Accessing and Using ENCODE Data Dr. Peggy J. Farnham
|
|
- Jennifer Atkinson
- 5 years ago
- Views:
Transcription
1 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000 genes 2001 First guess for human genes 100, , genome draft up to 40,000 genes : ~20,000 genes The ENCODE project Encyclopedia of DNA Elements Goal: delineate all functional elements in the human genome 3 1
2 Accessing and using ENCODE data What are ENCODE assays What has been learned so far How to access ENCODE data How to use ENCODE data 4 Advantages of studying the genome in a large consortium 1) Publicly available datasets 2) Integrative analysis of many assays from different groups using the same cells 3) Development of standards and guidelines
3 ENCODE assays Open chromatin Gene expression 3D looping TF binding 7 ENCODE assay: RNA-seq Fragment RNA Convert to cdna add sequencing adapters 8 Unbiased analysis of known and novel RNAs Both coding and non-coding RNAs can be studied Differential exon usage can be identified Strand-specific analyses can distinguish transcripts ENCODE assay: ChIP-seq 1400 site-specific DNA binding proteins Very few have been well-characterized Nature Reviews Genetics10, , Less false positives than bioinformatic methods Less false negatives than motif searching De novo motif discovery Can distinguish members of transcription factor families 3
4 Evolution of the ChIP assay Crosslink proteins to DNA Sonicate chromatin Immunoprecipitate Reverse crosslinks Purify DNA ChIP-PCR ChIP-chip ChIP-seq : PCR actcatgcatgaaacctgacgcagg ccgtatcgatgaggaqtctctcagga : ENCODE ChIP-chip 2007: ENCODE ChIP-seq ENCODE assays: regulatory chromatin ChIP-seq DNase-seq FAIRE-seq Open chromatin 11 ChIP-seq of modified histones Antibodies to active chromatin Promoters: H3K4me3, H3K9Ac Enhancers: H3K4me1, H3K27Ac Elongation: H3K36me3, H3K79me2 Antibodies to silent chromatin H3K27me3, H3K9me3 12 4
5 Comparison of DNase-seq, FAIRE-seq, modified histones, and TF binding DNase-seq FAIRE-seq TF ChIP-seq H3K4me3 H3K9Ac H3K27Ac 13 ENCODE assays: 3D looping 14 3C: examines a small number of regions; TF involved is not known 4C: can be used to find everything that interacts with a specific region 5C: higher throughput, sequencing-based version of 3C ChIA-PET: identifies loops mediated by a specific TF; Genome-wide HiC: can map all possible interactions; TF involved is not known Accessing and using ENCODE data What is ENCODE What has been learned so far How to access ENCODE data How to use ENCODE data 15 5
6 An integrated encyclopedia of DNA elements in the human genome Nature 489: 57-74, cell lines/tissues Jan 2011 data freeze 3,010 experiments 5 tera bases 1716x of the human genome 16 GM12878 K562 H1-Hesc HeLa-S3 HepG2 Huvec 164 assays (114 different Chip) Insights from ENCODE Information density Genes and transcripts Chromatin Transcription factors Relationship between regulatory elements and genetic variation 17 Density of information encoded in the human genome A functional element is a discrete genomic region that encodes a defined product or displays a reproducible biochemical signature 80% is in use; 62% is covered by RNA molecules >200 nts in length 95% lies within 8 kb of a DNAprotein interaction 18 RNA transcripts> histone marks> DHS> TF ChIP-seq peaks> TF bound motifs> exons 6
7 Protein coding transcripts There are 20,687 coding genes Average of 6.3 transcripts/gene Average of 3.9 different proteins/gene Longest transcript: 100,272 nt Most spliced isoforms: a b c Comparison of coding and non-coding RNAs Protein-coding RNAs 20,687 different coding genes Longest coding RNA: 100,272 nt Most spliced isoforms: 65 Non-coding RNAs 8801 small RNAs 9640 long RNAs Longest non-coding RNA: 29,517 nt Most spliced isoforms: Open chromatin 2.89 million unique DHS ~200,000 DHS/cell line ~1% of the genome in a cell type ~4% of the genome in aggregate ~98% of ChIP-seq TF peaks are in a DHS 21 7
8 Chromatin modifications that influence gene expression Relative contribution to R^2 (regression) H3K79me2 H3K9Ac, H3K4me3 H3K27me3, H3K9me3 22 Classification of transcription factors Enhancer element Core promoter Core promoter Common sites Proximal promoter Proximal sites 23 Cell type-specific Nat Rev Genet10: , 2009 Distal sites Binding preferences of TFs GATA2: mostly distal sites AP2 gamma : mix of proximal and distal sites E2F4: very TSS-centric 24 Percentage within 1 kb of a TSS 8
