SUPPLEMENTARY INFORMATION
|
|
|
- Hilary Tate
- 5 years ago
- Views:
Transcription
1 doi: /nature06310 SUPPLEMENTARY INFORMATION 1
2 2
3 3
4 Supplementary Figure S1 Spontaneous duration of wake, SWS and REM sleep (expressed as a percentage of time) of pphcrt::chr2-mcherry transduced animals (n=4) and their controls (; n=4) during the light and the dark parts of the light/dark cycle. No significant differences were found between pphcrt::chr2-mcherry transduced animals and their controls (p>0.05) demonstrating that expression of ChR2 in Hcrt neurons does not alter the spontaneous sleep-wake cycle of the mice. Supplementary Figure S2 a-c, Mean spectral distribution of relative cortical EEG power density of wake (a), SWS (b) and REM sleep (c) during the spontaneous sleep-wake cycle in baseline conditions (dashed lines) and during the long term stimulation procedures (; continuous lines) in pphcrt::chr2-mcherry transduced animals (n=4; red) and their controls (n=4; blue). The data were obtained by pooling 5 s epochs during duplicated 1h- experiments and their corresponding baseline for each animal. Note that no significant changes were found during baseline recordings between pphcrt::chr2-mcherry transduced animals and their controls (p>0.05, two-tailed Student s t-test). d, EEG power densities in the delta (0.5-4 Hz), theta (4.5-9 Hz) and alpha (9-15 Hz) ranges of pphcrt::chr2-mcherry transduced animals (n=4; red) and their controls (n=4; blue) during stimulation. The long term stimulation procedure was not found to induce significant changes in the frequency ranges analyzed (p>0.05, two-way ANOVA). Supplementary Figure S3 a, The cannula guide was implanted 0.5 mm above the LH area which contains the Hcrtpositive cells (immunohistochemically stained brown; see Methods). Scale bar: 500 μm. The circular space at the top of this typical section corresponds to cannula guide placement in this animal; note that the Hcrt cell field of the LH below the zona incerta lies well within 1 mm of the cannula guide position. Abbreviations used: F, fornix. b, c, Cannula guide positions across experimental conditions over the LH (drawings generated according to the mouse brain atlas 1 ) of mice transduced with (filled circles; n=6, one control animal died before perfusion) and pphcrt::chr2-mcherry 4
5 (filled squares; n=6) lentiviruses that were used in this study. Scale bar: 500 μm. Abbreviations used: Arc, arcuate nucleus; DM, dorso-medial hypothalamic area; opt, optic tract; PeF, perifornical area; VMH, ventro-medial hypothalamic area; ZI, zona incerta. d, e, Photomicrographs of double-immunostained sections from (d) and pphcrt::chr2-mcherry (e) transduced mice. Black arrows indicate Hcrt positive cells with their cytoplasm stained brown, and black arrowheads show double-labeled Hcrt and c-fos positive cells displaying brown cytoplasm and black nuclei. Scale bar: 20 μm. f, Percentage of Hcrt-positive neurons that were also c-fos positive after in vivo photostimulation (10s/20Hz pulse trains delivered once per minute over 10 minutes) in the stimulated side of the LH (ipsi for ipsilateral) and the contralateral side (contra). **, p<0.001 significantly different from other groups (one-way ANOVA followed by Tukey post hoc tests). 5
6 Supplementary Table 1: Sleep-wake transitions during long-term stimulation. Long-term stimulation (, 20 Hz for 10s every minute during one hour) were applied to pphcrt::chr2-mcherry transduced animals (n=4) and their controls (n=4). Number of specific behavioral transitions is represented as mean±sem after scoring of the EEG/EMG. Increased transitions to wakefulness are accompanied by increased transitions from wake to SWS since 1) total arousal state durations over the hour appear to be constant (Supplementary Table 2) and 2) Wake-to-REM sleep transitions are not found to occur. Analysis is based on duplicated stimulation sessions for each animal compared to their respective baseline values at the same circadian time. *, p<0.05 using a two-way ANOVA for transduction and stimulation conditions followed by a Bonferroni post hoc test. Wake to SWS 38.87± ± ± ±5.33 (p=0.06) SWS to Wake 34.27± ± ± ±5.86* SWS to REM sleep 4.83± ± ± ±0.77 REM sleep to Wake 4.66± ± ± ±0.90 Wake to REM sleep Total 82.67± ± ± ±10.41 (p=0.07) Supplementary Table 2: Sleep architecture during long-term stimulation. Spontaneous duration of wake, SWS and REM sleep (expressed as a percentage of time) of pphcrt::chr2-mcherry infected animals (n=4) and their controls (; n=4) during long-term stimulation (). Vigilance state duration is represented as mean±sem after scoring of the EEG/EMG. Analysis is based on stimulation sessions for each animal, in duplicate, compared to their respective baseline values at the same circadian time. No significant differences were found between pphcrt::chr2-mcherry infected animals and their controls (p>0.05, two-way ANOVA). Wake 36.47± ± ± ±4.35 SWS 56.28± ± ± ±3.58 REM sleep 7.25± ± ± ±
