Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Size: px
Start display at page:

Download "Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity."

Transcription

1 Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD, 60% fat) for 16 weeks, starting at 6 weeks of age (n=18 per group). (a) Body weight. (b) Body fat content. (c-f) Stromal vascular fraction (SVF) and adipocytes were prepared from epididymal (ep) WAT. Total RNA was extracted for quantitative RT-PCR analysis. (c,d) Xbp1 mrna splicing and relative mrna abundance of the indicated UPR marker genes in SVF (c) and adipocytes (d). (e,f) Relative mrna abundance of the indicated proinflammatory genes in SVF (e) and adipocytes (f). (g,h) CD11b + cells were isolated by magnetic MicroBeads from SVF of epwat. Quantitative RT-PCR analysis of Xbp1 mrna splicing and relative mrna abundance of the indicated UPR marker and RIDD target genes (g) along with proinflammatory genes (h). Data are shown as mean ± s.e.m., *P < 0.05; **P < 0.01; ***P < by Student s t-test.

2 Supplementary Figure 2 Metabolic characterization of Ern1 f/f ; Lyz2-Cre mice. (a) Immunoblot analyses of IRE1 protein in the indicated tissues of male Ern1 f/f (f/f) and Ern1 f/f ; Lyz2-Cre (f/f:cre) mice. (b-l) Male Ern1 f/f ; Lyz2-Cre mice and age-matched Ern1 f/f littermates were fed an NC (n=8 per group) or HFD (n=10 per group) for 16 weeks, starting at 8 weeks of age. (b) Representative image of mice of the indicated genotype. (c) The tibia length of NC-fed mice. (d) Weight of epwat from NC-fed mice. (e) Body weight gain of HFD-fed mice. (f) Representative images and weight of the indicated WAT from HFD-fed mice. (g) Lean mass was determined for mice fed an NC or HFD. (h) Immunoblot analyses of phosphorylation of AKT (p-akt) at Ser473 in livers, muscle, and epwat of HFD-fed mice after they were injected intravenously with PBS (-) or insulin (2 U/kg). (i) Liver weight was measured for NC- and HFD-fed mice. (j) Averaged daily food intake of NC- and HFD-fed mice. (k) Fecal TG content from HFD-fed mice. (l) Locomotor activity measured over a 24-h period. Results are shown as mean ± s.e.m., *P < 0.05; ***P < by Student s t- test or two-way ANOVA.

3 Supplementary Figure 3 Analysis of ATMs in NC-fed mice and ER stress in WAT of HFD-fed mice. (a,b) SVFs of epwat were prepared from NC-fed male Ern1 f/f ; Lyz2-Cre mice (n=4 per group) and their Ern1 f/f littermates (n=3 per group) at 20 weeks of age. (a) Representative histograms of flow cytometry analysis of CD11b and F4/80 expression. Shown also are percentages of F4/80 + CD11b + cells. (b) Expression of CD206 in CD11b + cells. Amounts of CD11b + CD206 + cells are quantified and shown as relative mean fluorescence intensity (MFI). (c-f) Ern1 f/f ; Lyz2-Cre mice (n=10 per group) and age-matched Ern1 f/f littermates (n=8 per group) were fed an HFD for 16 weeks. Quantitative RT-PCR analysis of exon 2-containing Ern1 mrna and Xbp1 mrna splicing, along with the abundance of the indicated UPR genes in SVF (c,e) or adipocytes (d,f) from epwat (c,d) and scwat (e,f). Results are presented as mean ± s.e.m., *P < 0.05; **P<0.01; ***P<0.001 by Student s t-test.

4 Supplementary Figure 4 Flow cytometry analysis of WAT macrophages and neutrophils. SVFs were prepared from epwat (a) and scwat (b) of Ern1 f/f or Ern1 f/f ; Lyz2-Cre mice following HFD feeding for 16 weeks (n=5 per group). CD11b + cells were isolated with magnetic MicroBeads and then subjected to flow cytometry. Shown are representative histograms and percentages of CD45 + CD11b + cells, which were further analyzed for percentages of F4/80 + CD11b + macrophages and Ly6G + CD11b + neutrophils.