9 Chromosomal loops 5C analysis of 1% of the genome in 4 cell types Average number of distal elements interacting with a TSS= 3.9 A gene can be regulated by multiple enhancers Average number of TSSs interacting with a distal element= An enhancer can regulate multiple genes ENCODE elements are linked to genetic variation 4492 GWAS SNPs: 34% overlap DNAse HS 26 Nature 489: 57-74,
10 Accessing and using ENCODE data What is ENCODE What has been learned so far How to access ENCODE data How to use ENCODE data 28 Visualizing ENCODE data
11 31 Snapshot of the ENCODE tracks on the UCSC browser 32 ENCODE tracks 33 11
12 How to access tables listing ENCODE data Experiment summary 36 12
13 Downloading ENCODE data ENCODE user s guide PLOS Biol 9:e ,
14 Using ENCODE data What is ENCODE What has been learned so far How to access ENCODE data How to use ENCODE data 40 Scenario #1: understanding ChIP-seq results How can ENCODE data provide information about the function of my favorite transcription factor? 41 ENCODE standards for ChIP-seq You ve just performed a ChIP-seq experiment for your favorite TF Is the ChIP-seq data of high quality? Choosing a peak cut-off 42 14
15 Reproducibility and peak cut-off Epigenetics Chromatin 6:13, 2103 *12,543 peaks called on the merged dataset* Comparing a ChIP-seq peak file to other ENCODE datasets 1) Create a ChIP-seq peak file with genomic coordinates ENCODE default: SPP and Peak-seq 2) Download BAM files from ENCODE ChIP-seq datasets for other TFs ChIP-seq datasets for modified histones 3) Create tag directories of each file using the maketagdirectory script in HOMER: 4) Map the density of sequenced tags from each dataset relative to the center of your called peaks file using annotatepeaks in HOMER Tag density plots of ChIP-seq data Pol2 H3K9ac H3K27me
16 Analysis of target genes Classification of a TF Gene ontology analysis Expression levels of nearest genes Motif analysis: Factorbook Sequence features and chromatin states around ENCODE TF peak sets 47 An example from FactorBook 48 16
17 ZBTB33 sequence logos Motif1 M1 M2 M3 M4 M5 Flanking-L Flanking-R 49 Scenario #2: understanding GWAS results You ve identified a genomic region of interest using GWAS How can I get an overview of the biochemical activity in this region? How can I find the important regulatory elements? 50 Overview of the genomic landscape rs around a risk SNP rs &c=chr8&g=wgEncodeReg 17
18 Tag SNPs & functional SNPs GWAS Tag SNP High LD region Functional element Tag SNP SNPs statistically associated with the phenotype fsnp SNP associated with the phenotype AND in a regulatory region HaploReg RegulomeDB 52 FunciSNP FunciSNP 53 Example of FunciSNP workflow: Defining cancer risk enhancers Cancer tag SNPs Genomic window (+/-200kb) around tag SNPs Extract all known SNPs from 1000 genome database Merge all SNPs with genomic feature: find overlaps ChIP-seq data Peak calling H3K4me1 H3K27Ac H3K4me3 Genomic features H3K27Ac peak file H3K4me1 peak file H3K4me3 peak file 54 Select correlated SNPs: measure of LD (r 2 >0.5) Functional SNPs 18
19 Identification of functional SNPs Tag SNP Enhancer SNPs H3K27Ac ChIP-seq 55 Summary: accessing and using ENCODE data What is ENCODE What has been learned so far How to access ENCODE data How to use ENCODE data
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationProcessing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data
Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To
More informationRaymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012
Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationSession 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016
Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More informationPeak-calling for ChIP-seq and ATAC-seq
Peak-calling for ChIP-seq and ATAC-seq Shamith Samarajiwa CRUK Autumn School in Bioinformatics 2017 University of Cambridge Overview Peak-calling: identify enriched (signal) regions in ChIP-seq or ATAC-seq
More informationChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationSupplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
More informationMechanisms of alternative splicing regulation
Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.
More informationChIP-seq analysis. J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand
ChIP-seq analysis J. van Helden, M. Defrance, C. Herrmann, D. Puthier, N. Servant, M. Thomas-Chollier, O.Sand Tuesday : quick introduction to ChIP-seq and peak-calling (Presentation + Practical session)
More informationHistone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells
Histone Modifications Are Associated with Transcript Isoform Diversity in Normal and Cancer Cells Ondrej Podlaha 1, Subhajyoti De 2,3,4, Mithat Gonen 5, Franziska Michor 1 * 1 Department of Biostatistics
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationComputational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
More informationHigh Throughput Sequence (HTS) data analysis. Lei Zhou
High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Expression deviation of the genes mapped to gene-wise recurrent mutations in the TCGA breast cancer cohort (top) and the TCGA lung cancer cohort (bottom). For each gene (each pair
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationcis-regulatory enrichment analysis in human, mouse and fly
cis-regulatory enrichment analysis in human, mouse and fly Zeynep Kalender Atak, PhD Laboratory of Computational Biology VIB-KU Leuven Center for Brain & Disease Research Laboratory of Computational Biology
More informationHeintzman, ND, Stuart, RK, Hon, G, Fu, Y, Ching, CW, Hawkins, RD, Barrera, LO, Van Calcar, S, Qu, C, Ching, KA, Wang, W, Weng, Z, Green, RD,
Heintzman, ND, Stuart, RK, Hon, G, Fu, Y, Ching, CW, Hawkins, RD, Barrera, LO, Van Calcar, S, Qu, C, Ching, KA, Wang, W, Weng, Z, Green, RD, Crawford, GE, Ren, B (2007) Distinct and predictive chromatin
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationResearch Article Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq Data
BioMed Volume 2016, Article ID 2395341, 6 pages http://dx.doi.org/10.1155/2016/2395341 Research Article Identifying Liver Cancer-Related Enhancer SNPs by Integrating GWAS and Histone Modification ChIP-seq
More informationTranscript-indexed ATAC-seq for immune profiling
Transcript-indexed ATAC-seq for immune profiling Technical Journal Club 22 nd of May 2018 Christina Müller Nature Methods, Vol.10 No.12, 2013 Nature Biotechnology, Vol.32 No.7, 2014 Nature Medicine, Vol.24,
More informationAssignment 5: Integrative epigenomics analysis
Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What
More informationREVIEWERS' COMMENTS: Reviewer #1 (Remarks to the Author):
Editorial Note: this manuscript has been previously reviewed at another journal that is not operating a transparent peer review scheme. This document only contains reviewer comments and rebuttal letters
More informationYingying Wei George Wu Hongkai Ji
Stat Biosci (2013) 5:156 178 DOI 10.1007/s12561-012-9066-5 Global Mapping of Transcription Factor Binding Sites by Sequencing Chromatin Surrogates: a Perspective on Experimental Design, Data Analysis,
More informationSudin Bhattacharya Institute for Integrative Toxicology
Beyond the AHRE: the Role of Epigenomics in Gene Regulation by the AHR (or, Varied Applications of Computational Modeling in Toxicology and Ingredient Safety) Sudin Bhattacharya Institute for Integrative
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationDiscovery of Novel Human Gene Regulatory Modules from Gene Co-expression and
Discovery of Novel Human Gene Regulatory Modules from Gene Co-expression and Promoter Motif Analysis Shisong Ma 1,2*, Michael Snyder 3, and Savithramma P Dinesh-Kumar 2* 1 School of Life Sciences, University
