Supplementary Materials for
|
|
- Elmer Shelton
- 6 years ago
- Views:
Transcription
1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice Yuka Morikawa, Min Zhang, Todd Heallen, John Leach, Ge Tao, Yang Xiao, Yan Bai, Wei Li, James T. Willerson, James F. Martin* The PDF file includes: *Corresponding author. Published 5 May 2015, Sci. Signal. 8, ra41 (2015) DOI: /scisignal Fig. S1. Microarray and Yap ChIP-Seq reproducibility. Fig. S2. Yap target genes are enriched in the fetal heart. Fig. S3. Yap/Tead regulatory elements are enriched in fetal heart DHS and Yap binding peaks. Fig. S4. Analysis of cell fusion in hearts 21 days after myocardial infarction. Fig. S5. Evaluation of cardiomyocyte size in Hippo-deficient hearts. Fig. S6. Cardiomyocyte protrusions in Hippo-deficient hearts. Fig. S7. Collagen gel migration assay with mitomycin C treatment. Fig. S8. Western blot analysis to quantitate sarcoglycan and syntrophin 1. Fig. S9. Scar formation in the apex resection model in mdx hearts. Fig. S10. Cardiomyocyte proliferation in the mdx apex-resected heart. Table S1. List of primers used to amplify enhancer elements and location of the Tead motif deletion.
2 Figure S1. Microarray and Yap ChIP-Seq reproducibility. Microarray was performed on P8 control and Salv CKO mouse hearts (2 biological replicates per group). Each sample has 3 technical controls. (A) Histograms show the distribution of log-transformed raw signal values which are approximate to a normal distribution. The red dotted lines indicate the mean value. (B) Quantile-Quantile plot of log2 (raw signal value) from control and Salv CKO samples. The x-axes show quantile values of standard normal distribution. The y-axes show quantile value of log-transformed signal value. (C, D) Reproducibility of microarray raw signal value in control and Salv CKO samples. Biological replicates were plotted as x-axis and y-axis values individually. Linear correlation coefficients were measured, and r is given in each diagram. The blue lines indicate the line of best fit. (E) Boxplots show that there were no significant outliers among the samples. (F) Differentially expressed genes in control and Salv CKO samples. Individual genes were plotted by using log of fold-change as the x-axis and -log10 of the p- value as the y-axis index. The differential expression threshold was fold change of at least 1.5 and P- value of at least 0.05, highlighted in blue. (G) Reproducibility of Yap ChIP-Seq (2 biological replicates). Signal intensities were measured over input sample in 5 kb bins. Pearson's correlation coefficient was calculated based on the basis of log-transformed values.
3 Figure S2. Yap target genes are enriched in the fetal heart. (A) Heat map of Yap target gene expression in human fetal and adult ventricle (N=2 biological replicates for each). The color bar represents relative expression of log-transformed value for each gene across different samples. (B) Yap target gene orthologs are more highly expressed in human fetal hearts than in adult hearts. Gene expression was measured in RPKM by using RNA-Seq profiling data. N=2 independent biological replicates. (C, D) Gene ontology analysis for genes enriched in fetal (C) (total number of genes = 700) and adult hearts (D) (total number of genes = 417). X-axes indicate Z-score of over-representation statistics; y-axes indicate percentage of gene overlay with differentially expressed genes from Salv CKO hearts. (E) Target gene expression in postnatal day 4 neonatal rat cardiomyocytes transduced with lacz or YAP1 (S127A) expressing adenovirus. Data was extracted from GSE33019, N=4 biological replicates per group. ** false discovery rate (fdr) < 0.01; * fdr < 0.05.
4 Figure S3. Yap/Tead regulatory elements are enriched in fetal heart DHS and Yap binding peaks. (A) Matched motifs in human fetal heart DHS-Seq peaks (N=11 biological replicates). Human fetal heart-specific DHS peaks were compared to human adult heart DHS peaks (N=2 biological replicates). Enriched motifs represent fetal heart-specific DHS peaks. (B) The density of enriched motifs within a 500 bp range of human fetal heart DHS peaks are shown in comparison with that of human embryonic stem cell DHS peaks (grey). (C) Heat map of enriched motifs in DHS footprints from different adult tissues and fetal compared to adult comparison. The relative enrichment was measured by the number of footprints containing each motif. (D-F) Representative genome browser tracks of Yap targets in regions of genome that are not conserved between species. DHS-Seq peaks from human fetal (green) and adult (blue) hearts and Yap ChIP-Seq peaks from mouse P8 Salv CKO hearts (black) are shown. Fgd4 contains highly conserved Tead binding elements in the promoter region (D). In Crebbp (E) and Mad2l1 (F), fetal specific DHS peaks and Yap binding peaks are located in genomic regions that are not conserved between species (non-syntenic).
5 Figure S4. Analysis of cell fusion in hearts 21 days after myocardial infarction. Left anterior descending artery occlusion (LADO) was performed with Myh6-Cre Ert ; mtmg (control) and Myh6- Cre Ert ; Salv fx/fx ; mtmg (Salv CKO) mice and hearts were collected at 21 dpmi. Three hearts were tested for each genotype. Cardiomyocyte lineage was delineated with egfp by using GFP immunostaining and non-cardiomyocyte lineage was delineated with mtomato using dsred immunostaining. Arrow shows cell fusion of two lineages detected as a double positive staining. Bars=25 µm. Right panel shows quantification of double-positive cells. Approximately 15,000 cells were counted, n.s. not significant (Mann-Whitney U test).
6 Figure S5. Evaluation of cardiomyocyte size in Hippo-deficient hearts. Left anterior descending artery occlusion or sham surgery was performed with Myh6-Cre Ert ; mtmg (control) and Myh6-Cre Ert ; Salv fx/fx ; mtmg (Salv CKO) mice and hearts were collected at 4, 10, and 21 dpmi (N=3 mice for each genotype and time point; cells measured per sample). Cells were delineated with wheat germ agglutinin (WGA, plasma membrane marker) staining and cardiomyocytes were labeled with egfp. Cross-sectional area was measured in the transverse plane. Bars are 25 µm. Statistical significance was assessed with the Mann-Whitney U test. **P>0.001.
7 Figure S6. Cardiomyocyte protrusions in Hippo-deficient hearts. (A-F) Representative images of hearts 10 days post myocardial infarction from 8 week old mice (N=3 mice per genotype). Myh6-Cre Ert ; mtmg (control, A, D) and Myh6-Cre Ert ; Salv fx/fx ; mtmg (Salv CKO, B, C, E, F). GFP and ctnt staining revealed border zone cardiomyocyte morphology. Arrowheads show protruding cardiomyocytes. (Bars= 50 µm). (G-L) P8 apex resections 4 days post resection (N=3 mice per genotype). Myh6-Cre Ert ; mtmg (control, G, H, I) and Myh6-Cre Ert ; Salv fx/fx ; mtmg (Salv CKO, J, K, L) hearts stained for ctnt and showing GFP immunofluorescence (G, J) or stained for Vinculin (H, K). Merged images showing Vinculin staining and GFP immunofluorescence are also shown (I, L).
8 (Bars=50 µm, G, J). Arrows show cells with protrusions (J). (Bars=20 µm H, I, K, L). Arrowheads show Vinculin localization in cells with protrusions (K, L). Figure S7. Collagen gel migration assay with mitomycin C treatment. Representative images of migrating cells in control and Salv sirna-treated P19 cells either untreated or pre-treated with 10 µg/ ml mitomycin C. Cells were labeled with tubulin and DNA synthesis was monitored by EdU incorporation. Bars=100 µm. Right panel shows quantitation of migrated cells. n.s. (not significant); ***P<0.01 (Mann-Whitney U test). N=3 independent experiments analyzing approximately cells per group.
9 Figure S8. Western blot analysis to quantitate sarcoglycan and syntrophin 1. (A) Western blots for the remaining two hearts from Myh6-Cre Ert ; mtmg (control) and Myh6-Cre Ert ; Salv fx/fx ; mtmg (Salv CKO) P8 mice probed with anti-sgcd (N=3 hearts total). (B) Western blot analysis for syntrophin 1 control (N=3) and Salv CKO (N=3 hearts) P8 hearts. n.s. (not significant; non-parametric Mann Whitney).
10 Figure S9. Scar formation in apex resection model in mdx hearts. Hearts from B10 control (N=11 mice) and mdx-b10 animals (N=7 mice) were resected at P1 and collected at 21 dpr. Hearts were sectioned and Trichrome staining was performed. Panels show images of the two representative biological samples from control and mdx mice. Serial sections of the hearts are shown from anterior (left) to posterior (right). Arrow point to scar formation. Bars=500 µm.
11 Figure. S10. Cardiomyocyte proliferation in mdx apex-resected heart. B6/10 control and mdx-b6/10 hearts were resected at P1 and collected 4 days post resection. EdU was injected 4 hours before harvest. (A-D) EdU staining or border zone cardiomyocytes from B6/10 control (A) and mdx-b6/10 (B) mice at 4 days post resection. Arrowheads show protrusions. (Bars=50 µm). (C, D) Higher magnification images of boxed area in (A, B). (Bars=25 µm). (E, F) Aurora B kinase staining in the border zone from B6/10 control (E) and mdx-b6/10 (F) at 4 days post resection. (Bars=25 µm). (G) Quantitation of EdU positive cells (N=3 mice for each genotype) in border zone and distal area. *p<0.05, **p<0.01, remaining column comparisons n.s (Mann-Whitney U test). (H) Aurora B kinase quantitation in B6/10 control and mdx-b6/10 hearts (N=3 mice for each genotype). *p<0.05, remaining column comparisons n.s (Mann- Whitney U test).
12 Table S1. List of primers used to amplify enhancer elements and location of the TEAD motif deletion. Name Forward primer Reverse primer Size (bp) Deletion (TEAD motif) Actrt2 CACCGGATTTGTTCTGTCT CCCACAGCTTCTAC 3205 N/A CTCATTAC CATCAA Aurkb CACCCAAGAAGAGGGTA CTACATTCCTGGGC 1218 N/A _1 GAAAGGCTAAAG TAGGTACA Aurkb _2 CACCGAGAATGGCTCAGA AGGAGAAC CACAGTTCACAGAA CAATACTGATAC (GATTC), (GGAATG) Fmn2 CACCATTCGATCTAGTCT GGGATACATAAAG CCCATCTGCCCAAA CTTCTATC (AGGAAT) Park2 CACCCGTGATCTGGCAAC GAAACTGGCGCCTT 6106 N/A TCTAC CATATTTAC Pkp4 CACCGTAAGGTGTCATAG GGTTTGAGAGGGA 3503 N/A GCTAACAGAAA ACGCATAA Ctnna 3_1 CACCAGTAGGTTGGATTA TCTGCCTGAGC GGCAAGGTATAGA GTAAGGGCTTAG (CATTCCT) Ctnna CACCCAGGATTGGACAGT GATTCAACGCATCC 4153 N/A 3_2 Enah Lin9 Sgcd GGGATTGTTTG CACCGATCAGCTTTCTCTC TCTCCCTCTC CACCCTCTTAATAGTGCC ACTCCTGTGAAC CACCATATTAGGGTCCTA CTTGTCACATAC TTTCTCTTCTCC CCTTGATCCATTTG GACTTGAGCTG CGTGTGAGACTCTA AATTGCCAGTG CTTAGGCAGCTCAT CCTCTAAC (CATTCCT), ( CATTCC, GGAATG) (AGGAATGA), (AGGAATG) (TGGAATGGG)
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationSupplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationNature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
More informationTcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
More informationBroad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More informationfl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)
KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
More informationSupplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationMII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationSupplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
More informationSupplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and
Supplementary Figure 1: Signaling centers contain few proliferating cells, express p21, and exclude YAP from the nucleus. (a) Schematic diagram of an E10.5 mouse embryo. (b,c) Sections at B and C in (a)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2610 Figure S1 FSMCs derived from MSLN CLN transgenic mice express smooth muscle-specific proteins. Beta-galactosidase is ubiquitously expressed within cultured FSMCs derived from MSLN
More informationTitle: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationSupplemental Information. Metabolic Maturation during Muscle Stem Cell. Differentiation Is Achieved by mir-1/133a-mediated
Cell Metabolism, Volume 27 Supplemental Information Metabolic Maturation during Muscle Stem Cell Differentiation Is Achieved by mir-1/133a-mediated Inhibition of the Dlk1-Dio3 Mega Gene Cluster Stas Wüst,
More informationNature Genetics: doi: /ng Supplementary Figure 1. Parameters and consequences of mononuclear cardiomyocyte frequency.
Supplementary Figure 1 Parameters and consequences of mononuclear cardiomyocyte frequency. (a) Correlation of the frequency of mononuclear cardiomyocytes to the frequency of cardiomyocytes with three or
More informationSupplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the
Supplementary Figure 1 Expression of Crb3 in mouse sciatic nerve: biochemical analysis (a) Schematic of Crb3 isoforms, ERLI and CLPI, indicating the location of the transmembrane (TM), FRM binding (FB)
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
More informationPostn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationLung Met 1 Lung Met 2 Lung Met Lung Met H3K4me1. Lung Met H3K27ac Primary H3K4me1
a Gained Met-VELs 1.5 1.5 -.5 Lung Met 1 Lung Met Lung Met 3 1. Lung Met H3K4me1 Lung Met H3K4me1 1 Lung Met H3K4me1 Lung Met H3K7ac 1.5 Lung Met H3K7ac Lung Met H3K7ac.8 Primary H3K4me1 Primary H3K7ac
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationSupplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
More informationSupplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated
Supplementary Figure 1 (Related with Figure 4). Molecular consequences of Eed deletion. (a) ChIP analysis identifies 3925 genes that are associated with the H3K27me3 mark in chondrocytes (see Table S1,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
More informationSupplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation
Supplementary Figure 1 ITGB1 and ITGA11 increase with evidence for heterodimers following HSC activation. (a) Time course of rat HSC activation indicated by the detection of -SMA and COL1 (log scale).
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationE10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)
Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse
More informationhemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationPrimary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)
Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials) Sunny Y. Wong, Allen D. Seol, Po-Lin So, Alexandre N. Ermilov, Christopher K.
More informationSUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
More informationm 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41556-018-0174-4 In the format provided by the authors and unedited. m 6 A mrna methylation regulates AKT activity to promote the proliferation
More informationSupplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationSUPPLEMENTARY INFORMATION
Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation.
More informationSupplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g)
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) In four mice, cre-dependent expression of the hyperpolarizing opsin Arch in pyramidal cells
More informationSupplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus
Supplementary Figure S1: Tanycytes are restricted to the central/posterior hypothalamus a: Expression of Vimentin, GFAP, Sox2 and Nestin in anterior, central and posterior hypothalamus. In the anterior
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationFigure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
More informationSupplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical
Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical adenomatous hyperplasia/epithelial hyperplasia (AAH/EH),
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2535 Figure S1 SOX10 is expressed in human giant congenital nevi and its expression in human melanoma samples suggests that SOX10 functions in a MITF-independent manner. a, b, Representative
More informationSupporting Information. Calculation of the relative contributions of myocyte proliferation, stem cell. Supporting Information Fig 1 (page 9)
Supporting Information Table of contents Calculation of the relative contributions of myocyte proliferation, stem cell differentiation and cardioprotection (page 2) Supporting Information Fig 1 (page 9)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2697 Figure S1 Cytokeratin 5 is a specific marker for basal and intermediate cells in all mouse prostate lobes. (a) Immunofluorescence staining showing co-localization of YFP with p63 in
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM.
Supplementary Figure 1 Analysis of hair bundle morphology in Ush1c c.216g>a mice at P18 by SEM. (a-c) Heterozygous c.216ga mice displayed normal hair bundle morphology at P18. (d-i) Disorganized hair bundles
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationNature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationExpanded View Figures
EMO Molecular Medicine Proteomic map of squamous cell carcinomas Hanibal ohnenberger et al Expanded View Figures Figure EV1. Technical reproducibility. Pearson s correlation analysis of normalised SILC
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationNature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationNature Genetics: doi: /ng Supplementary Figure 1. HOX fusions enhance self-renewal capacity.
Supplementary Figure 1 HOX fusions enhance self-renewal capacity. Mouse bone marrow was transduced with a retrovirus carrying one of three HOX fusion genes or the empty mcherry reporter construct as described
More informationSupplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each
Supplementary Figure 1 The ability to regenerate an ear hole is discontinuous with wound healing. Ear-hole closure at D85 for each sex within each species observed. Data show a binary response to a 4 mm
More informationSupplemental Information. Derivation of Human Trophoblast Stem Cells
Cell Stem Cell, Volume 22 Supplemental Information Derivation of Human Trophoblast Stem Cells Hiroaki Okae, Hidehiro Toh, Tetsuya Sato, Hitoshi Hiura, Sota Takahashi, Kenjiro Shirane, Yuka Kabayama, Mikita
More informationHippo pathway deficiency reverses systolic heart failure after infarction
Letter doi:1.138/nature2445 Hippo pathway deficiency reverses systolic heart failure after infarction John P. Leach 1, Todd Heallen 2, Min Zhang 1,3, Mahdis Rahmani 2, Yuka Morikawa 2, Matthew C. Hill
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationSupplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationSupplementary Figure S1
Supplementary Figure S1 Supplementary Figure S1. PARP localization patterns using GFP-PARP and PARP-specific antibody libraries GFP-PARP localization in non-fixed (A) and formaldehyde fixed (B) GFP-PARPx
More informationF-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/487/eaag2476/dc1 Supplementary Materials for Gene expression profiles of brain endothelial cells during embryonic development at bulk and single-cell levels
More information(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More information