Supplementary Table S1 Human Patients Patient Sample No. Gender Age Additional Medication Treatment 1 Reason for Dissection Total Irradiation Dose Estimated Irradiation Dose to SG Gland Time of Resection Post-IR 5554 Male 45 None Mandibular SCC None NA NA 2776 Female 25 None 1100 Male 70 None Pleomorphic adenoma Tongue base adenocarcinoma None NA NA None NA NA 7045 Male 48 None Lower lip SCC None NA NA 2836 Male 69 Zantaz, Convertin Floor mouth SCC 35 Gy 30 Gy 8 months 8567 Male 39 None MALIGNANT FIBROUS HISTIOCYTOMA Conjuctiva 70 Gy 50Gy 4 months 1991 Male 60 None Maxillary SCC 60 Gy 50Gy 4 months 1 Patients did not receive chemotherapy.
Supplementary Fig. S1A
Supplementary Fig. S1B
Supplementary Fig. S1C
Supplementary Fig. S2A TUNEL DNA Merge 17 Gy 15 Gy 13 Gy Naive
Supplementary Fig. S2B Naïve 13Gy 15Gy 17Gy
Supplementary Fig. S3B H2AX DNA Merged C H2AX 53BP1 DNA Merged
Supplementary Fig. S4 H2AX DNA Merged IL6 -/- +IR WT +IR IL6 -/- Naïve WT Naïve
Supplementary Fig. S5
Supplementary Fig. S6 H2Ax DNA merged HIL6 +IR IL-6 +IR Saline +IR Naïve
Supplementary Fig. S7A Naïve H2AX DNA merged IL-6 +IR 72h Saline +IR 72h IL-6 +IR 48h Saline +IR 48h IL-6 +IR 4h Saline +IR 4h
Supplementary Fig. S7B
Supplementary Fig. S8A IL-6 -/- +IR 4h WT +IR 4h WT Naive H2Ax DNA merged IL-6 -/- 72h WT 72h IL-6 -/- 48h WT 48h
Supplementary Fig. S8B
Supplementary Fig. S9
Supplementary Figure Legends Fig. S1 Radiation-induced morphological changes in the salivary glands. Thin sections of formalin fixed and paraffin embedded submandibular salivary glands from naïve and irradiated (13Gy) mice. Submandibular salivary glands were excised at 24, 48, 72, hours (h), and 2, 4, 8 and 12 weeks (W) post-irradiation and stained with (A) H&E; or immunostained for (B) macrophages (F4/80), or (C) neutrophils (Ly6B). Neutrophil staining in a lymph node adjoining the salivary gland is shown as a positive control. Scale bars, (a) 10 m and (b,c) 20 m; a acini, d ducts. No changes in either macrophage infiltration (red staining) or neutrophil (red staining) infiltration in the salivary gland were evident up to 2-4 weeks post-irradiation. Fig. S2 Apoptosis is not a prominent feature in salivary glands irradiated at doses causing hypofunction. (A) Representative micrographs of fluorescent TUNEL staining (green), and counterstained to show nuclei (blue), in thin sections of submandibular salivary glands taken from mice 48 hours following irradiation with 13, 15 or 17 Gy to the head and neck. Scale bars, 50 m. TUNEL staining observed at 17 Gy was most notable in ductal cells. (B) Representative micrographs of caspase 3 immunostaining (red-brown) in histological sections from salivary glands in (A). Scale bars, 20 m. Fig. S3 Morphologically aberrant acinar cells of irradiated salivary glands show evidence of DNA damage. Representative confocal immunofluorescence staining images of (A) aquaporin 5 (red), (B) H2AX (green), and (C) H2AX (green) and 53BP1 (red) co-immunostaining in salivary glands from naïve and irradiated (13 Gy) mice removed 8 weeks post-irradiation (13 Gy) and counterstained to show nuclei (blue). Scale bars, 20 m (A) and 10 m (B,C). Arrows enlarged, morphologically irregular acinar cells.