7 Supplementary Movie 1 Video recording of a SWS to wake transition after a single light pulse train (15 ms per pulse; 10 s pulse trains; 20 Hz trains) with simultaneous EEG/EMG (video inset, upper and lower traces, respectively). Supplementary Movie 2 Video recording of a REM sleep to wake transition after a single light pulse train (15 ms per pulse; 10 s pulse trains; 20 Hz trains) with simultaneous EEG/EMG (video inset, upper and lower traces, respectively). 7
Supplementary Figure 1
Supplementary Figure 1 Miniature microdrive, spike sorting and sleep stage detection. a, A movable recording probe with 8-tetrodes (32-channels). It weighs ~1g. b, A mouse implanted with 8 tetrodes in
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons
Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Drd1a-Cre driven ChR2 expression in the SCN. (a) Low-magnification image of a representative Drd1a-ChR2 coronal brain section (n = 2) showing endogenous tdtomato fluorescence (magenta).
Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
Nature Neuroscience: doi: /nn Supplementary Figure 1. Splenic atrophy and leucopenia caused by T3 SCI.
Supplementary Figure 1 Splenic atrophy and leucopenia caused by T3 SCI. (a) Gross anatomy of representative spleens from control and T3 SCI mice at 28 days post-injury. (b and c) Hematoxylin and eosin
Nature Neuroscience: doi: /nn Supplementary Figure 1. Confirmation that optogenetic inhibition of dopaminergic neurons affects choice
Supplementary Figure 1 Confirmation that optogenetic inhibition of dopaminergic neurons affects choice (a) Sample behavioral trace as in Figure 1d, but with NpHR stimulation trials depicted as green blocks
Supplementary Figure 1
Supplementary Figure 1 Arcuate ChIEF-tdTomato neurons expressed TH These micrographs show that TH-Cre-ChIEF-tdTomato (magenta), expressed by AAV in a TH-Cre mouse, were immunostained with TH (green) in
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g)
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) In four mice, cre-dependent expression of the hyperpolarizing opsin Arch in pyramidal cells
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
Exclusion criteria and outlier detection
1 Exclusion criteria and outlier detection 1 2 Supplementary Fig. 1 31 subjects complied with the inclusion criteria as tested during the familiarization session. The upper part of the figure (ovals) indicates
Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a)
1 Supplementary Figure 1. Microglia do not show signs of classical immune activation following MD a-b. Images showing immunoreactivity for MHCII (a) and CD45 (b) in fixed sections of binocular visual cortex
Lecture 8. Arousal & Sleep. Cogs17 * UCSD
Lecture 8 Arousal & Sleep Cogs17 * UCSD Arousal in the Brain Stimulated by sensory input Initiated, maintained endogenously Basal Forebrain Delivers ACh throughout cortex Arousal in the Brain Lateral Hypothalamus
Tuning properties of individual circuit components and stimulus-specificity of experience-driven changes.
Supplementary Figure 1 Tuning properties of individual circuit components and stimulus-specificity of experience-driven changes. (a) Left, circuit schematic with the imaged component (L2/3 excitatory neurons)
Nature Neuroscience: doi: /nn Supplementary Figure 1. Trial structure for go/no-go behavior
Supplementary Figure 1 Trial structure for go/no-go behavior a, Overall timeline of experiments. Day 1: A1 mapping, injection of AAV1-SYN-GCAMP6s, cranial window and headpost implantation. Water restriction
Supplemental Information. Dorsal Raphe Dual Serotonin-Glutamate Neurons. Drive Reward by Establishing Excitatory Synapses
Cell Reports, Volume 26 Supplemental Information Dorsal Raphe Dual Serotonin-Glutamate Neurons Drive Reward by Establishing Excitatory Synapses on VTA Mesoaccumbens Dopamine Neurons Hui-Ling Wang, Shiliang
Social transmission and buffering of synaptic changes after stress
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0044-6 In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee
EEG Arousals: Scoring Rules and Examples. A Preliminary Report from the Sleep Disorders Atlas Task Force of the American Sleep Disorders Association
EEG Arousals: Scoring Rules and Examples A Preliminary Report from the Sleep Disorders Atlas Task Force of the American Sleep Disorders Association Sleep in patients with a number of sleep disorders and
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
Figure S 1. S1. Histological evaluation of lateral hemisection.
