The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
|
|
- Maximilian Ray
- 6 years ago
- Views:
Transcription
1 The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego
2 - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride (CCl 4 ) - Clear liquid with a sweet odor that smells like chloroform. - Easily vaporizes. - High levels or continuous low dose exposure influence to liver, and cause hepatocyte injury, liver fibrosis and hepatocarcinogenesis. Trichloromethyl radical (Free radical) Lipid peroxidation Hepatotoxicity
3 Carbon tetrachloride (CCl 4 ) - Has been used for dry-cleaning, solvent, reagent in chemical synthesis, fire extinguisher fluid, and refrigerants. - The use and production of CCl 4 was declined in the mid 197s, but it has been diffusing into air, water and soil. It takes for several years to break down - In air of.1 ppb are common around the world. - In water or soil, ranging from 5 to over 1, ppb at 22% of the Superfund sites th and 5 th RANK (27 CERCLA and 211 ATSDR priority lists)
4 NAFLD Nonalcoholic fatty liver disease (NAFLD) is one of the leading causes of liver disease in the United States The prevalence of obesity and diabetes increases 6-7% of obese adults have NAFLD 3-4% of adults in the western world have NAFLD 15-2% of NAFLD patients progress to NASH According to a 28 estimation, NAFLD will be the leading cause for liver transplantation by 22.
5 Question: Does Fatty liver disease affects the sensitivity to toxin exposure? High fat diet Chronic Industrial Toxin Exposure Fatty Liver?
6 Activation of Stellate cells in Liver Fibrosis Carbon tetrachloride, HBV, HCV, NASH, Alcohol Cyp2E1 Hepatocyte Death TNF- TGF-? TGF- Activated Stellate cell
7 The Effect of Fatty Liver in Toxin-induced Liver Fibrosis 8x CCl 4 (.25ul/g BW) or corn oil LFD HFD HFD for 2M HFD for 1M 8x CCl 4 (.25ul/g BW) or corn oil
8 Serum ALT (U/L) HFD feeding enhances Toxin-induced Liver Injury LFD + Oil HFD + Oil LFD * HFD * 6 LFD + CCl 4 HFD + CCl Oil CCl 4 8 x CCl 4 (.25 ul/g BW)
9 Serum ALT (U/L) Tnf mrna [fold] Ccl2 mrna [fold] HFD feeding enhances Toxin-induced Liver Inflammation LFD HFD LFD HFD 12 * * 3 * 3 * * Oil CCl 4 Oil CCl 4 Oil CCl 4 8 x CCl 4 (.25 ul/g BW)
10 Sirius red staining area (%) HFD feeding enhances Toxin-induced Liver Fibrosis LFD HFD * * Oil CCl 4
11 Col1a1 mrna [fold] Acta2 mrna [fold] Timp1 mrna [fold] Tgfb1 mrna [fold] HFD feeding enhances Toxin-induced Liver Fibrosis LFD HFD * * * * * * * * Oil CCl Oil CCl 4 Oil CCl 4 Oil CCl
12 What is the Underlying Mechanism of Increased Sensitivity to CCl 4? High fat diet Chronic CCl 4 Exposure Fatty Liver 1. Increased sensitivity to hepatocyte death. 2. Increased capacity to produce cytokines. 3. Increased production of extracellular matrix. 4. Increased production of toxic metabolite from CCl 4.