5 Supplementary Figure 5 Analysis of IRE1 phosphorylation and UPR activation in LPS- or IL-4-stimulated BMDMs. BMDMs from mice of the indicated genotype were stimulated with 100 ng/ml LPS (a,b) or 20 ng/ml IL-4 (c,d) for the indicated times (3 and 4 independent experiments, respectively). (a,c) Phos-tag gel analysis of phosphorylation of IRE1. BMDMs treated with thapsigargin (Tg, 1 M) for 4 hours were used as a control. Shown are representative immunoblots with two different exposure times. (b,d) Quantification of eif2 phosphorylation and BiP protein expression from the immunoblots in Fig. 6a and 6d, respectively. Results are presented as mean ± s.e.m.

6 Supplementary Figure 6 Effects of IRE1 abrogation on the IL-4-induced transcriptome in BMDMs. BMDMs from Ern1 f/f or Ern1 f/f ; Lyz2-Cre mice were treated with IL-4 for 24 hours. Total cellular RNAs were subjected to RNA-seq analysis (2 independent experiments). (a) Heat maps showing IL-4 induction of differentially expressed genes. Pie charts indicate the percentage of IL-4-upregulated or -downregulated genes which are further enhanced, attenuated or unaltered by IRE1α ablation in the presence of IL-4 stimulation (Ern1 f/f ; Lyz2-Cre_Ern1 f/f ). Gene expression results were analyzed by two-tailed rank product non-parametric method. (b) Gene Set Enrichment Analysis (GSEA) using the KEGG database ( with a nominal P-value < 0.05 and false discovery rate (FDR) < Shown are heat maps for the indicated IL- 4-enhanced or -suppressed cellular function processes and signaling pathways, as aligned with those affected by IRE1α deficiency under stimulation by IL-4 (Ern1 f/f ; Lyz2-Cre_Ern1 f/f ). (c) Changes in the expression of genes encoding potential secretory proteins as a result of IRE1α deficiency. Shown are heat maps for IL-4-upregulated or -downregulated genes, as aligned with those altered in IRE1 -deficient BMDMs relative to control cells under IL-4 stimulation (Ern1 f/f ; Lyz2-Cre_Ern1 f/f ).

7 Supplementary Figure 7 Enforced expression of XBP1s has no effect on the mrna abundance of M2 polarization regulators. Mouse BMDMs were infected by control or XBP1s-expressing lentiviruses before treatment with veh. or IL-4 for 24 hours (4 independent experiments). Quantitative RT-PCR analysis of the mrna abundance of the XBP1s target gene Erdj4 (a) and the indicated regulators of M2 polarization (b). Data are shown as mean ± s.e.m., **P < 0.01 by two-way ANOVA.

8 3 4 Supplementary Table 1. Oligonucleotide primers for quantitative RT-PCR analysis (related to Methods) Gene Forward primer (5-3 ) Reverse primer (5-3 ) 5 18s rrna AGGGGAGAGCGGGTAAGAG GGACAGGACTAGGCGGAACAACA Xbp1s CTGAGTCCGAATCAGGTGCAG GTCCATGGGAAGATGTTCTGG Nos2 ACATCGACCCGTCCACAGTAT CAGAGGGGTAGGCTTGTCTC Arg1 CTCCAAGCCAAAGTCCTTAGAG GGAGCTGTCATTAGGGACATCA Il10 GCTATGCTGCCTGCTCTTACT CCTGCTGATCCTCATGCCA Chi3l3 CAGGTCTGGCAATTCTTCTGAA GTCTTGCTCATGTGTGTAAGTGA Cox5a GGAAGACCCTAATCTAGTCCCG GTTGGGGCATCGCTGACTC Cox7a GCTCTGGTCCGGTCTTTTAGC GTACTGGGAGGTCATTGTCGG Cox8b TGTGGGGATCTCAGCCATAGT AGTGGGCTAAGACCCATCCTG Klf4 GGCGAGTCTGACATGGCTG GCTGGACGCAGTGTCTTCTC Hgnat CGGGCGGAGCCAGATTTAG GCTCGTCCCCAAGAGTTCAT Pmp22 CATCGCGGTGCTAGTGTTG GATCAGTCGTGTGTCCATTGC Mrc1 CTCTGTTCAGCTATTGGACGC TGGCACTCCCAAACATAATTTGA Tnfa GACGTGGAACTGGCAGAAGAG ACCGCCTGGAGTTCTGGAA Il1b GCAACTGTTCCTGAACTCAACT ATCTTTTGGGGTCCGTCAACT Ccl2 TTAAAAACCTGGATCGGAACCAA GCATTAGCTTCAGATTTACGGGT Bip ACTTGGGGACCACCTATTCCT ATCGCCAATCAGACGCTCC Chop CTGGAAGCCTGGTATGAGGAT CAGGGTCAAGAGTAGTGAAGGT Erdj4 ATAAAAGCCCTGATGCTGAAGC GCCATTGGTAAAAGCACTGTGT Retnla CCAATCCAGCTAACTATCCCTCC ACCCAGTAGCAGTCATCCCA Pgc1a TATGGAGTGACATAGAGTGTGCT CCACTTCAATCCACCCAGAAAG Irf4 TCCGACAGTGGTTGATCGAC CCTCACGATTGTAGTCCTGCTT Pparg GGAAGACCACTCGCATTCCTT GTAATCAGCAACCATTGGGTCA Ppard TCCATCGTCAACAAAGACGGG ACTTGGGCTCAATGATGTCAC Prdm16 CCAAGGCAAGGGCGAAGAA AGTCTGGTGGGATTGGAATGT Il6 CCACGGCCTTCCCTACTTC TTGGGAGTGGTATCCTCTGTGA Cd137 CCTTGCAGGTCCTTACCTTGT GTTGCTTGAATATGTGGGGGA Ear2 CCTGTAACCCCAGAACTCCA CAGATGAGCAAAGGTGCAAA Tmem26 TTCCTGTTGCATTCCCTGGTC GCCGGAGAAAGCCATTTGT Adgre1 ATGGACAAACCAACTTTCAAGGC GCAGACTGAGTTAGGACCACAA Atf4 CCTTCGACCAGTCGGGTTTG CTGTCCCGGAAAAGGCATCCA Ern1 CCTTGTTGTTTGTCTCGACCCT GCCTTCGTTGTTCTTGCCTC

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets. Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK

More information

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION -. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity

Data supplement. Netrin-1 promotes adipose tissue macrophage accumulation and insulin resistance in obesity Data supplement Netrin- promotes adipose tissue macrophage accumulation and insulin resistance in obesity Bhama Ramkhelawon, Elizabeth J Hennessy, Mickaël Ménager 2, Tathagat D. Ray, Frederick J Sheedy,

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/106/ra7/dc1 Supplementary Materials for A Crucial Role for RACK1 in the Regulation of Glucose-Stimulated IRE1α Activation in Pancreatic β Cells Yifu Qiu, Ting

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Protein extraction and western blot analysis Protein extraction was performed as

Protein extraction and western blot analysis Protein extraction was performed as ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs

More information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x magnification). B: Second HC skin stained for TSLP receptor in brown

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression)

ALT (U/L) (Relative expression) HDL (mm) (Relative expression) ALT (U/L) (Relative expression) a DMT mrna () 8 6 r =.96 P =. DMT mrna () 8 6 r =. P =.6 DMT mrna () 8 6 r =.99 P =.6 DMT mrna () 8 6 r =. P =.9 DMT mrna () BMI (kg/m ) 8 6 r =.7 P =.966 DMT mrna () 8 ALT (U/L) 8 6 r = -.66 P =.76 DMT

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance

Supplemental Information. Human Carboxylesterase 2 Reverses. Obesity-Induced Diacylglycerol Accumulation. and Glucose Intolerance Cell Reports, Volume 18 Supplemental Information Human Carboxylesterase 2 Reverses Obesity-Induced Diacylglycerol Accumulation and Glucose Intolerance Maxwell A. Ruby, Julie Massart, Devon M. Hunerdosse,