Dorsal Central Ventral Figure S1. Histological evaluation of lateral hemisection. Schematic Figure S1. Histological evaluation of lateral hemisection. Schematic representation of hemisection at. Dashed
Hormonal gain control of a medial preoptic area social reward circuit
CORRECTION NOTICE Nat. Neurosci. 20, 449 458 (2017) Hormonal gain control of a medial preoptic area social reward circuit Jenna A McHenry, James M Otis, Mark A Rossi, J Elliott Robinson, Oksana Kosyk,
Nature Medicine: doi: /nm.4084
Supplementary Figure 1: Sample IEDs. (a) Sample hippocampal IEDs from different kindled rats (scale bar = 200 µv, 100 ms). (b) Sample temporal lobe IEDs from different subjects with epilepsy (scale bar
McWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
Two distinct mechanisms for experiencedependent
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0150-0 In the format provided by the authors and unedited. Two distinct mechanisms for experiencedependent homeostasis Michelle C.
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Hippocampal recordings. a. (top) Post-operative MRI (left, depicting a depth electrode implanted along the longitudinal hippocampal axis) and co-registered preoperative MRI (right)
Ube3a is required for experience-dependent maturation of the neocortex
Ube3a is required for experience-dependent maturation of the neocortex Koji Yashiro, Thorfinn T. Riday, Kathryn H. Condon, Adam C. Roberts, Danilo R. Bernardo, Rohit Prakash, Richard J. Weinberg, Michael
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
Supplementary Figure 1. Nature Neuroscience: doi: /nn.4547
Supplementary Figure 1 Characterization of the Microfetti mouse model. (a) Gating strategy for 8-color flow analysis of peripheral Ly-6C + monocytes from Microfetti mice 5-7 days after TAM treatment. Living
Supplementary information - Table (1), Figures (12), and Videos (5)
Supplementary information - Table (1), Figures (12), and Videos (5) A soft, transparent, freely accessible cranial window for chronic imaging and electrophysiology Chaejeong Heo 1, Hyejin Park 1, 2, Yong-Tae
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Relative expression of K IR2.1 transcript to enos was reduced 29-fold in capillaries from knockout animals. Relative expression of K IR2.1 transcript to enos was reduced 29-fold
EEG Sleep Circadian rhythms Learning Objectives: 121, 122
EEG Sleep Circadian rhythms Learning Objectives: 121, 122 Zoltán Lelkes Electroencenphalography Hans Berger pen time amplifier electrodes 1 The waves of the EEG gamma > 30 Hz beta: 13-30 Hz Mental activity:
Supplementary Figure 1.
Supplementary Figure 1. Transduction of adipocytes after intra-ewat administration of AAV vectors. A: Immunostaining against GFP (green) in sections of ewat two weeks after the intra-ewat administration
F-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
Nature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References
File name: Supplementary Information Description: Supplementary Figures, Supplementary Table and Supplementary References File name: Supplementary Data 1 Description: Summary datasheets showing the spatial
Protocol for Rat Sleep EEG
Protocol for Rat Sleep EEG Subjects Male Spraue Dawley rats weihin 250-300 rams at the time of surery are used. Food and water are available ad libitum throuhout the experiment. Rats are roup housed prior
Nature Neuroscience: doi: /nn Supplementary Figure 1. Distribution of starter cells for RV-mediated retrograde tracing.
Supplementary Figure 1 Distribution of starter cells for RV-mediated retrograde tracing. Parcellation of cortical areas is based on Allen Mouse Brain Atlas and drawn to scale. Thick white curves, outlines
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/3/3/e1600955/dc1 Supplementary Materials for Flexible and stretchable nanowire-coated fibers for optoelectronic probing of spinal cord circuits Chi Lu, Seongjun
Supplementary Figure 1
Supplementary Figure 1 Localization of virus injections. (a) Schematic showing the approximate center of AAV-DIO-ChR2-YFP injection sites in the NAc of Dyn-cre mice (n=8 mice, 16 injections; caudate/putamen,
Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol.
Supplementary Figures 1-11 Supplementary Figure 1: Kv7 currents in neonatal CA1 neurons measured with the classic M- current voltage-clamp protocol. (a), Voltage-clamp recordings from CA1 pyramidal neurons
Rapid blue-light mediated induction of protein interactions in living cells
Nature Methods Rapid blue-light mediated induction of protein interactions in living cells Matthew J Kennedy, Robert M Hughes, Leslie A Peteya, Joel W Schwartz, Michael D Ehlers & Chandra L Tucker Supplementary
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
Sleep. No longer think of sleep as an isolated block of time at the end of the day. Sleep is not just the absence of wakefulness,
Sleep Neil B. Kavey, MD Columbia Presbyterian Medical Center No longer think of sleep as an isolated block of time at the end of the day. Sleep is not just the absence of wakefulness, It is an active physiologic
Sleep. No longer think of sleep as an isolated block of time at the end of the day. Sleep is not just the absence of wakefulness,
Sleep Neil B. Kavey, MD Columbia Presbyterian Medical Center No longer think of sleep as an isolated block of time at the end of the day. Sleep is not just the absence of wakefulness, It is an active physiologic
Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis
Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,
ON-LINE REPOSITORY MATERIAL DIFFERENCES IN SLEEP-INDUCED HYPOXIA BETWEEN A/J AND DBA/2J MOUSE STRAINS
37 ON-LINE REPOSITORY MATERIAL DIFFERENCES IN SLEEP-INDUCED HYPOXIA BETWEEN A/J AND DBA/2J MOUSE STRAINS Arnon E. Rubin, Vsevolod Y. Polotsky, Alex Balbir, Jerry A. Krishnan, Alan R. Schwartz, Philip L.
Deletion of the Mammalian Circadian Clock Gene BMAL1/Mop3 Alters Baseline Sleep Architecture and the Response to Sleep Deprivation
CIRCADIAN RHYTHMS Deletion of the Mammalian Circadian Clock Gene BMAL1/Mop3 Alters Baseline Sleep Architecture and the Response to Sleep Deprivation Aaron Laposky, PhD 1 ; Amy Easton, PhD 1 ; Christine
Structural basis for the role of inhibition in facilitating adult brain plasticity
Structural basis for the role of inhibition in facilitating adult brain plasticity Jerry L. Chen, Walter C. Lin, Jae Won Cha, Peter T. So, Yoshiyuki Kubota & Elly Nedivi SUPPLEMENTARY FIGURES 1-6 a b M
Supplementary Figure 1. Identification of the type II spiral ganglion neurons (SGN) via immunofluorescence of peripherin protein (PRPH).
Supplementary Figure 1. Identification of the type II spiral ganglion neurons (SGN) via immunofluorescence of peripherin protein (PRPH). (a), (b), PRPH immunolabelling of cryosections from post-natal day
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC
1 2 1 3 Supplementary figure 1: LII/III GIN-cells show morphological characteristics of MC 4 5 6 7 (a) Reconstructions of LII/III GIN-cells with somato-dendritic compartments in orange and axonal arborizations
Martínez, Schwartz, Smale & Nunez
I. Artículos Martínez, Schwartz, Smale & Nunez 12 Circadian regulation of daily rhythms in orexinergic neurons Circadian regulation of daily rhythms in orexinergic neurons in diurnal and nocturnal rodents
Nature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Representative images of an in vitro comparison of several AAV serotypes regarding egfp expression in cochlear explants of CBA/CaJ mice. (A-F): Results after incubation at equal
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
Nature Neuroscience: doi: /nn.4335
Supplementary Figure 1 Cholinergic neurons projecting to the VTA are concentrated in the caudal mesopontine region. (a) Schematic showing the sites of retrograde tracer injections in the VTA: cholera toxin
EEG Changes (Research Abstracts)
EEG Changes (Research Abstracts) Kennerly, Richard. QEEG analysis of cranial electrotherapy: a pilot study. Journal of Neurotherapy (8)2, 2004. Presented at the International Society for Neuronal Regulation
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chen et al., http://www.jcb.org/cgi/content/full/jcb.201210119/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Lack of fast reversibility of UVR8 dissociation. (A) HEK293T
EEG Electrode Placement
EEG Electrode Placement Classifying EEG brain waves Frequency: the number of oscillations/waves per second, measured in Hertz (Hz) reflects the firing rate of neurons alpha, beta, theta, delta Amplitude:
Supplemental Information. Melanopsin-Encoded Response Properties. of Intrinsically Photosensitive. Retinal Ganglion Cells
Neuron, Volume 90 Supplemental Information Melanopsin-Encoded Response Properties of Intrinsically Photosensitive Retinal Ganglion Cells Ludovic S. Mure, Megumi Hatori, Quansheng Zhu, James Demas, Irene
Normal sleep mechanisms & why do we sleep?