13 Serine Rich region TGF- activated kinase 1 (TAK1) TAK1 is a 78-8 kda protein, which is encoded by the MAP3K7 gene. TAK1 is a serine/ threonine kinase, and belong to MAP3K family. Phosphorylation and ubiquitination of TAK1 are important for activation of TAK1 and its downstream molecules. TAK1 interacts with TAB1, TAB2 and TAB3 that regulate TAK1 full activation. TAK1 is activated in the signaling of TNF, IL-1, TLRs and TGF-. TAK1 regulates activation of NF- B, JNK, p38, AMPK and NLK. Catalytic domain P P 1 3 Thr Ser 36 Ser / P Lys Lys Thr Ub Ub P TAB1 TAB2/3
14 TAK1 Regulates NF- B and JNK Pathways, and also Regulates AMPK-Autophagy Pathway TNF TGF Metabolic stress (AMP/ATP, starvation) TAK1 TAK1 NEMO IKK NF- B JNK AP-1 AMPK mtorc1 autophagy Hepatocyte Death Hepatocyte Death
15 Tak1 mrna [fold] Tak1 mrna [fold] TAK1/ -actin [fold] Hepatic TAK1 expression is decreased in advanced fatty liver disease LFD ** LFD 8M-HFD TAK1 β-actin HFD ** WT Ob/Ob TAK1 β-actin LFD ** * HFD WT Ob/Ob WT Ob/Ob
16 Hepatic TAK1 expression is decreased in fatty liver with toxin exposure (2M) (2M)
17 Does Decreased TAK1 Expression Increase Sensitivity to CCl 4? High fat diet Chronic CCl 4 Exposure TAK1 Does Decreased TAK1 Play a Role? Fatty Liver
18 Generation of hepatocyte-specific TAK1-deleted mice Alb-Cre-Tg mice Tak1 flox/flox mice X Alb-promoter Cre-recombinase exon1 exon2 exon3 exon4 loxp loxp exon1 exon3 exon4 loxp TAK1 TAK1 Whole liver WT Tak1 HEP Hepatocytes WT Tak1 HEP TAK1 TAK1
19 Sirius red pos area (%) CCl 4 exposure augmentes liver fibrosis in Tak1 HEP mice WT-oil WT-CCl * * Tak1 HEP -oil Tak1 HEP -CCl 4 5 CCl injections (5-6 month old)
20 ALT (U/L) Col1a1 mrna [fold] Acta2 mrna [fold] Timp1 mrna [fold] TAK1 deficiency enhanced liver injury and fibrogenic response after chronic exposure to CCl * 4 2 CCl * * * * CCl CCl CCl
21 Why Does Decreased TAK1 Expression Increase Sensitivity to CCl 4 Exposure? 1.Sensitivity to TNF -induced hepatocyte death 2.Sensitivity to TGF -induced hepatocyte death 3.Autophagy in hepatocytes.
22 TAK1 -/- hepatocytes lack TNF -induced NF- B activation and are susceptible to cell death CCl 4 exposure inflammation TNF IL-1 TNF TNFR TAK1 NF- B Survival JNK Kupffer cells TGF DAMPs Hepatic stellate cells Caspase-3 Apoptosis Necrosis SMA TIMP1 Collagen Liver fibrosis Hepatocytes (Inokuchi et al 21, PNAS)
23 number of cell death (%) Caspase-3 activity (RFU/min) TAK1 -/- hepatocytes lack TNF -induced NF- B activation and are susceptible to cell death TNF- (min) NF- B pjnk JNK caspase-3 Cleaved caspase-3 WT (Inokuchi et al 21, PNAS) Tak1 HEP WT necrosis apoptosis WT ** TNF Tak1 HEP ** TNF Tak1 HEP
24 TAK1 -/- hepatocytes augment TGF -mediated Smad2/3 activation and are susceptible to cell death CCl 4 exposure inflammation TNF IL-1 TGF TGFbR TAK1 NF- B JNK Survival Kupffer cells TGF DAMPs Hepatic stellate cells Smad2/3/4 Caspase-3 Apoptosis Necrosis SMA TIMP1 Collagen Liver fibrosis Hepatocytes (Yang et al 213, Gastroenterology)
25 TUNEL-pos cells/hpf TAK1 -/- hepatocytes augment TGF -mediated Smad2/3 activation and are susceptible to cell death WT Tak1 HEP 3 * ** TGFβ(min) psmad2 Smad * * psmad3 1 Smad3 5 Cleaved Caspase3 Caspase3 TGFβ ng/ml WT Tak1 -/- Smad4 -/- Tak1 -/- Smad4 -/- (Yang et al 213, Gastroenterology)
26 Autophagy Autophagy is a process to degrade intracellular components (long-lived or aggregated proteins, lipids, and damaged organelles, such as mitochondria) in lysosomes to supply for energy generation for maintaining cellular homeostasis. Cell death, Cancer, Fatty Liver, Type II Diabetes, Innate Immune Systems, Aging, Infectious Disease, Toxin exposure, Fibrosis.
27 LC3B aggregates/ cell N.D. % LD with AV Fasted Fed WT Autophagy is suppressed in TAK1 HEP mice Tak1 hep Fed Fasted Fed Fasted LC3B IHC Electron Microscope WT Tak1 hep WT Tak1 hep p-s6 p62 LC3B-I LC3B-II -actin Fasted Fed Starvation Hepatocyte Death TAK1 AMPK mtorc1 Autophagy WT ** Fed Tak1 hep WT Tak1 hep ** ** 5 * ** Fasted Fed Fasted (Inokuchi-Shimizu et al 214, J Clin Invest)
28 Ratio (LC3B-GFP-II/I) TAK1 -/- -LC3B GFP WT-LC3B GFP LC3B-GFP (dots/cell) Autophagic LC3B aggregation is suppressed in TAK1 -/- hepatocytes medium starvation 6 ** ** WT Tak1 -/- medium WT Tak1 -/- starvation GFP-LC3B-I GFP-LC3B-II p62 -actin WT Tak1 -/- starvation starvation 3 ** 2 1 starvation WT Tak1 -/-
29 Starvation-induced AMPK activation is inhibited in TAK1 -/- hepatocytes TAK1 plkb1 WT Tak1 -/- starvation starvation 2h 6h 2h 6h Starvation TAK1 LKB1 pampk AMPK praptor Raptor pulk1 ULK1 -actin P P LKB1 AMPK P P Raptor ULK1 mtor Autophagy mtorc1 LC3B p62
30 Rapamycin Restores Autophagy in TAK1 -/- Hepatocytes WT Starvation WT TAK1 -/- rapa TAK1 Tak1 GFP-LC3B-I GFP-LC3B-II p62 ps6 TAK1 -/- P LKB1 AMPK Raptor P P T-S6 -actin (Inokuchi-Shimizu et al 214, J Clin Invest) mtor Autophagy S6K Rapa P S6
31 TUNEL pos cells (/x1 filed) ALT (U/L) Rapamycin Suppresses Liver Injury in Tak1 HEP mice 6 2 * * rapamycin rapamycin WT TAK1 HEP WT TAK1 HEP (Inokuchi-Shimizu et al 214, J Clin Invest)
32 Sirius Red pos Area (%) Rapamycin Suppresses Liver Fibrosis in Tak1 HEP mice Tak1 HEP mice 8 * 6 4 Vehicle rapamycin Injection of 5mg/kgBW rapamycin 2 times/week from 28 to 36 weeks 2 Vehicle rapa (Inokuchi-Shimizu et al 214, J Clin Invest)
33 The enhancement of toxin-induced liver fibrosis in fatty liver disease High fat diet Carbon Tetrachloride Exposure Steatotic Hepatocytes TAK1 NF-κB Smad2/3 Autophagy Hepatocyte Death Stellate Cell Activation
34 Fatty liver disease changes the sensitivity to toxin exposure that enhances liver fibrosis High fat diet Chronic Industrial Toxin Exposure Fatty Liver Liver Cirrhosis
35 Acknowledgement UC San Diego Superfund Research Center Ekihiro Seki MD, PhD (Project5) David A. Brenner MD (Co-leader) Yoon Seok Roh DVM,PhD Shuang Liang PhD Hiroshi Matsushita MD, PhD Sayaka Inokuchi-Shimuzu MD,PhD Ling Yang MD,PhD Bi Zhang Jingyi Song Robert Tukey PhD (Director) Michael Karin PhD (Project 1) Koji Taniguchi MD,PhD XieFeng Wu PhD Mark Ellisman PhD (Core) Mason Mackey
Understanding Root Cause: Pathogenesis of Hepatic Fibrosis
10/1/12 Understanding Root Cause: Pathogenesis of Hepatic Fibrosis Hepatitis C Virus Mild inflammation Inflammation Fibrosis Cirrhosis 1 10/1/12 Non-alcoholic Fatty Liver Disease Steatosis Steatohepatitis
More informationTAK1-mediated autophagy and fatty acid oxidation prevent hepatosteatosis and tumorigenesis
The Journal of Clinical Investigation TAK1-mediated autophagy and fatty acid oxidation prevent hepatosteatosis and tumorigenesis Sayaka Inokuchi-Shimizu, 1 Eek Joong Park, 1 Yoon Seok Roh, 1 Ling Yang,
More informationMechanisms of hepatic fibrogenesis in chronic liver disease
Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationA particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy se
A particular set of insults induces apoptosis (part 1), which, if inhibited, can switch to autophagy. At least in some cellular settings, autophagy serves as a defence mechanism that prevents or retards
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationThe role of Hepatitis C Virus in hepatocarcinogenesis
The role of Hepatitis C Virus in hepatocarcinogenesis Laura Beretta Fred Hutchinson Cancer Research Center l8 Incidence and mortality of the five most common cancers worldwide, 2000 Incidence Lung Breast
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationVirchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation
Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis
More informationForward-looking Statements
NASDAQ:CNAT Forward-looking Statements This presentation contains forward-looking statements. All statements other than statements of historical facts contained in this presentation, including statements