More information

Supplementary Information Titles

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Article Title: Corresponding Author: Authors: An inhibitor of the protein kinases /ε improves obesity- related metabolic dysfunctions Alan Saltiel

More information

Supporting Information

Supporting Information Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution Immunity, Volume 9 Supplemental Information Regulatory T Cells Promote Macrophage Efferocytosis during Inflammation Resolution Jonathan D. Proto, Amanda C. Doran, Galina Gusarova, Arif Yurdagul Jr., Erdi

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD) SUPPLEMENTARY INFORMATION LEGENDS Supplemental Figure. Body weight and blood glucose parameters of chow-diet (CD) fed and high-fat diet (HFD) fed mice. (A) Body weight was measured at the beginning of

More information

Nature Medicine: doi: /nm.4078

Nature Medicine: doi: /nm.4078 Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios

More information

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages

Supplemental Information. Aryl Hydrocarbon Receptor Controls. Monocyte Differentiation. into Dendritic Cells versus Macrophages Immunity, Volume 47 Supplemental Information Aryl Hydrocarbon Receptor Controls Monocyte Differentiation into Dendritic Cells versus Macrophages Christel Goudot, Alice Coillard, Alexandra-Chloé Villani,

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Nature Genetics: doi: /ng.3731

Nature Genetics: doi: /ng.3731 Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table Title of file for HTML: Peer Review File Description: Innate Scavenger Receptor-A regulates

More information

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0 Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in 9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade

More information

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,

More information

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed

More information

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl) a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

More information

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Supplementary Information

Supplementary Information Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Nature Immunology: doi: /ni Supplementary Figure 1

Nature Immunology: doi: /ni Supplementary Figure 1 Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.

More information

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c

Male 30. Female. Body weight (g) Age (weeks) Age (weeks) Atg7 f/f Atg7 ΔCD11c ody weight (g) ody weight (g) 34 3 Male 3 27 Female 26 24 22 18 7 9 11 13 15 17 19 21 23 21 18 15 7 9 11 13 15 17 19 21 23 Age (weeks) Age (weeks) Supplementary Figure 1. Lean phenotypes in mice regardless

More information

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran

More information

Supplementary information

Supplementary information Supplementary information High fat diet-induced changes of mouse hepatic transcription and enhancer activity can be reversed by subsequent weight loss Majken Siersbæk, Lyuba Varticovski, Shutong Yang,

More information

Supplementary Figure 1:

Supplementary Figure 1: Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti

More information

Expanded View Figures

Expanded View Figures Expanded View Figures A B C D E F G H I J K L Figure EV1. The dysregulated lipid metabolic phenotype of mouse models of metabolic dysfunction is most pronounced in the fasted state. A L Male 12-weeks-old

More information

Gut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Gut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Gut Reaction Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Ley, R. et al (2005) PNAS vol. 102 no. 31 Bacterial diversity in the distal gut (ceca) of C57BL6 mice. (A) Phylogenetic tree of

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p. a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure

More information

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin resistance index of homeostatic model assessment (HOMA IR)

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.

Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating

More information

The unfolded protein response is shaped by the NMD pathway

The unfolded protein response is shaped by the NMD pathway Manuscript EMBOR-2014-39696 The unfolded protein response is shaped by the NMD pathway Rachid Karam, Chih-Hong Lou, Heike Kroeger, Lulu Huang, Jonathan H. Lin and Miles F. Wilkinson Corresponding author:

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or

More information

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171 SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)

More information

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation ORIGINAL ARTICLE STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation Anca D. Dobrian, 1 Elena V. Galkina, 2 Qian Ma, 1 Margaret Hatcher, 1 Sabai Myo Aye, 1 Mathew

More information

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21

More information

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b) KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

Supplementary Information

Supplementary Information Supplementary Information Akt regulates hepatic metabolism by suppressing a Foxo1 dependent global inhibition of adaptation to nutrient intake Mingjian Lu 1, Min Wan 1, Karla F. Leavens 1, Qingwei Chu

More information

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina

More information

Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature

Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information