4 rd Congress of the European Academy of Neurology Lisbon, Portugal, June 16-19, 2018 Teaching Course 18 Basics of sleep medicine - Level 1 Normal sleep mechanisms & why do we sleep? Rolf Fronczek Leiden,
Supplemental Information. A Labeled-Line Neural Circuit. for Pheromone-Mediated Sexual Behaviors in Mice
Neuron, Volume Supplemental Information A Labeled-Line Neural Circuit for Pheromone-Mediated Sexual Behaviors in Mice Kentaro K. Ishii, Takuya Osakada, Hiromi Mori, Nobuhiko Miyasaka, Yoshihiro Yoshihara,
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
John Nguyen, Nozomi Nishimura, Robert Fetcho, Costantino Iadecola, Chris B. Schaffer
Supplemental figures and text for Occlusion of cortical ascending venules causes blood flow decreases, reversals in flow direction, and vessel dilation in upstream capillaries John Nguyen, Nozomi Nishimura,
Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.
Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Source localisation in the clinical practice: spontaneous EEG examinations with LORETA. Ph.D. thesis. Márton Tamás Tóth M.D.
Source localisation in the clinical practice: spontaneous EEG examinations with LORETA Ph.D. thesis Márton Tamás Tóth M.D. Department of Neurology, University of Pécs Leader of project:: Prof. István Kondákor,
Nature Neuroscience: doi: /nn.4642
Supplementary Figure 1 Recording sites and example waveform clustering, as well as electrophysiological recordings of auditory CS and shock processing following overtraining. (a) Recording sites in LC
Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/10/e1500775/dc1 Supplementary Materials for Structural-functional connectivity deficits of neocortical circuits in the Fmr1 /y mouse model of autism Matthias
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature12024 entary Figure 1. Distribution of the number of earned cocaine Supplementary Figure 1. Distribution of the number of earned cocaine infusions in Shock-sensitive
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).
SLEEP STAGING AND AROUSAL. Dr. Tripat Deep Singh (MBBS, MD, RPSGT, RST) International Sleep Specialist (World Sleep Federation program)
SLEEP STAGING AND AROUSAL Dr. Tripat Deep Singh (MBBS, MD, RPSGT, RST) International Sleep Specialist (World Sleep Federation program) Scoring of Sleep Stages in Adults A. Stages of Sleep Stage W Stage
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Subcellular segregation of VGluT2-IR and TH-IR within the same VGluT2-TH axon (wild type rats). (a-e) Serial sections of a dual VGluT2-TH labeled axon. This axon (blue outline) has
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Physiology Unit 2 CONSCIOUSNESS, THE BRAIN AND BEHAVIOR
Physiology Unit 2 CONSCIOUSNESS, THE BRAIN AND BEHAVIOR In Physiology Today What the Brain Does The nervous system determines states of consciousness and produces complex behaviors Any given neuron may
Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex
Supplementary Information Unique functional properties of somatostatin-expressing GABAergic neurons in mouse barrel cortex Luc Gentet, Yves Kremer, Hiroki Taniguchi, Josh Huang, Jochen Staiger and Carl
Dopamine in Ube3a m-/p+ mice. Online Supplemental Material
Online Supplemental Material S1 Supplemental Figure 1. Schematic of rate-dependent intracranial self-stimulation (ICSS) (A) Mice implanted with monopolar stimulating electrodes to the medial forebrain
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in
Sleep stages. Awake Stage 1 Stage 2 Stage 3 Stage 4 Rapid eye movement sleep (REM) Slow wave sleep (NREM)
Sleep stages Awake Stage 1 Stage 2 Stage 3 Stage 4 Rapid eye movement sleep (REM) Slow wave sleep (NREM) EEG waves EEG Electrode Placement Classifying EEG brain waves Frequency: the number of oscillations/waves
Neuroscience Optional Lecture. The limbic system the emotional brain. Emotion, behaviour, motivation, long-term memory, olfaction
Neuroscience Optional Lecture The limbic system the emotional brain Emotion, behaviour, motivation, long-term memory, olfaction Emotion Conscious experience intense mental activity and a certain degree
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Nature Neuroscience: doi: /nn Supplementary Figure 1. Lick response during the delayed Go versus No-Go task.
Supplementary Figure 1 Lick response during the delayed Go versus No-Go task. Trial-averaged lick rate was averaged across all mice used for pyramidal cell imaging (n = 9). Different colors denote different
SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,
Neurophysiology & EEG
Neurophysiology & EEG PG4 Core Curriculum Ian A. Cook, M.D. Associate Director, Laboratory of Brain, Behavior, & Pharmacology UCLA Department of Psychiatry & Biobehavioral Sciences Semel Institute for
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
Specimen. Humeral Head. Femoral Head. Objective. Femoral Condyle (medial) Supplementary Figure 1
A B Specimen Humeral Head 2 1 µm 76 µm Femoral Head Objective Femoral Condyle (medial) Supplementary Figure 1 A Femoral Head Global Cell Density Superficial Cell Density Cell Number at 1 µm Nuclei /.1
Summary of behavioral performances for mice in imaging experiments.
Supplementary Figure 1 Summary of behavioral performances for mice in imaging experiments. (a) Task performance for mice during M2 imaging experiments. Open triangles, individual experiments. Filled triangles,
Supplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
Title. Author(s)Ono, Daisuke; Honma, Ken-Ichi; Honma, Sato. CitationScientific reports, 5: Issue Date Doc URL
Title Circadian and ultradian rhythms of clock gene expres Author(s)Ono, Daisuke; Honma, Ken-Ichi; Honma, Sato CitationScientific reports, 5: 31 Issue Date 215-7-21 Doc URL http://hdl.handle.net/2115/59574
doi: /nature09554
SUPPLEMENTARY INFORMATION doi:10.1038/nature09554 Supplementary Figure 1: Optical Tracing with New Photoactivatable GFP Variants Reveals Enhanced Labeling of Neuronal Processes We qualitatively compare
Microarray profiling of gene expression after sleep deprivation and recovery sleep 03/05/2008
Microarray profiling of gene expression after sleep deprivation and recovery sleep 03/05/2008 1. OVERVIEW...1 2. BEHAVIORAL CONDITIONS...1 3. LASER MICRODISSECTION/MICROARRAY...2 3.1. REGIONS OF INTEREST...
Suppl. Information Supplementary Figure 1. Strategy/latency analysis of individual mice during maze learning. a,
Goal-oriented searching mediated by ventral hippocampus early in trial-and-error learning Ruediger, S, Spirig, D., Donato, F., Caroni, P. Suppl. Information Supplementary Figure 1. Strategy/latency analysis
CONTROL OF MOVEMENT BY THE BRAIN A. PRIMARY MOTOR CORTEX:
CONTROL OF MOVEMENT BY THE BRAIN A. PRIMARY MOTOR CORTEX: - responsible for - like somatosensory cortex, primary motor cortex show (motor homunculus) - amount of cortex devoted to different parts of body
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Short latency of the fepsp evoked in CA3 by electrical stimulation of perforant path inputs (a) Single and superimposed representative perforant pathway-ca3
Nov versus Fam. Fam 1 versus. Fam 2. Supplementary figure 1
a Environment map similarity score (mean r ).5..3.2.1 Fam 1 versus Fam 2 Nov versus Fam b Environment cofiring similarity score (mean r ).7.6.5..3.2.1 Nov versus Fam Fam 1 versus Fam 2 First half versus
SUPPLEMENTARY INFORMATION
doi:1.138/nature1139 a d Whisker angle (deg) Whisking repeatability Control Muscimol.4.3.2.1 -.1 8 4-4 1 2 3 4 Performance (d') Pole 8 4-4 1 2 3 4 5 Time (s) b Mean protraction angle (deg) e Hit rate (p