More informationAlcoholic hepatitis is a drug-induced disorder
Alcoholic hepatitis is a drug-induced disorder Gyongyi Szabo, MD, PhD Professor of Medicine University of Massachusetts Medical School Source: 2 Sobernation.com Clinical Progression of ALD Mortality Acute
More informationReviewers' comments: Reviewer #1 (Remarks to the Author):
Reviewers' comments: Reviewer #1 (Remarks to the Author): The manuscript by Wu et al describes critical role of RNA binding protein CUGBP1 in the development of TGF-beta-mediated liver fibrosis. The activation
More informationKinase-independent functions of RIPK1 regulate hepatocyte survival and liver carcinogenesis
The Journal of Clinical Investigation Kinase-independent functions of RIPK1 regulate hepatocyte survival and liver carcinogenesis Trieu-My Van, 1,2,3 Apostolos Polykratis, 1,2,3 Beate Katharina Straub,
More informationTrehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway
Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,
More informationSupplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with
Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with DMN Immunohistochemistry for hepcidin and H&E staining (left). qrt-pcr assays for hepcidin in the liver (right).
More informationMolecular mechanisms of Fibrosis: Targets of Therapy. John P Iredale University of Edinburgh, UK
Molecular mechanisms of Fibrosis: Targets of Therapy John P Iredale University of Edinburgh, UK Take home messages: The wound healing MFBs of the liver and the hepatic macrophages are key players in progressive
More informationDisclosures. Outline. Extracellular Vesicles in Fatty Liver Disease. From Contributors to disease pathogenesis to novel biomarkers
Extracellular Vesicles in Fatty Liver Disease From Contributors to disease pathogenesis to novel biomarkers Ariel Feldstein, M.D. Professor of Pediatrics Chief, Division of Pediatric Gastroenterology Hepatology
More informationThe liver in poisoning: what can we learn from animal models?
The liver in poisoning: what can we learn from animal models? Stephan Krähenbühl Clinical Pharmacology & Toxicology University Hospital 4031 Basel/Switzerland Kraehenbuehl@uhbs.ch Outcome and causes of
More informationUniversity of Groningen. Non-alcoholic fatty liver disease Sheedfar, Fareeba
University of Groningen Non-alcoholic fatty liver disease Sheedfar, Fareeba IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it. Please check
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationIdentified proteins interacting with TMBIM1 by mass spectrometry
Supplementary Information Journal: Nature Medicine Article Title: Corresponding Author: A novel multivesicular body regulator TMBIM1 protects against non-alcoholic fatty liver disease in mice and monkeys
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationNonalcoholic fatty liver disease (NAFLD), the
Transforming Growth Factor Beta Signaling in Hepatocytes Participates in Steatohepatitis Through Regulation of Cell Death and Lipid Metabolism in Mice Ling Yang, 1,2 Yoon Seok Roh, 1 Jingyi Song, 1 Bi
More informationCell Quality Control. Peter Takizawa Department of Cell Biology
Cell Quality Control Peter Takizawa Department of Cell Biology Cellular quality control reduces production of defective proteins. Cells have many quality control systems to ensure that cell does not build
More informationHypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationDietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
More informationPostn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
More informationConflicts of Interest in the last 12 months
STEATOHEPATITIS Richard K. Sterling, MD, MSc, FACP, FACG VCU Hepatology Professor of Medicine Chief, Section of Hepatology Virginia Commonwealth University Richmond, VA Conflicts of Interest in the last
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationWHAT THE EXPERIMENTAL MODELS CAN TEACH US IN NAFLD/NASH? Claudio Tiribelli, MD PhD Scientific Director FIF
WHAT THE EXPERIMENTAL MODELS CAN TEACH US IN NAFLD/NASH? Claudio Tiribelli, MD PhD Scientific Director FIF ctliver@fegato.it Worldwide estimated prevalence of NAFLD distribution of PNPLA3 genotypes 2017-Younussi
More informationshehab Moh Tarek ... ManarHajeer
3 shehab Moh Tarek... ManarHajeer In the previous lecture we discussed the accumulation of oxygen- derived free radicals as a mechanism of cell injury, we covered their production and their pathologic
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationLiposome Mediated Delivery of sirna to Hepatic Stellate Cells Alfica Sehgal, Mohammad Zafari, Boris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz
Liposome Mediated Delivery of sirn to Hepatic Stellate ells lfica Sehgal, Mohammad Zafari, oris Klebanov, Greg Hinkle, Satya Kuchimanchi, Sarfraz Shaikh, Martin Maier, Jonathan O Shea, Lauren Speciner,
More informationRAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
More informationSupplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
More informationIntracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
More informationConnective Tissue Response in IBD
Connective Tissue Response in IBD Dr I C Lawrance MB BS, PhD FRACP School of Medicine and Pharmacology, University of Western Australia, Fremantle Hospital Intestinal response to Chronic Inflammation Control
More informationCheng Liu 1, Xia Yuan 2, Le Tao 3, Zhuoan Cheng 1, Xiuqin Dai 1, Xia Sheng 4 and Dongying Xue 3*
Liu et al. BMC Complementary and Alternative Medicine (2015) 15:201 DOI 10.1186/s12906-015-0733-1 RESEARCH ARTICLE Open Access Xia-yu-xue decoction (XYXD) reduces carbon tetrachloride (CCl 4 )-induced
More informationD2 inhibits TLR2- initiated 12p40 transcription (-) TLR2 PGN MDP. MyD88 IRAK ECSIT TRAF6 NIK. Smallest unit of PGN muramyl dipeptide IKK.
D2 inhibits TLR2- initiated 12p40 transcription CARD CARD NOD2 LRR RICK/Rip2 NIK MDP TRAF6 PGN TLR2 MyD88 IRAK ECSIT (-) IKK Smallest unit of PGN muramyl dipeptide IκB NF-κB atanabe et al, 2004 NF-κB IL-12p40
More informationNAFLD/NASH. Definitions. Pathology NASH. Vicki Shah PA-C, MMS Rush University Hepatology
NAFLD/NASH Vicki Shah PA-C, MMS Rush University Hepatology Definitions NAFLD Evidence of hepatic steatosis by histology (5%) or imaging No causes for secondary fat accumulation EtOH, Drugs, hereditary
More informationFigure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in
9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade
More informationGut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
More informationCholesterol and Sphingolipids in Non-Alcoholic fatty liver disease.
Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease. José C. Fernández-Checa Liver Unit, Hospital Clinic CIBEK and IDIBAPS Instituto Investigaciones Biomédicas Barcelona Consejo Superior
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationFibrosis is a highly conserved response to hepatic
NEW HORIZONS Hepatic Inflammation and Fibrosis: Functional Links and Key Pathways Ekihiro Seki 1,2 and Robert F. Schwabe 3,4 Inflammation is one of the most characteristic features of chronic liver disease
More informationInnate Immune Consequences of Hepatocyte Injury. Katherine J. Brempelis. A dissertation. submitted in partial fulfillment of the
Innate Immune Consequences of Hepatocyte Injury Katherine J. Brempelis A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Washington
More informationSignaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
More informationLIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES
LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES A THESIS SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationNonalcoholic steatohepatitis (NASH), characterized
AMERICAN ASSOCIATION FOR THE STUDY OFLIVERD I S E ASES HEPATOLOGY, VOL. 65, NO. 5, 2017 STEATOHEPATITIS/METABOLIC LIVER DISEASE The E3 Ligase Tripartite Motif 8 Targets TAK1 to Promote Insulin Resistance
More informationNonalcoholic Fatty Liver Disease in Children: Typical and Atypical
Nonalcoholic Fatty Liver Disease in Children: Typical and Atypical Disclosure Naim Alkhouri, MD discloses the following relationships with commercial companies: Membership in the Speakers Bureau for Alexion
More informationHow Will New Therapies Affect HCC Development?