Fig. S4 IL-6 is crucial for persistent DDR signaling in irradiated salivary glands. Representative confocal images of H2AX immunostaining (green nuclear foci) in salivary gland thin sections in irradiated (5x5.6 Gy) wild-type and IL-6 -/- mice, 8 weeks post-irradiation, counterstained to show nuclei (blue). Scale bars, 10 m. Fig. S5 IL-6 infusion upregulates of IL-6 mrna in the salivary gland. Analysis of IL- 6 mrna by Real-Time PCR in the submandibular salivary glands taken 5h following infusion of IL-6 (15 ng) or normal saline with or without irradiation (13 Gy) 3h postinfusion. (RQ Relative Quantification, Data represent mean ± s.e.m. *P<0.05 using two-tailed Mann-Whitney test; n=4-6). Fig. S6 Local treatment with IL-6 or HIL-6 reduces irradiation-induced senescence in the salivary gland. Representative confocal images of H2AX (green nuclear foci) immunostaining in submandibular salivary glands from mice treated by retrograde infusion of molar equivalents of either IL-6 (15 ng) or HIL-6 (50 ng) protein and irradiated (5x5.6 Gy). Stainings were performed on glands taken 8 weeks postirradiation and counterstained to show nuclei (blue). Scale bars, 10 m. Fig. S7 IL-6 pretreatment accelerates DNA damage repair shortly following irradiation. (A) Representative confocal images of H2AX immunofluorescence staining of (nuclear green foci) and counterstained to show nuclei (blue), in submandibular salivary glands from mice pretreated by retrograde infusion of IL-6 (30 ng) or normal saline and removed either before treatment (naïve), or 4h, 48h, or 72h post-irradiation (+IR) (5.6 Gy). Scale bars, 10 m. (B) Quantification of nuclear H2AX foci in ductal cells from (A) (naïve, and 4h and 48h post-ir). Due to their density, foci were quantified as pixels per nuclei in the ductal cells. (Data are means ± s.e.m.; ***P<0.001, #P<0.05 versus all other groups using two-tailed Mann-Whitney test; Naive, n=3; Saline+IR (4h) and IL-6+IR (48h), n=9; IL-6+IR (4h), n=10; and Saline+IR (48h), n=8).
Fig. S8 IL-6 deficiency does not affect DNA damage response at early times following irradiation. (A) Representative confocal images of H2AX immunofluorescence staining of (nuclear green foci) and counterstained to show nuclei (blue), in submandibular salivary glands from naïve wild-type mice, or wildtype and IL-6 -/- mice removed 4h, 48h, or 72h post-irradiation (+IR) (5.6 Gy). Scale bars, 10 m. (B) Quantification of nuclear H2AX foci in ductal cells. Due to their density, foci were quantified as pixels per nuclei in the ductal cells. (Data are means ± s.e.m.; **P<0.01 and #P<0.05 versus WT+IR(4h) and IL-6 -/- +IR(4h) using two-tailed Mann-Whitney test; Naive, n=3; WT+IR (4h) and IL-6 -/- +IR(4h), n=6; WT+IR (48h) and IL-6 -/- +IR(48h), n=4). Fig. S9 The effect of local HIL-6 pretreatment on in vivo antitumoral efficacy of radiotherapy. The effect of HIL-6 (50 ng) infusion to the salivary gland on the radiosensitivity of tumors was tested in BALB/C mice bearing tumors derived from distally implanted SQ2 anaplastic squamous cell carcinoma cells (1). Irradiation (14 Gy) treated mice were administered either HIL-6 (50 ng) (filled triangles) or Normal Saline carrier (filled squares) by retrograde infusion to the submandibular glands, 3-4 hours prior to irradiation. Tumor volume compared between irradiated and nonirradiated controls (filled circles). (Data are means ± s.e.m.; No differences were observed in average tumor volume between HIL-6 and Saline treated groups as compared by Mann-Whitney rank test; P>0.1. *P<0.05 and ***P<0.001 versus irradiated mice, using two-tailed Mann-Whitney test; Non-irradiated, n=7; Saline+IR and HIL-6+IR n=6).