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationAn epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationThe Insulator Binding Protein CTCF Positions 20 Nucleosomes around Its Binding Sites across the Human Genome
The Insulator Binding Protein CTCF Positions 20 Nucleosomes around Its Binding Sites across the Human Genome Yutao Fu 1, Manisha Sinha 2,3, Craig L. Peterson 3, Zhiping Weng 1,4,5 * 1 Bioinformatics Program,
More informationA Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
More informationMIR retrotransposon sequences provide insulators to the human genome
Supplementary Information: MIR retrotransposon sequences provide insulators to the human genome Jianrong Wang, Cristina Vicente-García, Davide Seruggia, Eduardo Moltó, Ana Fernandez- Miñán, Ana Neto, Elbert
More informationMODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
More informationChromatin marks identify critical cell-types for fine-mapping complex trait variants
Chromatin marks identify critical cell-types for fine-mapping complex trait variants Gosia Trynka 1-4 *, Cynthia Sandor 1-4 *, Buhm Han 1-4, Han Xu 5, Barbara E Stranger 1,4#, X Shirley Liu 5, and Soumya
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/156973
More informationR2 Training Courses. Release The R2 support team
R2 Training Courses Release 2.0.2 The R2 support team Nov 08, 2018 Students Course 1 Student Course: Investigating Intra-tumor Heterogeneity 3 1.1 Introduction.............................................
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationGenome Control in Cell Identity and Disease! Development and cell identity Loss of cell identity and disease New diagnostics and therapeutics
Genome Control in Cell Identity and Disease! Development and cell identity Loss of cell identity and disease New diagnostics and therapeutics Development and cell identity! 30,000,000,000 cells!! Control
More informationSTAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
More informationTutorial. ChIP Sequencing. Sample to Insight. September 15, 2016
ChIP Sequencing September 15, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com ChIP Sequencing
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationGenome-wide Association Studies (GWAS) Pasieka, Science Photo Library
Lecture 5 Genome-wide Association Studies (GWAS) Pasieka, Science Photo Library Chi-squared test to evaluate whether the odds ratio is different from 1. Corrected for multiple testing Source: wikipedia.org
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationExploring chromatin regulation by ChIP-Sequencing
Exploring chromatin regulation by ChIP-Sequencing From datasets quality assessment, enrichment patterns identification and multi-profiles integration to the reconstitution of gene regulatory wires describing
More informationBroad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes
Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,
More informationEXPression ANalyzer and DisplayER
EXPression ANalyzer and DisplayER Tom Hait Aviv Steiner Igor Ulitsky Chaim Linhart Amos Tanay Seagull Shavit Rani Elkon Adi Maron-Katz Dorit Sagir Eyal David Roded Sharan Israel Steinfeld Yossi Shiloh
More informationA novel ATAC-seq approach reveals lineage-specific reinforcement of the open chromatin landscape via cooperation between BAF and p63
Bao et al. Genome Biology (2015) 16:284 DOI 10.1186/s13059-015-0840-9 RESEARCH A novel ATAC-seq approach reveals lineage-specific reinforcement of the open chromatin landscape via cooperation between BAF
More informationChip Seq Peak Calling in Galaxy
Chip Seq Peak Calling in Galaxy Chris Seward PowerPoint by Pei-Chen Peng Chip-Seq Peak Calling in Galaxy Chris Seward 2018 1 Introduction This goals of the lab are as follows: 1. Gain experience using
More informationMODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationPart-II: Statistical analysis of ChIP-seq data
Part-II: Statistical analysis of ChIP-seq data Outline ChIP-seq data, features, detailed modeling aspects (today). Other ChIP-seq related problems - overview (next lecture). IDR (next lecture) Stat 877
More informationThe epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response
Abstract # 319030 Poster # F.9 The epigenetic landscape of T cell subsets in SLE identifies known and potential novel drivers of the autoimmune response Jozsef Karman, Brian Johnston, Sofija Miljovska,
More informationStatistical Genetics. Matthew Stephens. Statistics Retreat, October 26th 2012
Statistical Genetics Statistics Retreat, October 26th 2012 Two stories The two most influential statistical ideas in analysis of genetic association studies. 1 Sequence, sequence, everywhere. 1 With apologies
More informationPackage NarrowPeaks. August 3, Version Date Type Package
Package NarrowPeaks August 3, 2013 Version 1.5.0 Date 2013-02-13 Type Package Title Analysis of Variation in ChIP-seq using Functional PCA Statistics Author Pedro Madrigal , with contributions
More informationUse Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types. Epigenome Informatics Workshop Bioinformatics Research Laboratory
Use Case 9: Coordinated Changes of Epigenomic Marks Across Tissue Types Epigenome Informatics Workshop Bioinformatics Research Laboratory 1 Introduction Active or inactive states of transcription factor
More informationBig Data Training for Translational Omics Research. Session 1, Day 3, Liu. Case Study #2. PLOS Genetics DOI: /journal.pgen.
Session 1, Day 3, Liu Case Study #2 PLOS Genetics DOI:10.1371/journal.pgen.1005910 Enantiomer Mirror image Methadone Methadone Kreek, 1973, 1976 Methadone Maintenance Therapy Long-term use of Methadone
More informationEukaryotic transcription (III)
Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids
More informationThe corrected Figure S1J is shown below. The text changes are as follows, with additions in bold and deletions in bracketed italics:
Correction H3K4me3 readth Is Linked to Cell Identity and Transcriptional Consistency érénice A. enayoun, Elizabeth A. Pollina, Duygu Ucar, Salah Mahmoudi, Kalpana Karra, Edith D. Wong, Keerthana Devarajan,
More informationChipSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation
Center for Biomics ChipSeq Technique and science The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Wilfred van IJcken Sequencing Seminar Illumina September 8 Scheme
More informationUniversity of Pittsburgh Annual Progress Report: 2008 Formula Grant
University of Pittsburgh Annual Progress Report: 2008 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Research Project 1: Project Title and Purpose Small Molecule Inhibitors of HIV Nef Signaling
More informationUser Guide. Association analysis. Input
User Guide TFEA.ChIP is a tool to estimate transcription factor enrichment in a set of differentially expressed genes using data from ChIP-Seq experiments performed in different tissues and conditions.
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationThe search for cis-regulatory driver mutations in cancer genomes
/, Vol. 6, No. 32 The search for cis-regulatory driver mutations in cancer genomes Rebecca C. Poulos 1, Mathew A. Sloane 1, Luke B. Hesson 1, Jason W. H. Wong 1 1 Prince of Wales Clinical School and Lowy
More informationCTCF-Mediated Functional Chromatin Interactome in Pluripotent Cells
SUPPLEMENTARY INFORMATION CTCF-Mediated Functional Chromatin Interactome in Pluripotent Cells Lusy Handoko 1,*, Han Xu 1,*, Guoliang Li 1,*, Chew Yee Ngan 1, Elaine Chew 1, Marie Schnapp 1, Charlie Wah
More informationAnalyse de données de séquençage haut débit
Analyse de données de séquençage haut débit Vincent Lacroix Laboratoire de Biométrie et Biologie Évolutive INRIA ERABLE 9ème journée ITS 21 & 22 novembre 2017 Lyon https://its.aviesan.fr Sequencing is
More informationPatterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationGenome-wide relationship between histone H3 lysine 4 mono- and tri-methylation and transcription factor binding
Letter Genome-wide relationship between histone H3 lysine 4 mono- and tri-methylation and transcription factor binding A. Gordon Robertson, 1,4 Mikhail Bilenky, 1,4 Angela Tam, 1 Yongjun Zhao, 1 Thomas
More informationChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs
ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand
More informationChIPSeq. Technique and science. The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation
Center for Biomics ChIPSeq Technique and science The genome wide dynamics of the binding of ldb1 complexes during erythroid differentiation Wilfred van IJcken EU Sequencing Seminar Illumina June 16 Genomics
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More informationYue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1
Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos
More informationOpen Access RESEARCH. Background Malaria is a major public health problem in many developing countries, with the parasite Plasmodium
Karmodiya et al. Epigenetics & Chromatin (215) 8:32 DOI 1.1186/s1372-15-29-1 RESEARCH Open Access A comprehensive epigenome map of Plasmodium falciparum reveals unique mechanisms of transcriptional regulation
More informationSupplemental Materials
Supplemental Materials Sequence Features and Chromatin Structure around the Genomic Regions Bound by 119 Human Transcription Factors Running title: Analysis of Sites of 119 TFs in the Human Genome Jie
More informationH3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells
Nucleic Acids Research, 2017 1 doi: 10.1093/nar/gkx251 H3K4 demethylase KDM5B regulates global dynamics of transcription elongation and alternative splicing in embryonic stem cells Runsheng He 1,2 and
More informationNature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
More informationAnnotation of Functional Regulatory Elements in Livestock Species
Annotation of Functional Regulatory Elements in Livestock Species Midwest ASAS March 17, 2015 Huaijun Zhou 1, Pablo Ross 1, Ian Korf 1, Mary Delany 1, Hans Cheng 2, Juan Medrano 1, Alison Van Eenennaam
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationSupplementary Figure 1. Nature Genetics: doi: /ng.3736
Supplementary Figure 1 Genetic correlations of five personality traits between 23andMe discovery and GPC samples. (a) The values in the colored squares are genetic correlations (r g ); (b) P values of
More informationSupplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
More informationHeritability enrichment of differentially expressed genes. Hilary Finucane PGC Statistical Analysis Call January 26, 2016
Heritability enrichment of differentially expressed genes Hilary Finucane PGC Statistical Analysis Call January 26, 2016 1 Functional genomics + GWAS gives insight into disease relevant tissues Trynka
More informationHistones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
More informationRNA- seq Introduc1on. Promises and pi7alls
RNA- seq Introduc1on Promises and pi7alls DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different func1onal RNAs Which RNAs (and some1mes
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationthe reaction was stopped by adding glycine to final concentration 0.2M for 10 minutes at
Supplemental Material Material and Methods. ChIP. Cells were crosslinked with formaldehyde 0.4% for 10 min at room temperature and the reaction was stopped by adding glycine to final concentration 0.2M
More informationAllelic reprogramming of the histone modification H3K4me3 in early mammalian development
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ
More informationIntegrated analysis of sequencing data
Integrated analysis of sequencing data How to combine *-seq data M. Defrance, M. Thomas-Chollier, C. Herrmann, D. Puthier, J. van Helden *ChIP-seq, RNA-seq, MeDIP-seq, Transcription factor binding ChIP-seq
More informationComputational Modeling of mirna Biogenesis
Computational Modeling of mirna Biogenesis Brian Caffrey and Annalisa Marsico Abstract Over the past few years it has been observed, thanks in no small part to high-throughput methods, that a large proportion
More information