Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney

Transcription

1 Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney

2 Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary thyroid cancer (PTC) is the most prevalent Females Males Source: Cancer Council NSW Briseis et al; International patterns and trends in thyroid cancer incidence,

3 Diagnosis of thyroid cancer Nodule found palpable or incidentally detected by ultrasound, CT or doppler Fine needle aspiration (FNA) cells collected FNA Cytology Diagnosis Benign Indeterminate Surgery Malignant Surgery

4 Papillary thyroid cancer (PTC) : Treatment and prognosis Treatment: surgical thyroid removal, radioiodine therapy, monitoring of thyroglobulin and life long supplementation of T4 Prognosis: 5 year survival rate >90% Recurrence: 0-30% -Cervical (neck) lymph node metastases 0-35% Absence of lymph node metastases a predictor of survival in patients > 45 years old

5 Diagnosis of thyroid cancer Nodule found Fine needle aspiration (FNA) cells collected FNA cytology diagnosis + molecular diagnosis Benign Indeterminate Malignant Surgery Surgery

6 Cytology Bethesda classifications I Non diagnostic or unsatisfactory II III IV V VI Atypia of undetermined significance Follicular lesion of undetermined significance Suspicious for malignancy Malignant ~ 35% (varies with institution world wide)

7 Molecular analysis to complement cytology Bethesda category II Benign III 1) Clarify diagnosis IV V VI Malignant 2) Predict aggressive tumours and guide surgery - some DNA mutations are associated with metastasis

8 Molecular analysis to confirm cancer Surgical risk FNA Bethesda III, IV, V Diagnostic hemi thyroidectomy Total thyroidectomy +/- Lymph node dissection Positive molecular result Negative molecular result? Surgery avoided

9 Molecular markers for thyroid cancer DNA mutations BRAF, NRAS, KRAS Gene rearrangements RET/PTC, PAX8- PPARG Micro RNA (mirna) short (~25bp) non coding RNAs which bind mrna and regulate translation

10 MAPK pathway Cell proliferation, growth, survival Image from Nikiforov & Nikiforova, Nat Rev Endo 2011:1: , Ciampi et al., J. Clin. Invest :

11 Common gene mutations by cancer type Papillary thyroid cancer (variants) Classic Follicular Tall Cell 1. BRAF 1. RAS 1. BRAF 1. RAS Follicular thyroid cancer 2. RET/PTC 2. BRAF 2. RET/PTC 2. PAX8/PPARγ

12 BRAF DNA mutations Chromosome 7 exon 15 BRAF V600E (most common) - nucleotide position 1799 T A GCT ACA GTG AAA TCT A Valine Glutamic acid Papillary thyroid cancer variants Classic (~60% BRAF+) Follicular (~10% BRAF+)

13 Single gene mutation testing - limitations Papillary thyroid cancer population Mutation +ve Mutation -ve Individual tumour mutation +ve cells within tumour = 2%, 50%, 100%? Assay sensitivity is important

14 BRAF incidence rates in PTC World wide incidence rates range from ~ 35% to 85% -Population - BRAF detection method sensitivity Population Incidence Reference Sydney AUS 59% RPAH ongoing O Neil et al. Surgery Dec 2010: Cincinnati USA 53% Nikiforov et al J Clin Endo Metab 2009: 94(6): Korea % Han et al. Ann Surg Treat Res 2014: 87(4):174-9, Kim et al J Clin End Metab 95:

15 Molecular analysis of papillary thyroid cancer current research 1. BRAF testing of FNAs to aid diagnosis and clinical decisions 2. BRAF association with lymph node metastases 3. mirna profile expression changes

16 Methods: BRAF mutation testing DNA extraction followed by Sequencing PCR melt curve analysis PCR mutation targeted primers

17 PCR melt curve analysis AGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGT 2 probes target the normal sequence Probes anneal to the template at specific temperatures and fluoresce when together At higher temperatures, probes dissociate and the signal drops BRAF mutant templates have lower annealing temperatures Heterozygous templates have two melting peaks Nikiforov et al 2009 J Clin Endo Metab 94(6):

18 Amoy Dx kit ADx ARMS technology Patented two-step PCR amplification procedure with fluorescent probes Primers target mutated sequence Positive result Pos control: green Sample: red C t <28

19 BRAF status of FNA samples Cytology BRAF result Histology Negative 2 BRAF - 2 Benign Indeterminate 1 BRAF+ 1 PTC No false positives 35 BRAF- 5 PTC, 1 FC, 29 Benign Suspicious 6 BRAF+ 6 PTC 8 BRAF - 7 PTC, 1 Benign Bethesda V Malignant 9 BRAF+ 9 PTC 1 BRAF- 1 PTC Bethesda VI

20 Clinical relevance of a BRAF+ result Surgical risk FNA Bethesda V,VI Diagnostic hemi thyroidectomy Total thyroidectomy +/- lymph node dissection +BRAF BRAF and lymph node metastases?

21 BRAF and lymph node metastasis Papillary thyroid cancer patients n = 22 Thyroid BRAF Lymph BRAF Number of patients % Conclusion: BRAF+ is associated with lymph node metastasis in 50% of cases. How does this compare to other studies? USA: 55% of BRAF+ patients had lymph node metastasis deemed a high incidence by authors (n=1510, Yip et al Ann Surg 262 (3):

22 Clinicopathological features of BRAF+ PTC Study Lymph node metastases Extrathyroidal invasion Reference China (n = 543) Seoul Korea (n=3107) Seoul Korea (n=71) Victoria, Australia (n=148) No (67%) Yes Yang et al Int J Endo 2015: pre-pub Yes (2-4cm) (81%, p<0.05) Yes (50% p<0.05) - Kim et al Head Neck 2015: pre-pub - So et al Otolaryngol Head Neck Surg 2011: 145:422-7 No (46%) - Mond et al Int Med J 2014: 44:

23 Other potential molecular markers for aggressive tumours RET/PTC associated with frequent lymph node metastases RAS mutation in follicular thyroid cancer associated with invasive histology and distant metastases Expert Reviews of Molecular Diagnostics (1): 83-89

24 Micro RNAs (mirnas) Negative regulation of translation Ribosome mirna Can target oncogenes and tumour suppressor genes mirna target gene mirna target gene

25 Proliferation Cell cycle progression Cell migration mirna profiles in thyroid tissue PTC mir-146 mir-146b mir-181b mir-221 mir-222 mir-7 mir-144 mir-34b FTC mir-183 mir-146b mir-221 mir-222 mir-199 Extra thyroidal invasion, tumour size, lymph node metastases: mir-146, mir- 221, mir-222 Cancer recurrence: mir-146b, mir-222 mir-34b mir-130b Multifocal lesions: mir- let-e

26 Diagnosis of PTC by circulating mirnas in serum/plasma Altered mirna expression mir-146b, mir-155, mir-222 mir-146a mir-190, mir-579, mir- 95, mir-29b Reference Lee et al Oral Oncol 2015; 51:77-83, Lee et al Cancer 2013: 119: Sun et al Cancer biomark 2015;15:33-40 Cantara et al J Clin Endocrinol Metab 2014; 99: Circulating mirnas can predict PTC complications mirna and complication mir-155 lymph node metastases Reference Lee et al Oral Oncol 2015; 51:77-83

27 Limitations of single target molecular testing Not all cases have the same single point mutation or mirna profile Single point mutations are often mutually exclusive

28 Molecular diagnostic panels; FNA Panels combine DNA mutations and mirnas (ThygenX) ThyraMIR) Bethesda III IV V Indeterminate or suspicious 94% NPV Avoid surgery in % cases ($$) Molecular panels ~ $ USD/test Cost lower than diagnostic surgery (US health insurance) A potential case for Medicare??

29 Molecular diagnostic panels Panel name Targets Claims Reference ThygenX Thyroid oncogene panel + ThyraMIR thyroid mirna classifier 17 DNA mutations 10 mirna expression NPV 94% avoidable surgeries by 85% Labourier et al J Clin Endocrinol Metab (7): Afirma gene expression classifier 142 genes mrna expression pattern NPV 95% avoidable surgeries by 74-90% Alexander et al N Engl J Med 2012;367: ThyroSeq v2 next-generation sequencing assay 13 DNA mutations 42 gene fusions PPV 83% NPV 96% Nikiforov et al Cancer 2014;120 (23):

30 Molecular testing for thyroid cancer -summary FNA Bethesda category II III IV Benign Conservative management Reduce number of avoidable surgeries V VI Malignant Surgery Future planning for aggressive type tumours

31 University of Sydney Ass/Prof Susan McLennan Luisa Agudo, Research assistant Veronica Dy, Research assistant Stephanie Drake, Summer students Colin Moncrieff, Summer student Acknowledgements Royal Prince Alfred Hospital Sydney, NSW Health Dr Elizabeth Chua, Endocrinology and Metabolism Centre Dr Michael Elliott, Head and Neck Dr Ruta Gupta, Histopathology Jessica Tubb, Histopathology

32

33 BRAF testing for PTC Specificity = 100% Sensitivity = 59% Positive predictive value = 100% Negative predictive value = all benign with BRAF- /(benign + PTC BRAF ve) =34/47 = 72%