ACCUMBENS: MODULATION OF DOPAMINE AND ACETYLCHOLINE RELEASE
Br. J. Pharma. (1982), 75, 359-365 CHOLINERGIC ACTION IN THE NUCLEUS ACCUMBENS: MODULATION OF DOPAMINE AND ACETYLCHOLINE RELEASE J.S. de BELLEROCHE & I.M. GARDINER Departments of Neurology and Biohemistry,
Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell
2 Supplementary Figure 1. ACE robotic platform. A. Overview of the rig setup showing major hardware components of ACE (Automatic single Cell Experimenter) including the MultiClamp 700B, Digidata 1440A,
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
Nature Neuroscience: doi: /nn Supplementary Figure 1. Distribution of starter cells for RV-mediated retrograde tracing.
Supplementary Figure 1 Distribution of starter cells for RV-mediated retrograde tracing. Parcellation of cortical areas is based on Allen Mouse Brain Atlas and drawn to scale. Thick white curves, outlines
The comparison of psychological evaluation between military aircraft noise and civil aircraft noise
The omparison of psyhologial evaluation between military airraft noise and ivil airraft noise Makoto MORINAGA ; Ippei YAMAMOTO ; Hidebumi TSUKIOKA ; Koihi MAKINO 2, Sonoko KUWANO 3, Mitsuo MATSUMOTO 4
SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,
Methylglyoxal modification of Na v 1.8 facilitates nociceptive neuron firing and causes hyperalgesia in diabetic neuropathy
A r t i l e s Methylglyoxal modifiation of Na v 1.8 failitates noieptive neuron firing and auses hyperalgesia in diabeti neuropathy Angelika Bierhaus 1,2, Thomas Fleming 1,2, Stoyan Stoyanov 1, Andreas
Supplemental Information. Memory-Relevant Mushroom Body. Output Synapses Are Cholinergic
Neuron, Volume 89 Supplemental Information Memory-Relevant Mushroom Body Output Synapses Are Cholinergic Oliver Barnstedt, David Owald, Johannes Felsenberg, Ruth Brain, John-Paul Moszynski, Clifford B.
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
-51mV 30s 3mV. n=14 n=4 p=0.4. Depolarization (mv) 3
Supplementary Figure 1 a optoβ 2 -AR b ChR2-51mV 30s 3mV -50mV 30s 3mV c 4 n=14 n=4 p=0.4 Depolarization (mv) 3 2 1 0 Both optogenetic actuators, optoβ 2 AR and ChR2, were effective in stimulating astrocytes
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in