How Will New Therapies Affect HCC Development? July 6, 2018 Scott Friedman, M.D. Fishberg Professor of Medicine Dean for Therapeutic Discovery Chief, Division of Liver Diseases Icahn School of Medicine
More informationCompany Overview. September 2018 NASDAQ: MDGL
Company Overview September 2018 NASDAQ: MDGL 1 Forward Looking Statements Any statements, other than statements of historical facts, made in this presentation regarding our future financial or business
More informationNon alcoholic fatty liver and Non alcoholic Steatohepatitis. By Dr. Seham Seif
Non alcoholic fatty liver and Non alcoholic Steatohepatitis By Dr. Seham Seif Definition NAFL describe a common clinicopathological conditions characterized by significant lipid deposition in the hepatocytes
More informationHepatitis C Virus and Cytokine Responses
Hepatitis C Virus and Cytokine Responses Eui-Cheol Shin, M.D., Ph.D. Laboratory of Immunology & Infectious Diseases (LIID), Graduate School of Medical Science & Engineering (GSMSE), KAIST Daejeon, Korea
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationDecoy receptor 3 alleviates hepatic fibrosis through suppressing inflammation activated by NF-κB signaling pathway
Original papers Decoy receptor 3 alleviates hepatic fibrosis through suppressing inflammation activated by NF-κB signaling pathway Zhenjing Jin A,E, Siqi Liu B,C, Qian Zhang D,E, Xue Shao B,F, Jingting
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationNFκB What is it and What s the deal with radicals?
The Virtual Free Radical School NFκB What is it and What s the deal with radicals? Emily Ho, Ph.D Linus Pauling Institute Scientist Department of Nutrition and Food Management Oregon State University 117
More informationAppendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
More informationNonalcoholic fatty liver disease (NAFLD) is one of
GASTROENTEROLOGY 2010;139:323 334 Toll-Like Receptor 9 Promotes Steatohepatitis by Induction of Interleukin-1 in Mice KOUICHI MIURA,*, YUZO KODAMA,* SAYAKA INOKUCHI,* BERND SCHNABL,* TOMONORI AOYAMA,*
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationExploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
University of Windsor Scholarship at UWindsor UWill Discover Undergraduate Conference UWill Discover 2016 Mar 29th, 4:00 PM - 5:00 PM Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
More informationSUPPLEMENTARY INFORMATION
Figure S1. Silver staining and immunoblotting of the purified TAK1 kinase complex. The TAK1 kinase complex was purified through tandem affinity methods (Protein A and FLAG), and aliquots of the purified
More informationSestrin2-mediated signaling in autophagy induction and oxidative metabolism
Sestrin2-mediated signaling in autophagy induction and oxidative metabolism May 16, 2017 Graduate Course 2214/BioC 998 SEUNG-HYUN RO Redox Biology Center University of Nebraska - Lincoln 1 Part I : ULK1-Sestrin2
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More information1. Activated receptor tyrosine kinases (RTKs) phosphorylates themselves
Enzyme-coupled receptors Transmembrane proteins Ligand-binding domain on the outer surface Cytoplasmic domain acts as an enzyme itself or forms a complex with enzyme 1. Activated receptor tyrosine kinases
More informationThe Future Outlook to DILI Research From The Perspective of China
The Future Outlook to DILI Research From The Perspective of China Yimin Mao Renji Hospital,Shanghai Jiaotong University School of Medicine DILI in General Population Less than 20/100,000 The incidence
More informationAbnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S100A9
Abnormally differentiating keratinocytes in the epidermis of systemic sclerosis patients show enhanced secretion of CCN2 and S1A9 Joanna Nikitorowicz-Buniak UCL Division of Medicine Systemic sclerosis
More informationSupplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin
Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationSupplementary Information File
Supplementary Information File Supplementary Table 1. List of synthesized sirna sequences for target genes sirna Species Sequence Ctrl sirna mouse sense 5 -UUCUCCGAACGUGUCACGUTT-3 Antisense 5 -ACGUGACACGUUCGGAGAATT-3
More informationImproving the Lives of Patients with Liver Diseases
Improving the Lives of Patients with Liver Diseases Corporate Presentation March 2019 Safe Harbor Statement This presentation contains "forward-looking" statements that involve risks, uncertainties and
More informationNON-ALCOHOLIC STEATOHEPATITIS AND NON-ALCOHOLIC FATTY LIVER DISEASES
NON-ALCOHOLIC STEATOHEPATITIS AND NON-ALCOHOLIC FATTY LIVER DISEASES Preface Zobair M. Younossi xiii Epidemiology and Natural History of NAFLD and NASH 1 Janus P. Ong and Zobair M. Younossi Understanding
More informationNovel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27
Novel Reduction of PCSK9 Expression: Mechanistic Insights into the Anti-Atherosclerotic & Hypolipidemic Effects of Heat Shock Protein 27 Ed O Brien, Jean-Claude Bakala-N Goma, Chunhua Shi Cumming School
More informationIncreases in p53 expression induce CTGF synthesis by mouse and human hepatocytes and result in liver fibrosis in mice
Research article Increases in p53 expression induce CTGF synthesis by mouse and human hepatocytes and result in liver fibrosis in mice Takahiro Kodama, 1 Tetsuo Takehara, 1 Hayato Hikita, 1 Satoshi Shimizu,
More informationMaster class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationAAIM: GI Workshop Follow Up to Case Studies. Non-alcoholic Fatty Liver Disease Ulcerative Colitis Crohn s Disease
AAIM: GI Workshop Follow Up to Case Studies Non-alcoholic Fatty Liver Disease Ulcerative Colitis Crohn s Disease Daniel Zimmerman, MD VP and Medical Director, RGA Global October 2015 Non-alcoholic Fatty
More informationChapter 3. Toxicity and the Factors That Modify Toxic Responses
Chapter 3 Toxicity and the Factors That Modify Toxic Responses Cellular Basis of Toxicity All chemicals have the potential to produce toxicity. Toxicity may be generally defined as any adverse effect of
More informationAMPK Activation by Metformin Suppresses Abnormal Extracellular Matrix Remodeling in Adipose Tissue and Ameliorates Insulin Resistance in Obesity
Diabetes Volume 65, August 2016 2295 Ting Luo, 1,2 Allison Nocon, 1 Jessica Fry, 1 Alex Sherban, 1 Xianliang Rui, 1 Bingbing Jiang, 1 X. Julia Xu, 1 Jingyan Han, 1 Yun Yan, 3 Qin Yang, 4 Qifu Li, 2 and
More informationMetformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state
Related Commentary, page 2267 Research article Metformin inhibits hepatic gluconeogenesis in mice independently of the LKB1/AMPK pathway via a decrease in hepatic energy state Marc Foretz, 1,2 Sophie Hébrard,
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationIs there a common mechanism of DILI, do we need to know?
Is there a common mechanism of DILI, do we need to know? Neil Kaplowitz, MD USC Research Center for Liver Disease Los Angeles, California IS THERE A COMMON MECHANISM OF DILI? ANSWER YES & NO Mechanisms
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationMesothelin/mucin 16 signaling in activated portal fibroblasts regulates cholestatic liver fibrosis
Mesothelin/mucin 16 signaling in activated portal fibroblasts regulates cholestatic liver fibrosis Yukinori Koyama,, David A. Brenner, Tatiana Kisseleva J Clin Invest. 2017;127(4):1254-1270. https://doi.org/10.1172/jci88845.
More informationLiver fibrosis: Twenty years after. Fabio Marra Dipartimento di Medicina Sperimentale e Clinica Università di Firenze
Liver fibrosis: Twenty years after Fabio Marra Dipartimento di Medicina Sperimentale e Clinica Università di Firenze fabio.marra@unifi.it DISCLOSURES: Grants from: ViiV Healthcare Consultant for: Bayer
More informationUniversity of California, San Diego La Jolla CA 92093
AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationAntibodies for Unfolded Protein Response
Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)
More information