Supplementary Methods Western blot analysis Protein extracts were prepared from tissue samples (~100mg) by homogenization and subjected to Western blot analysis as described previously (1). Blots were probed with antibodies to p-stat3, STAT3, (Santa Cruz Biotechnology, Santa Cruz, CA), or murine IL-6R (R&D) and developed with HRP Envision (DAKO). As a loading control, the blots were stripped with 0.1 M glycine ph 2.8 and re-probed with a monoclonal anti-β-actin antibody (Sigma). Quantitation of Western blot bands was performed using TINA 2.10g Imaging software. IL 6 ELISA Murine serum IL6 levels were determined using a mouse IL6 DuoSet ELISA kit (R&D, USA) according to the manufacturer s instructions on serum samples stored at -20 C. RNA RNA was extracted from snap frozen tissue specimens using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) as described(2). Reverse transcription of total RNA was performed using the qscripttm cdna Synthesis Kit (#95047) and Quantiative PCR (qpcr) of mrna was performed using PerfeCTa SYBR Green FastMix ROX (#95073) (Quanta BioSciences Inc., Gaithersburg, MD, USA). qpcr assay was performed on an AB 7900 HT fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) or CFX384 TM Real-Time System with C1000 Touch Thermal Cycle (BioRad, Hercules, CA, USA). The fold expression and statistical - Ct significance were calculated using the 2 method. All experiments were performed in triplicate. The primers used for qpcr are: Cdknia AGGCAGACCAGCCTGACAGAT, and TCCTGACCCACAGCAGAAGAG; DCR2 GCTGTGTCTGTGGCTGTGACTT and TCCTCATCCGTCTTTGAGAAGC; CDKN2D (P19) GGCCTTGCAGGTCATGATGTTT and GACATCAGCACCATGCTCCAC; PAI1 ATGGCTCAGAGCAACAAGTTCA and TAGGGCAGTTCCACAACGTCAT; IL-6 ATACCACTCCCAACAGACCTGTC and CAGAATTGCCATTGCACAACTC; and HPRT
GTTAAGCAGTACAGCCCCAA and GGGCATATCCAACAACAAACT. Detection of IL-6R mrna by RT-PCR was performed as described previously (1). In vivo tumor model SQ2 cells (10 6 ), derived from a spontaneous anaplastic squamous cell carcinoma of BABL/C origin (3), were injected subcutaneously under anesthesia (ketamine/xylesine) into the right hind flank of 7-8 week old female BALB/C mice. Tumors were allowed to grow to an estimated volume of 14-100 mm 3, mice were randomly divided into treatment (irradiated) and control (non-irradiated) groups. Mice in the treatment groups were subjected under anesthesia (ketamine/xylazine) to singlefraction irradiation (14 Gy) to the hind flanks. Mice in the treatment groups were subjected to infusion (50 l) of either HIL-6 protein (50 ng) or carrier solution (10 g/ml BSA in normal saline) to the submandibular gland 3.5-4 hours prior to irradiation, as described in Methods. Tumor dimensions were measured by caliper and volume was estimated using the formula volume = (length x width x width) (0.5). Experiments were terminated when tumors in the control group reached ~600 mm 3 estimated volume. References Sited 1. Nechemia-Arbely, Y., Barkan, D., Pizov, G., Shriki, A., Rose-John, S., Galun, E., and Axelrod, J.H. 2008. IL-6/IL-6R axis plays a critical role in acute kidney injury. J Am Soc Nephrol 19:1106-1115. 2. Katzenellenbogen, M., Mizrahi, L., Pappo, O., Klopstock, N., Olam, D., Jacob-Hirsch, J., Amariglio, N., Rechavi, G., Domany, E., Galun, E., et al. 2007. Molecular mechanisms of liver carcinogenesis in the mdr2-knockout mice. Mol Cancer Res 5:1159-1170. 3. Blank, M., Lavie, G., Mandel, M., and Keisari, Y. 2000. Effects of photodynamic therapy with hypericin in mice bearing highly invasive solid tumors. Oncol Res 12:409-418.