Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study

Similar documents
SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice

Supplementary Figure 1

Supplemental Material to:

Supplementary Figure 1.

Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and

Supplementary Figure S1. DD2 reactivity on human tonsils and analysis of slandc proliferation. Sections are from a representative human tonsil (a-f;

P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl

Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in

npod Viral Workgroup IHC studies update Dr Sarah Richardson

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Supplemental Table 1. Biochemical and Cellular Potency and Selectivity of PF

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

CAN Resubmission SUPPLEMENTAL INFORMATION

Supporting Information

Mouse DCs were cocultured with ID8-ova lysates, matured and analyzed for CD11c. SIINFEKL-pentamer staining and mouse Treg cell phenoytyping

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Figure S1. A Non-lesional Lesional

Supporting Information

CAN Resubmission SUPPLEMENTAL INFORMATION

Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses

U.S. ARMY MEDICAL RESEARCH INSTITUTE OF CHEMICAL DEFENSE

Supplementary Figure 1

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet-Expressed CXCL10 Promotes Autoimmune Destruction of Islet Isografts in Mice With Type 1 Diabetes

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1.

ImageStream cytometer analysis. Cells were cultured as described above in vented-cap

Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on

Supplementary Appendix

Supporting Online Material for

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

SUPPLEMENTARY DATA. Supplementary experimental procedures

Int J Clin Exp Pathol 2017;10(3): /ISSN: /IJCEP

Sipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the

Supplementary Materials for

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD,

In vitro differentiation optimization Flow Cytometry

Supplementary Information

Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Supplementary information:

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

January 25, 2017 Scientific Research Process Name of Journal: ESPS Manuscript NO: Manuscript Type: Title: Authors: Correspondence to

HIV-infected subjects were recruited from an ongoing clinic-based cohort (SCOPE)

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

University of Oklahoma Health Sciences Center, Oklahoma City, OK, USA; e Boone Pickens

Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.

The prevalence of enteroviral vp1 immunostaining in pancreatic islets in human type 1 diabetes

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1: Validation of labeling specificity of immature OSNs and presynaptic terminals. (A) (B) (C) (D) (E)

Fas and Fas ligand expression in inflamed islets in pancreas sections of patients with recent-onset Type I diabetes mellitus

Materials and Methods

Supplemental materials

Supplemental Information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Enterovirus infection, CXC chemokine ligand 10 (CXCL10) and CXCR3 circuit: a mechanism of accelerated beta-cell failure in fulminant type 1 diabetes

Supplementary Figure 1

Supplementary Figure 1

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

Supplementary Information Catapult-like release of mitochondrial DNA by eosinophils contributes to anti-bacterial defense

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

ORE Open Research Exeter

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

Control of Glucose Metabolism

TITLE: CYP1B1 Polymorphism as a Risk Factor for Race-Related Prostate Cancer

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Categorical analysis of human T cell heterogeneity with One-SENSE

CLARITY reveals dynamics of ovarian follicular architecture and vasculature in three-dimensions

Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)

Simultaneous blockade of PD-1 and VEGFR2 induces synergistic. Short title: Synergistic antitumour effect by dual blockade of PD-1 and VEGFR2

Effect of glucose on beta cell proliferation and population size in organ culture of foetal and neonatal rat pancreases

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones

Title. Author(s)Ikeshita, Shunji; Miyatake, Yukiko; Otsuka, Noriyuki. CitationExperimental and Molecular Pathology, 97(1): Issue Date

Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells

Pathophysiological mechanisms involving aggressive islet cell destruction in fulminant type 1 diabetes

CD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer

SUPPLEMENTARY METHODS

Transcription:

Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria, 1:100 Glucagon Mouse K79bB10 Abcam, Cambridge, UK 1:2000 Enterovirus VP-1 peptide Mouse 5-D8/1 Novocastra, Newcastle Upon Tyne, UK 1:200 Interferon-alpha Mouse MMHA-3 PBL Biomedical Laboratories, 1:50 Piscataway, NJ Interferon-beta1 Rabbit - LifeSpan BioSciences, Seattle, WA 1:100 Interferon-gamma Rabbit - Santa Cruz Biotechnology, Santa Cruz, 1:50 CXCL10 Goat - R&D Systems, Minneapolis, MN 1:80 CXCR3/CD183 Mouse 1C6 BD Bioscience, San Jose, 1:50 MHC class I Mouse EMR8-5 HOKUDO Co., LTD., Sapporo, Japan 1:50 MHC class II Mouse TAL.1B5 Dako, Carpinteria, 1:30 TLR3 Rabbit - ABGENT, San Diego, 1:25 TLR4 Mouse 76B357.1 IMGENEX, SanDiego, 1:100 RIG-I/DDX58 Rabbit - Abcam, Cambridge, UK 1:200 MDA5 Goat - Abcam, Cambridge, UK 1:50 CD1a Mouse 010 Dako, Carpinteria, 1:50 CD4 Mouse IF6 Novocastra, Newcastle Upon Tyne, UK 1:50 CD8 Mouse C8/144B Dako, Carpinteria, 1:50 CD11c Rabbit EP1347Y Abcam, Cambridge, UK 1:100 CD56 Mouse 123C3 Dako, Carpinteria, 1:50 CD57 Mouse B321(NK-1) Abcam, Cambridge, UK 1:20 CD68 Mouse PG-M1 Dako, Carpinteria, 1:50 Foxp3 Rat PCH101 ebioscience, San Diego, 1:20 IL-18 Mouse 25-2G MBL, Nagoya, Japan 1:20 IL-18 Rabbit - MBL, Nagoya, Japan 1:200 IL-12 Mouse JJ07 Santa Cruz Biotechnology, Santa Cruz, 1:50 IL-12 Mouse 24910 R&D Systems, Minneapolis, MN 1:25 Fas Rabbit - Santa Cruz Biotechnology, Santa Cruz, 1:25 FasL Rabbit - Santa Cruz Biotechnology, Santa Cruz, 1:50 Cleaved caspase 3 Rabbit - Cell Signaling Technology, Danvers, 1:400 MA Cleaved caspase 8 Rabbit 18C8 Cell Signaling Technology, Danvers, 1:50 MA Cleaved caspase 9 Rabbit - Novus Biologicals, Littleton, CO 1:1000 RARRES3 Rabbit - Sigma, St. Louis, MO 1:250 IRF-7 Rabbit - Novus Biologicals, Littleton, CO 1:200

Supplementary Figure 1. Immunohistochemical staining in pancreas from non-diabetic controls (A-H) and patients with type 1 diabetes (I-L). A-D: Immunohistochemical staining of MDA5 (A), glucagons (B), insulin (C) and merged image of (D) of (A) (B) and (C) in pancreases of non-diabetic controls. The merged image (D) shows weak expression of MDA5 in a few alpha cells (arrowheads). E-H. Immunostaining for RIG-I (E), glucagons (F), insulin (G), merged image (H) of (E) (F) and (G) in nondiabetic controls. Hyper-expression of RIG-I is hardly observed. (I)-(J): Immunohistochemical staining of MDA5 (I) and merged image (J) of insulin (red) and MDA5 (green, arrowheads) in type 1 diabetic control pancreas. Similar to non-diabetic controls, weak expression of MDA5 in non-beta cells (green, arrowheads) was observed in type 1 diabetic control pancreas. (K), (L): Immunohistochemical staing of RIG-I (K) and CD 68 (L) in type 1 diabetic control pancreas showed no RIG-I expression in the CD68+mononuclear cell infiltrated islet.

Supplementary Figure 2. Immunohistochemical staining of the pancreas obtained from fulminant type 1 diabetes for enterovirus capsid protein (VP1)(A) and insulin (B). The merged image (C) shows positive staining for VP1 in beta cell and non-beta cells (x200, case 2). Non-diabetic control pancreas showed no staining for VP1 (D). Color balance of (C) is adjusted.

Supplementary Figure 3. Fas and Fas-ligand (FasL) expression in the pancreas of non-diabetic controls and type 1 diabetic controls. Fas was not stained in both non-diabetic controls and type 1 diabetic controls (A), (E). FasL-positive mononuclear cells (G) are infiltrated to the islet of type 1 diabetic controls, while FasL was not stained for the islet of non-diabetic controls (C). (B), (D), (F), (H): Immuno-histochemical staining for insulin.

Supplementary Figure 4. Immunohistochemical demonstration of RARRES3, activated caspase 8, caspase 9 and caspase 3 in the affected islets by fulminant type 1 diabetes. (A), (B), (C): Double-immunofluorescent staining for insulin (A) and RARRES3 (B)(x400, case2). A merged image (C) shows specific expression of RARRES3 in beta cells (arrowheads). Double-immunofluorescent staining for insulin (D) and activated caspase 8 (E) (x400, case1). The merged image (F) demonstrates that activated caspase 8 is expressed specifically in beta cells (arrowheads). Double-immunofluorescent staining for insulin (G) and activated caspase 9 (H) (x400, case1). The merged image (I) demonstrates that activated caspase 9 is expressed specifically in beta cells (arrowheads) (x400, case1). Double-immunofluorescent staining for insulin (J) and activated caspase 3 (K) (x400, case 1). The merged image (L) demonstrates that activated caspase 3 is expressed specifically in beta cells (arrowheads).

Supplementary Figure S5. Immunohistochemical staining of activated caspase 8, caspase 9 and caspase 3 in type 1 diabetic controls and autopsied non-diabetic controls. (A), (B), (C): Double-immunostaining for caspase 8 (A) and insulin (B) in type1 diabetic controls (x200). A merged image (C) shows weak staining in some islet beta cells. (D), (E), (F): Double-immunostaining for caspase 8 (D) and insulin (E) and merged image (F) in autopsied nondiabetic controls. Activated caspase 8 was not shown. (G), (H), (I): Double-immunostaining for caspase 9 (G) and insulin (H) in type1 diabetic controls (x200). A merged image (I) shows weak staining in some islet beta cells. (J), (K), (L): Double-immunostaining for caspase 9 (J) and insulin (K) and merged image (L) in autopsied nondiabetic controls. Activated caspase 9 was not shown. (M), (N), (O): Double-immunostaining for caspase 3 (M) and insulin (N) in type1 diabetic controls (x200). A merged image (O) shows weak staining in some islet beta cells. (P), (Q), (R): Double-immunostaining for caspase 3 (P), insulin (Q) and merged image (R) in autopsied nondiabetic controls. Activated caspase 3 was not shown.

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback