Protein extraction and western blot analysis Protein extraction was performed as

Similar documents
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figures

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplementary Figure 1

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

2.5. AMPK activity

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

Supplemental Figure 1

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

SUPPLEMENTARY METHODS

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

Supplementary Data Table of Contents:

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

SUPPLEMENTARY INFORMATION

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Figures S1-S5, Figure Legends, Table S1 List of primers used in the study

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice

Supplemental Information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients

Supplemental information

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary Materials for

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Supplementary Information

Supporting Information

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

University of California, San Diego La Jolla CA 92093

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Supplemental Material:

SUPPLEMENTARY INFORMATION. Supplemental Figure 1. Body weight and blood glucose parameters of chow-diet (CD)

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

Supplemental Information. Regulatory T Cells Promote Macrophage. Efferocytosis during Inflammation Resolution

Supplementary Figure 1: Additional metabolic parameters of obesity mouse models and controls. (a) Body weight, (b) blood glucose and (c) insulin

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*

Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or

Supplementary Information

Supplementary Information

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Supplementary Figure 1. H-PGDS deficiency does not affect GI tract functions and anaphylactic reaction. (a) Representative pictures of H&E-stained

Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Cell Stem Cell, volume 10 Supplemental Information

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Materials and Methods

MAIT cell function is modulated by PD-1 signaling in patients with active

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Roux-en-Y gastric bypass surgery but not vertical sleeve gastrectomy decreases bone mass in male rats

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Transcription:

ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1, Cell Signaling Technology, Danvers, MA, USA), phosphorakt (Ser473; 1:1, Cell Signaling Technology), AMPKα1 (1:1, Cell Signaling Technology) or phosphorampkα1 (Thr172; 1:1, Cell Signaling Technology). HRPlabeled goat antirabbit IgG (1:4, KPL, Gaithersburg, MD, USA) was used as secondary antibody. Chemiluminescent detection was performed by using ECL western blot detection kit (BIORAD, Hercules, CA, UAS) in Image Quant LAS 4 mini (GE Healthcare, Piscataway, NJ, USA). Total RNA isolation and quantitative realtime PCR Total RNA was isolated with TRIZOL reagent (TAKARA, Dalian, China). The cdna was synthesized using M MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and oligo (dt)18 primers according to manufacturer s protocol. Quantitative realtime PCR was performed using itaq Universal SYBR Green Supermix (BIORAD) in BIORAD MyIQ2 Real Time PCR system. Relative mrna expression was determined by the ΔΔCt method and normalized to Gapdh. The primer sequences were listed in ESM Table 2. Immunohistochemistry and ELISA Immunohistochemistry stains with MAC2 antibody (Bio Legend, San Diego, CA, USA) for total macrophages in mice EAT was as previously described [2]. The serum TNFα, IL6 and MCP1 levels were measured

using mouse ELISA kits (BD Bioscience) according to manufacturer s protocols. EAT stromal vascular fraction (SVF) isolation Stromal vascular cells were isolated as previously described [3] with some minor modifications. Briefly, mouse EAT were excised, minced and incubated in 2 mg/ml Type II Collagenase (SigmaAldrich, St. Louis, MO, USA) at 37 C for 2 min. To remove adipocytes, the digesta were passed through a 75 μm filter. And then the cells were washed with PBS supplemented with.5% BSA, which was followed by red blood cell lysis for 5 min. Flow cytometry analysis For flow cytometry analysis, SVF or other cells were incubated with Fc Block (BD Biosciences, San Diego, USA) for 15 min on ice, and then were directly conjugated with the corresponding antibodies for 3 min at 4 C. All antibodies were listed ESM Table 3. The cells were identified by flow cytometer MoFlo XDP (Beckman Coulter, Fullerton, CA, USA) and data were analyzed using Summit 5.2. Small interfering (si)rna sirnas against Ampk 1 (also known as Prkaa1) and a scrambled sirna as control were purchased from Sangon Biotech (Shanghai, China). The sirna sequences applied to target Ampk 1 were: 5 GCAAUCAAGCAGUUGGAUU dtdt3 (sense) and 5 AAUCCAACUGCUUGAUUGCdTdT3 (antisense). The scrambled sirna sequences employed as a negative control were 5 GCAGAA CUGACGGUUAAUUdTdT3 (sense) and 5 AAUUAACCGUCAGUUCUGCdT

dt3 (antisense). RAW264.7 and PCM were transfection with sirnas using Lipofectamine 2 (Invitrogen) according to the manufacture s protocol. References 1. Dong J, Zhang X, Zhang L, et al. (214) Quercetin reduces obesityassociated ATM infiltration and inflammation in mice: a mechanism including AMPK 1/SIRT1. J Lipid Res 55: 363374 2. Xu N, Zhang L, Dong J, et al. (214) Lowdose diet supplement of a natural flavonoid, luteolin, ameliorates dietinduced obesity and insulin resistance in mice. Mol Nutr Food Res 58: 12581268 3. Bao B, Chen YG, Zhang L, et al. (213) Momordica charantia (Bitter Melon) reduces obesityassociated macrophage and mast cell infiltration as well as inflammatory cytokine expression in adipose tissues. PLoS One 8: e8475

Blood glucose (mmol/l) Blood glucose (% of initial) a 17 b 12 15 13 11 9 7 5 3 2 4 6 8 1 12 Time (min) 11 1 9 8 7 6 5 4 2 4 6 8 1 12 Time (min) ESM Figure 1 GTT (a) and insulin tolerance test (b) assays were performed at 15weekold mice. Black circles, HFD; white circles, LFD; grey triangles, HFD. All data were presented as mean ± SEM, n=8 per group, oneway ANOVA with Duncan s post hoc test relative to HFD, P<.5, P<.1.

a EAT weight (g) 3 2 1 b SAT weight (g) 2.5 2 1.5 1.5 c Food intake (kcal/week/2g body weight) 8 6 4 2 N.S ESM Figure 2 Weights of EAT (a) and SAT (b) of mice. (c) Energy intake per 2 g body weight of mice every week treatment. Black bars, HFD; white bars, HFD2; grey bars, HFD1; hatched bars, LFD. All data were presented as mean ± SEM, n=8 per group, oneway ANOVA with Duncan s post hoc test relative to HFD, P<.5, P<.1.

a 1 1 1 1 HFD HFD2 HFD1 LFD b MAC2 area (%).5.4.3.2.1 c 1 5 Mac per g adipose 2.6 2.4 2.2 2 1.8 1.6 1.4 1.2 1 ESM Figure 3 Dietary decreased macrophage accumulation into EAT. (a) MAC2 immunohistochemistry of EAT; scale bars: 1 μm. (b) Quantification of MAC2 area percent. (c) Quantification of macrophages per g EAT by flow cytometry. Black bars, HFD; white bars, HFD2; grey bars, HFD1; hatched bars, LFD. All data were presented as mean ± SEM, n=8 per group, oneway ANOVA with Duncan s post hoc test relative to HFD, P<.5, P<.1. Mac, macrophage.

a 3 25 2 15 1 5 (μmol/l ) 5 1 2 b Tnfα mrna (fold) 2 16 12 8 4 (μmol/l) 1 c 2 16 12 8 4 5 2 (μmol/l) 5 1 2 d 1 e 1 f 1, 8 6 4 2 (μmol/l) 5 1 2 Tnfα mrna (fold) 8 6 4 2 (μmol/l) 5 1 2 8, 6, 4, 2, (μmol/l) 5 1 2 g (μmol/l) 5 1 j 1 8 6 4 2 35 3 25 2 15 1 5 (μmol/l) 5 1 2 2 h Tnfα mrna (fold) (μmol/l) 5 1 k Tnfα mrna (fold) 15 12 9 6 3 14 12 1 8 6 4 2 (μmol/l) 5 1 2 2 i 35 3 25 2 15 1 5 (μmol/l) 5 1 l 8 7 6 5 4 3 2 1 (μmol/l) 5 1 2 2

ESM Figure 4 reduced macrophage inflammation in dosedependent manner. RAW264.7 and PCM were pretreated with vehicle 5, 1 or 2 mol/l for 12 h, and then stimulated with 1 ng/ml for 4 h or for 48 h. The mrna levels of proinflammatory cytokine Mcp1, Tnfα and Il6 were detected in stimulated RAW264.7 (ac) and PCM (df), and stimulated RAW264.7 (gi) and PCM (jl). n=4 per group. All data were presented as mean ± SEM, n=4 per group, twotailed student s t test relative to or treatment, P<.5, P<.1.

a 35 3 25 2 15 1 5 2 b Tnfa mrna (fold) d e 12 f 1 8 9 6 6 4 Tnfa mrna (fold) 3 25 2 15 1 5 3 c 25 2 15 1 5 12, 9, 6, 3, g h i j 12 1 8 6 4 2 4 32 24 16 8 Tnfa mrna (fold) k Tnfa mrna (fold) 15 1 5 15 12 9 6 3 l 35 3 25 2 15 1 5 9 6 3

ESM Figure 5 suppressed or induced macrophage inflammation through activating AMPKα1. The mrna levels of Mcp1, Tnfα and Il6 were analyzed in stimulated RAW264.7 (ac) and PCM (df) or stimulated RAW264.7 (gi) and PCM (jl). All data were presented as mean ± SEM, n=4 per group, twotailed student s t test, P<.5, P<.1.

AMPK 1/ actin of RAW264.7 AMPK 1/ actin of PCM a b c 1.2 1. 1.2 1. AMPK 1 actin AMPK 1 actin RAW264.7 PCM.8.6.4.8.6.4.2 ESM Figure 6 sirnamediated knockdown of Ampkα1 in RAW264.7 and PCM. RAW264.7 and PCM were transfected with a negative control sirna () or a sirna targeting Ampkα1 for 72 h and lysed for immunoblots. (a) Immunoblots for AMPKα1 and actin and quantification of AMPKα1 to actin in RAW264.7 (b) and PCM (c). All data were presented as mean ± SEM, n=4 per group, twotailed student s t test, P<.5, P<.1.

a 25 2 15 1 b Tnf mrna (fold) 25 2 15 1 5 c 2 16 12 8 4 5 d e f 1 8 6 4 2 1 8 6 4 2 35 28 21 14 7 Tnf mrna (fold) 8 6 4 2 Tnf mrna (fold) Tnf mrna (fold) 12 1 8 6 4 2 12 1 8 6 4 2 8, g h i j k l 6, 4, 2, 3 2 1 8 6 4 2 ESM Figure 7 Ampk 1 silencing reserved the effects of on macrophage inflammation. The mrna levels of Mcp1, Tnfα and Il6 were detected in

stimulated RAW264.7 (ac) and PCM (df) or stimulated RAW264.7 (gi) and PCM (jl). All data were presented as mean ± SEM, n=4 per group, twotailed student s t test, P<.5, P<.1.

ESM Table 1. The composition of diets used in experiment Ingredient (g) LFD HFD HFD.1% Casein 2 2 2 LCystine 3 3 3 Corn starch 315 72.8 72.8 Malt dextrin 1 35 1 1 Sucrose 35 172.8 172.8 Cellulose 5 5 5 Soybean oil 25 25 25 Lard 2 177.5 177.5 Mineral Mix 126 1 1 1 Dicalciumphospate 13 13 13 Calcium carbonate 5.5 5.5 5.5 Potassium citrate 16.5 16.5 16.5 Vitamin Mix V11 1 1 1 Choline bitartrate 2 2 2 Luteolin.851 Total weight (g) 155 858.1 858.1 Total energy (kcal) 457 457 457 Note: a) LFD, low fat diet was based on the research diets D1245B diet; b) HFD, high fat diet was based on the research diets D12451diet; c), luteolin was added in diets as powders.

ESM Table 2. Primers for quantitative qpcr Gene Sequence of forward primers(5' to 3') Sequence of reverse primers(5' to 3') Tnf ACGGCATGGATCTCAAAGAC AGATAGCAAATCGGCTGACG Mcp1 CCCCAAGAAGGAATGGGTCC GGTTGTGGAAAAGGTAGTGG Il6 CCTTCCTACCCCAATTTCCAA AGATGAATTGGATGGTCTTGGTC Nos2 CCAAGCCCTCACCTACTTCC CTCTGAGGGCTGACACAAGG Arg1 CTCCAAGCCAAAGTCCTTAGAG AGGAGCTGTCATTAGGGACATC Cd36 ATGGGCTGTGATCGGAACTG GTCTTCCCAATAAGCATGTCTCC Plin2 GACCTTGTGTCCTCCGCTTAT CAACCGCAATTTGTGGCTC Gapdh CGTGTTCCTACCCCCAATGT TGTCATACTTGGCAGGTTTCT

ESM Table 3. Flow cytometry antibodies used in this study Cells Antibody name Supplier Catalog number Adipose tissue macrophages APC antimouse F4/8 BioLegend 123116 FITC antimouse CD26 (MMR) BioLegend 14174 PE antimouse CD11c ebioscience 12114 induced macrophages APC antimouse CD274 (B7H1,PDL1) BioLegend 124312 PE antimouse CD38 BioLegend 1278 induced macrophages APC antimouse CD36 ebioscience 17361 PE antimouse ABCA1 Novusbio NB415PE

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback