TRPM8 in the negative regulation of TNFα expression during cold stress
|
|
|
- Jemimah Richard
- 5 years ago
- Views:
Transcription
1 in the negative regulation of TNFα expression during cold stress Xin-Pei Wang 1, Xuan Yu 1, Xiao-Jin Yan 1, Fan Lei 2, Yu-Shuang Chai 1, Jing-Fei Jiang 1, Zhi- Yi Yuan 1, Dong-Ming Xing 1, Li-Jun Du 1* 1 MOE Key Laboratory of Protein Sciences, Laboratory of Molecular Pharmacology and Pharmaceutical Sciences, School of Life Sciences, Tsinghua University, Beijing , China 2 School of Pharmacology and Pharmaceutical Sciences, Tsinghua University, Beijing , China Equal in contribution * Correspondence should be addressed to MOE Key Laboratory of Protein Sciences, Laboratory of Molecular Pharmacology and Pharmaceutical Sciences School of Life Sciences Tsinghua University, Beijing , China Tel: lijundu@mail.tsinghua.edu.cn Supplementary information includes: Supplementary Figure S1-S11, Table S1 and S2.
2 Supplementary information Figure S1 Figure S1. Comparison of the mrna expressions of, TRPA1, TNFα and of PC12 cells in between 20 C and 4 C conditions. Data are shown as the mean ± S.D. from three independent experiments. *, P < 0.05; **, P < 0.01.
3 Figure S C TNFα 30 C Control Model Control Model Control Model TNFα 20 C Control Model Control Model Control Model TNFα * * * 4 C Control Model Control Model Control Model TNFα Control Model Control Model Control Model Figure S2. The mrna expressions of, and TNFα in PC12 cells under different temperature in vitro. Control: 37 C. Model: Cold conditions. Data are shown as the mean ± S.D. from three independent experiments. *, P < 0.05; **, P < 0.01.
4 Figure S3 Figure S3. The mrna expressions of, HSP70, and TNFα in heat stress (40 C) both in vivo and in vitro. Data are shown as the mean ± S.D. from five mice in each group in vivo and three independent experiments in vitro. *, P < 0.05; **, P < 0.01.
5 Figure S4 Figure S4. Effect of Trpm8siRNA and Trpa1siRNA (sirna) on the mrna expressions of, TRPA1, TNFα and in PC12 cells in normal conditions (37 C). (A) - (D): Trpm8siRNA. (E) - (H): Trpa1siRNA. Data are shown as the mean ± S.D. from three independent experiments. *, P < 0.05; **, P < 0.01.
6 Figure S5 Figure S5. Effect of Trpm8siRNA (sirna) on the mrna expressions of, TRPA1, TNFα and in PC12 cells in cold conditions (4 C). Data are shown as the mean ± S.D. from three independent experiments. **, P < 0.01.
7 Figure S6 Figure S6. Effect of menthol on the mrna expressions of, TRPA1, TNFα and in PC12 cells. Data are shown as the mean ± S.D. from three independent experiments. #, P < 0.05; ##, P < 0.01.
8 Figure S7 Figure S7. The mrna expressions of, and TNFα in ischemia and reperfusion stress under normal conditions (in vivo: room temperature, in vitro: 37 C). Con represents control, Mod means model. CIR: cerebral ischemia and reperfusion, OGD: oxygen and glucose deprivation. Data are shown as the mean ± S.D. from five mice in each group in vivo and three independent experiments in vitro. *, P < 0.05; **, P < 0.01.
9 Figure S8 Figure S8. The mrna expressions of, HSP70, and TNFα under cold stress (4 C) both in vivo and in vitro. Data are shown as the mean ± S.D. from five mice in each group in vivo and three independent experiments in vitro. *, P < 0.05; **, P < 0.01.
10 Figure S9 TRPA1 TNFα Lane1: Marker Lane2 5: TRPA1 (0 3h / 4 C) Lane1: Marker Lane2 5: TNFα (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Figure S9. Original blots of cropped western blots of Figure 1. The expression levels of, TRPA1, and TNFα in mouse brains under cold conditions.
11 Figure S10 TRPA1 Lane1: Positive control Lane2 5: (0 3h / 4 C) Lane1: Positive control Lane2 5: TRPA1 (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane5: Positive control Lane1 4: (0 3h / 4 C) Lane5: Positive control TNFα Lane1 4: TNFα (0 3h / 4 C) Figure S10. Original blots of cropped western blots of Figure 2. Expression of, TRPA1, and TNFα in PC12 cells under cold conditions.
12 Figure S11 TRPA1 Lane1 4: TRPA1 (0 3h / 4 C) Lane5: Empty Lane1 4: (0 3h / 4 C) TNFα Lane1 4: TNFα (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Lane1 4: (0 3h / 4 C) Figure S11. Original blots of cropped western blots of Figure 3. Expression of, TRPA1, and TNFα in PC12 cells with Trpm8 knockdown under cold conditions.
13 Figure S12 IP: (WT) Lane1: Positive control Lane2: Input (0h) Lane3: Input (3h) Lane4: Marker Lane5: IP (0h) Lane6: IP (3h) Lane1: Input (0h) Lane2: Input (3h) Heavy Chain (Input) Lane1: Positive control Lane1: Input (0h) Lane2: Input (3h) (IP) Lane1: IP (0h) Lane2: IP (3h) IP: (WT) Lane1: Input (0h) Lane2: Input (3h) Lane4: Marker Lane3: IP (0h) Lane4: IP (3h) Lane1: IP (0h) Lane2: IP (3h) Lane1: Input (0h) Lane2: Input (3h) Lane1: Input (0h) Lane2: Input (3h) Lane3: Positive control IP: (KD) (Input) Lane1: Positive control Lane2: Input (0h) Lane3: Input (3h) Lane4: Marker (Input) Lane1: Positive control Lane2: Input (0h) Lane3: Input (3h) (IP) Lane1: IP (0h) Lane2: IP (3h) Lane3: Marker Lane4: Input (0h) Lane5: Input (3h) Lane6: Positive control (IP) (Input) Lane1: IP (0h) Lane2: IP (3h) IP: (KD) (IP) Heavy Chain Lane1: Marker Lane2: IP (0h) Lane3: IP (3h) (input) Lane1: Input (0h) Lane2: Input (3h) Lane1: Input (0h) Lane2: Input (3h) Lane3: Marker Lane4: IP (0h) Lane5: IP (3h) Lane1: IP (0h) Lane2: IP (3h) Lane3: positive control Figure S12. Original blots of cropped western blots of Figure 5. Co-immunoprecipitation (CoIP) of endogenous and using antibodies and reverse CoIP performed with antibodies in PC12 (WT) and (KD) respectively.
14 Figure S13 WT C- N- Lane1 4: in Cytoplasm (0 3 h/ 4 C) Lane5: Marker Lane6 9: in Nucleus (0 3 h/ 4 C) Lane1 4: (0 3 h/ 4 C) KD C- Lane1 4: in Cytoplasm (0 3 h/ 4 C) N- Lane1 4: in Nucleus (0 3 h/ 4 C) Lane1 4: (0 3 h/ 4 C) Figure S13. Original blots of cropped western blots of Figure 6. Protein expression of in PC12 cells under cold conditions (4 ºC).
15 Figure S14 TNFα Lane1: Normal Lane2: Normal+Cooling Lane3: CIR Model Lane4: CIR+Cooling Figure S14. Original blots of cropped western blots of Figure 7. Protein expression of and TNFα in mouse brain with cerebral ischemia-reperfusion (CIR)..
16 Table S1 Table S1 Primer for mouse Gene Sense Anti-sense TATGAGACCCGAGCAGTGGA CAGGCTGAGCGATGAAATGC TRPA1 GTCCAGGGCGTTGTCTATCG CGTGATGCAGAGGACAGAGAT GGAGGCATGTTCGGTAGTGG CCCTGCGTTGGATTTCGTG TNFα CCCTCACACTCAGATCATCTTCT GCTACGACGTGGGCTACAG AGGCCACACAAATAGGGTCC TTGTGGACACTGCCCCATTC
17 Table S2 Table S2 Primer for PC12 cells (rat) Gene Sense Anti-sense TCATACCCACCTGCTGCTTG CCTGGGCAAAACACACGATG TRPA1 GCAGCATTTTCAGGTGCCAA CGCTGTCCAGGCACATCTTA CGCCTGAGACCCGAGACAAG CTGCCTCCTGCTCCACTGAC TNFα CTCCAGCTGGAAGACTCCTCCCAG CCCGACTACGTGCTCCTCACC CCGTAAAGACCTCTATGCCAACA CGGACTCATCGTACTCCTGCTT
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced
Astragaloside IV ameliorates 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis implicating regulation of energy metabolism Xu-Guang Jiang 1,2,, Kai Sun 1,3,4,5,, Yu-Ying Liu 1,4,5, Li Yan 1,4,5,
Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects identifies susceptibility loci at PLCE1 and C20orf54
CORRECTION NOTICE Nat. Genet. 42, 759 763 (2010); published online 22 August 2010; corrected online 27 August 2014 Genome-wide association study of esophageal squamous cell carcinoma in Chinese subjects
Canqiu Yu 1, Jinwei Chen 2, Li Huang 3*
A STUDY ON THE ANTITUMOUR EFFECT OF TOTAL FLAVONOIDS FROM PTERIS MULTIFIDA POIR IN H22 TUMOUR-BEARING MICE 459 Canqiu Yu 1, Jinwei Chen 2, Li Huang 3* 1 Department of General Surgery, The Second Xiangya
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer
An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Researches on Fermentation Engineering of Polysaccharide of
13 1 Vol13 No1 1 2009 2 Life Science Research Feb 2009 1a 1b, 2, 1 416000 2 416000 3 410300 : (Cordyceps militaris), :, 6% 1% 25, ; 6% 1% 22, : ; ; ; ; ; : TQ92 : A : 1007-7847(2009)01-0065-06 Researches
Supplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Supporting Information
Supporting Information Natural small molecule FMHM inhibits lipopolysaccharide-induced inflammatory response by promoting TRAF6 degradation via K48-linked polyubiquitination Ke-Wu Zeng 1, Li-Xi Liao 1,
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt
Supplementary Information CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Jae Hyang Lim, Hirofumi Jono, Kensei Komatsu, Chang-Hoon Woo, Jiyun Lee, Masanori Miyata,
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
EMPEROR'S COLLEGE MTOM COURSE SYLLABUS HERB FORMULAE II
COURSE DESCRIPTION The second of three courses in the Herb Formulae series. Categories covered in Formulae II include the Tonify Qi and Blood, Regulate Qi, Invigorate the Blood, Stop Bleeding, Stabilize
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table
Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
Targeted disruption of influenza A virus hemagglutinin in genetically modified. mice reduces viral replication and improves disease outcome
Supplementary Information Targeted disruption of influenza A virus hemagglutinin in genetically modified mice reduces viral replication and improves disease outcome Song Wang 1#, Chao Chen 1#, Zhou Yang
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Summary of Chapter 44 of the Líng Shū
Summary of Chapter 44 of the Líng Shū Shùn Qì Yī Rì Fēn Wéi Sì Shí The Human Healthy Energy in the Day and Night Corresponds with the Energies of the Four Seasons Paragraph 1 The initiation of the various
Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination
Yoon et al, page Scaffold function of long noncoding RNA HOTAIR in protein ubiquitination Je-Hyun Yoon,, Kotb Abdelmohsen, Jiyoung Kim, Xiaoling Yang, Jennifer L. Martindale, Kumiko Tominaga-Yamanaka,
Liu Jing and Liu Jing Diagnosis System in Classical TCM Discussions of Six Divisions or Six Confirmations Diagnosis System in Classical TCM Texts
Liu Jing and Liu Jing Diagnosis System in Classical TCM Discussions of Six Divisions or Six Confirmations Diagnosis System in Classical TCM Texts Liu Jing Bian Zheng system had developed about 1800 years
Effect of EGCG in combination with gemcitabine on β-catenin expression in PANC-1 human pancreatic cancer cells * Research Article
Gene Therapy and Molecular Biology Vol 15, page 159 Gene Ther Mol Biol Vol 15, 159-163, 2013 Effect of EGCG in combination with gemcitabine on β-catenin expression in PANC-1 human pancreatic cancer cells
The clathrin adaptor Numb regulates intestinal cholesterol. absorption through dynamic interaction with NPC1L1
The clathrin adaptor Numb regulates intestinal cholesterol absorption through dynamic interaction with NPC1L1 Pei-Shan Li 1, Zhen-Yan Fu 1,2, Ying-Yu Zhang 1, Jin-Hui Zhang 1, Chen-Qi Xu 1, Yi-Tong Ma
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
Next-generation sequencing-based molecular diagnosis of neonatal hypotonia in Chinese
Title page Next-generation sequencing-based molecular diagnosis of neonatal hypotonia in Chinese Population Yan Wang 1, #,Wei peng 1,#, Hong-Yan Guo 3,4, Hui Li 3,4, Jie Tian 3,4, Yu-Jing Shi 3,4, Xiao
Diagnostic Accuracy of Intracellular Mycobacterium. tuberculosis Detection for Tuberculous Meningitis
Diagnostic Accuracy of Intracellular Mycobacterium tuberculosis Detection for Tuberculous Meningitis Running title: Laboratory diagnosis of tuberculous Guo-Dong Feng (MD PhD);Ming Shi(MD PhD); Lei Ma(MD
Phase IV clinical trial of Shufeng Jiedu Capsule in the treatment of cases of acute upper espiratory infection of wind-heat syndrome
tp tp Phase IV clinical trial of Shufeng Jiedu Capsule in the treatment of 2 031 cases of acute upper espiratory infection of wind-heat syndrome XU Yan-ling 1, ZHANG Hui-hong 2, XUE Yun-li 2, YANG Jing-sheng
Letter to the Editor. Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes *
814 Biomed Environ Sci, 2016; 29(11): 814-817 Letter to the Editor Association of TCF7L2 and GCG Gene Variants with Insulin Secretion, Insulin Resistance, and Obesity in New-onset Diabetes * ZHANG Lu 1,^,
Supporting information
Supporting information Structural modification of natural product ganomycin I leading to discovery of a potent α-glucosidase and HMG-CoA reductase dual inhibitor improving obesity and metabolic dysfunction
A Facile Method for Enhancing the Sensing Performance of Zinc Oxide. Nanofibers Gas Sensors
Electronic Supplementary Information (ESI): A Facile Method for Enhancing the Sensing Performance of Zinc Oxide Nanofibers Gas Sensors Pei-Pei Wang a, Qi Qi a, Rui-Fei Xuan a,b, Jun Zhao a, Li-Jing Zhou
An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb222 / b. WB anti- WB anti- ulin Mitotic index (%) 14 1 6 2 T (h) 32 48-1 1 2 3 4 6-1 4 16 22 28 3 33 e. 6 4 2 Time (min) 1-6- 11-1 > 1 % cells Figure S1 depletion leads to mitotic defects
Supplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
Appropriate Quality regarde as
A systematic review of antibiotic prescription associated with upper respiratory tract infections in China (Jing Li, MS 1 ) Supplemental Digital Content-Table 1. Quality assessment of included studies
AVINASH CHANDRA, MD. September 16 th, Business Address: Buffalo Neuroimaging Analysis Center
AVINASH CHANDRA, MD September 16 th, 2014 Title: MRI Fellow Business Address: Buffalo Neuroimaging Analysis Center 100 High Street; Buffalo, NY 14203 Work: 716 859 7040 Email: achandra@bnac.net Education
TCM Ideology and Methodology
Journal of Traditional Chinese Medicine, June 2011; 31(2): 147-151 147 TCM Ideology and Methodology The TCM Pattern of the Six-Zang and Six-Fu Organs Can Be Simplified into the Pattern of Five-Zang and
Bioinformatics Analysis on Molecular Mechanism of Poria Cocos in Treatment of Jaundice
International Conference on Computer Engineering, Information Science & Application Technology (ICCIA 2016) Bioinformatics Analysis on Molecular Mechanism of Poria Cocos in Treatment of Jaundice Shan Si1,
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Rapid Detection of Milk Protein based on Proteolysis Catalyzed by Trypsinase
Rapid Detection of Milk Protein based on Proteolysis Catalyzed by Trypsinase Yafeng Chen Institute of Food Quality and Safety, University of Shanghai for Science and Technology Shanghai 93, China Email:cyfxy498@6.com
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan
Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
CORRELATION BETWEEN SURVIVIN OVEREXPRESSION AND CLINICO-PATHOLOGICAL FEATURES OF INVASIVE CERVICAL CANCER: A META-ANALYSIS
Acta Medica Mediterranea, 2018, 34: 1091 CORRELATION BETWEEN SURVIVIN OVEREXPRESSION AND CLINICO-PATHOLOGICAL FEATURES OF INVASIVE CERVICAL CANCER: A META-ANALYSIS HUI-RONG LI 1, JI-LI BAI 2*, RUI XU 2,
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Effect of a HFD on the Acox gene expression in the livers of WT and IL-6 -/- mice. Expression of Acox in the livers of WT and IL-6 -/- mice fed STD or HFD determined through
Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429
Influence of c-src on Hypoxic Resistance to Paclitaxel in Human Ovarian Cancer Cells and Reversal of FV-429 Qinglong Guo 1a, Lu Lu 1a, Yan Liao a, Xiaoping Wang a, Yi Zhang a, Yicheng Liu a, Shaoliang
m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
Chinese Journal of Experimental Traditional Medical Formulae 14 ~ ~ 20 P < 0. 05
21 8 1 2 1 1 1 1 1 1* 1. 100029 2. 100700 SHR 14 ~ 18 14 SHR 55 SHR WKY ELISA 4 6 5-5-HT Ⅱ ANGⅡ NE 14 ~ 20 P < 0. 05 5-HT ANGⅡ NE 4 6 P < 0. 05 14 ~ 18 5-HT ANGⅡ NE 14 ~ 18 SHR 5-HT ANGⅡ NE R285. 5 doi
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
Title: Expression of AE1/p16 promoted degradation of AE2 in gastric cancer cells
Author s response to reviews Title: Expression of AE1/p16 promoted degradation of AE2 in gastric cancer cells Authors: Guo-Hui Fu (fuguhu@263.net) Ting Wang (wangting_tina@126.com) Hong-Jun Fei (feihongjun1@126.com)
ACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility. in mice
Deletion of tyrosine phosphatase Shp2 in Sertoli cells causes infertility in mice Xiaopeng Hu 1 *, Zhenzhou Tang 1,2 *, Yang Li 2 *, Wensheng Liu 2, Shuang Zhang 3, Bingyan Wang 3, Yingpu Tian 2, Yinan
Cell Death in Biology and Diseases
Cell Death in Biology and Diseases Series Editors Xiao-Ming Yin Zheng Dong More information about this series at http://www.springer.com/series/8908 Wen-Xing Ding Xiao-Ming Yin Editors Cellular Injury
Supplemental Fig. 1. Relative mrna Expression. Relative mrna Expression WT KO WT KO RT 4 0 C
Supplemental Fig. 1 A 1.5 1..5 Hdac11 (ibat) n=4 n=4 n=4 n=4 n=4 n=4 n=4 n=4 WT KO WT KO WT KO WT KO RT 4 C RT 4 C Supplemental Figure 1. Hdac11 mrna is undetectable in KO adipose tissue. Quantitative
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
CURRICULUM VITAE. Professional Employment and Teaching Experience:
CURRICULUM VITAE Name: Current Address: Hong Chen American Academy of Acupuncture and Oriental Medicine 1925 West County Road B2 Roseville, MN 55113 Tel: (651) 631-0204 Fax: (651) 631-0361 E-mail: hongyu1229@hotmail.com
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
Effect of Ginkgo biloba leaf extract on electroencephalography of rat with cerebral ischemia and reperfusion
157 2003, Acta Pharmacologica Sinica Chinese Pharmacological Society Shanghai Institute of Materia Medica Chinese Academy of Sciences http://www.chinaphar.com Effect of Ginkgo biloba leaf extract on electroencephalography
ACTA PHYSIOLOGICA SINICA
Acta Physiologica Sinica, Volume 63, Contents (1 6) 619 ACTA PHYSIOLOGICA SINICA (Continuing The Chinese Journal of Physiology Started in 1927) VOLUME 63 CONTENTS (1 6) No. 1 INVITED REVIEW Neuronal signaling
Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans
Serum mirna signature diagnoses and discriminates murine colitis subtypes and predicts ulcerative colitis in humans Emilie Viennois 1*, Yuan Zhao 1, 2, Moon Kwon Han 1, Bo Xiao 1, 3, Mingzhen Zhang 1,
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Root & Branch Bulk Formula List
An asterisk * indicates the inclusion of 1 or more granule versions of an herb because of limited availability on the American herbal market. These products are usually animal in nature like E Jiao, Shui
Supplementary Information
Supplementary Information HBV maintains electrostatic homeostasis by modulating negative charges from phosphoserine and encapsidated nucleic acids Authors: Pei-Yi Su 1,2,3, Ching-Jen Yang 2, Tien-Hua Chu
Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via. Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid.
Title Page Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid Metabolism Zhang-Hong Ke 1, *, Jie-Xue Pan 1,4, *, Lu-Yang
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis. is mediated by SOCS3 regulatory pathway
Therapeutic effect of baicalin on experimental autoimmune encephalomyelitis is mediated by SOCS3 regulatory pathway Yuan Zhang 1,2, Xing Li 1,2, Bogoljub Ciric 1, Cun-gen Ma 3, Bruno Gran 4, Abdolmohamad
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Low toxicity and accumulation of zinc oxide nanoparticles in mice
Electronic Supplementary Material (ESI) for Toxicology Research. This journal is The Royal Society of Chemistry 2016 Low toxicity and accumulation of zinc oxide nanoparticles in mice after 270-day consecutive
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Integrative network analysis: Bridging the gap between Western medicine and traditional Chinese medicine
Hong Kong Baptist University HKBU Institutional Repository HKBU Staff Publication 2015 Integrative network analysis: Bridging the gap between Western medicine and traditional Chinese medicine Bing He Hong
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
SPIE Student Chapter Report Annual report
SPIE Student Chapter Report 2016 Annual report SPIE Student Club Shanghai Institute of Optics and Fine Mechanics October 02, 2016 Shanghai Institute of Optics and Fine Mechanics Chinese Academy of Mechanics
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity
Manuscript EMBO-2010-76298 Myelin suppresses axon regeneration by PIR-B/SHPmediated inhibition of Trk activity Yuki Fujita, Shota Endo, Toshiyuki Takai and Toshihide Yamashita Corresponding author: Toshihide
Effect of Chronic Aluminum Exposure on PKC, CaMK and Neurogranin in Hippocampus of Rat
ISSN 100727626 CN 1123870ΠQ 2007 5 Chinese Journal of Biochemistry and Molecular Biology 23 (5) :410 414 PKC CaMK Ng 3,,,,,, (, 110001) (long2term potentiation, LTP) C (protein kinase c, PKC) Ca 2 + 2
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic
Supplementary Figure 1. mir124 does not change neuron morphology and synaptic density. Hippocampal neurons were transfected with mir124 (containing DsRed) or DsRed as a control. 2 d after transfection,
Joint Department of Biomedical Engineering
Electronic Supplementary Material (ESI) for Biomaterials Science. This journal is The Royal Society of Chemistry 2018 Supplementary Data Systemic Delivery of CRISPR/Cas9 with PEG-PLGA Nanoparticles for
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Used for exterior conditions such as common colds, fevers, and flu s. Many of these formulas induce sweating. This category can be subdivided into
Section 1 Used for exterior conditions such as common colds, fevers, and flu s. Many of these formulas induce sweating. This category can be subdivided into formulas the release cold or heat. Traditionally