Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al.
IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT (% of CTRL) VGLUT2/HPRT (% of control) VGAT/HPRT (% of CTRL) PSD9 puncta A 12 1 ** *** WT BM chimera IL6 -/- BM chimera WT BM unstressed IL6 -/- BM unstressed WT BM stressed IL6 -/- BM stressed 7 B 2 No RSDS 1 8 6 4 4 4 RSDS *** *** WT BM chimera IL6 -/- BM chimera C 2 2 1 *** 12 1 7 ** 12 9 6 * 2 1 HSV-GFP () HSV-Rac1 (6) 2 2 3 No RSDS RSDS D phytochemicals RSDS Rac1 in NAc Synaptic maladaptation ( PSD-9, EPSCs ) Susceptibility to Depression Normalization of Excitatory synaptic plasticity ( PSD-9, EPSCs ) Resilience to depression RSDS Periphery IL-6 phytochemicals Supplementary Figure 1. The role of IL-6 and Rac1 in modulating synaptic plasticity. (A) Quantification of marker of excitatory synapses PSD-9 puncta in NAc from WT and IL-6 -/- BM chimeric mice with or without RSDS (one-way ANOVA, F 3,17 =13.94, P=.2). Inset: representative schematic of mouse NAc region used for the immunohistological quantification and representative images showing increased frequency of PSD-9 puncta in NAc of stressed WT BM chimeras compared to unstressed WT chimeras and stressed or unstressed IL-6 -/- BM chimeric mice; scale bar = 1µm. (B) Measurements of IL-6 in the plasma following RSDS (one-way ANOVA, F 3,3 =12.2, P<.1, n=8,8,7,8 mice (C) Modulation of synaptic markers on excitatory neurons by Rac1 in MSN-enriched primary cultures. Gene expression of glutamatergic PSD-9, GLUT2 and GABAergic VGAT in MSNs 48 hours following HSV-GFP or HSV-Rac1 infection (unpaired two tailed t-test). (D) Working hypothesis: RSDS mediated down regulation of Rac1 in the NAc and upregulation of peripheral IL-6 lead to synaptic maladaptation in the NAc and susceptible phenotype of depression (Black). Select phytochemicals can block RSDS-mediated changes of Rac1 and IL-6, thus normalizing synaptic plasticity and promoting resilience to stress-induced depression (Red). All graphs represent mean ± s.e.m., *P<., **P<.1, ***P<.1 2
P-ERK1/2 (Arbitrary unit/ ug protein) P-AKT (Arbitrary unit/ ug protein) P-JNK (Arbitrary unit/ ug protein) P-AKT (Arbitrary unit/ ug protein) P-p38 (Arbitrary unit/ ug protein) A B 2 2 LPS LPS+DHCA 1 1 1 C 3 6 36 96 (min) 8 6 4 D 3 6 36 96 3 6 36 96 (min) 2 2 1 LPS LPS+DHCA 2 3 6 36 96 (min) 3 6 36 96 (min) Supplementary Figure 2. The effect of DHCA on signal transduction pathways in PBMCs following LPS stimulation. The expression of (A) p-jnk (pt183/py18), (B) p-p38 (pt18/py182), (C) p-erk1/2 (pt18/py187) and (D) p-akt (ps473) in PBMCs following, 3 minutes, 6 minutes, 36 minutes and 96 minutes of LPS stimulation in the presence or absence of overnight treatment with DHCA (Two-way ANOVA P=.22 F 4,3 =2. for p-jnk; P=.67 F 4,3 =4.98 for p-p38; P=.1, F 4,3 =14.41 for p-erk1/2 and P=.13, F 4,3 =12. for p-akt, n=4 per culture per condition) 3
IL-6 LIX (pg/ml) M-CSF IL-6 (pg/ml) MCP-1 IL-6 (pg/ml) MIP-1 IL-6 (pg/ml) MIP-1 IL-6 (pg/ml) TNF- (pg/ml) VEGF IL-6 (pg/ml) IL-6 IL-9 (pg/ml) IL-1 IL-6 (pg/ml) IL-12 (p4) (pg/ml) IL-12 (p7) (7p) (pg/ml) IL- IL-6 (pg/ml) IL-17 IL-6 (pg/ml) IL-6 KC (pg/ml) G-CSF IL-6 (pg/ml) GM-CSF (pg/ml) IFN- IL-6 (pg/ml) IL-1 (pg/ml) IL-1 (pg/ml) (pg/ml) IL-6 IL-2 (pg/ml) frequency donor neutrophils IL-6 (pg/ml) 1 8 6 4 2 G-CSF 2 2 1 2 2 CTRL Legend (2) Vehile+LPS sus/ctrl (4) IL-1a IL-1b GM-CSF IFN-rγ IL-2 DHCA+LPS α β IL-6 sus/treatment (4) 4 *** *** 4 2 3 ** 1 1 *** 2 3 3 2 1 2 2 1 1 1 1 3 IL-9 IL-1 IL-12 (p4) IL-12 (p7) IL- IL-17 8 1 8 4 * *** * ** 12 KC * 2 1 6 4 2 1 8 6 4 2 6 4 2 3 2 1 9 6 3 12 LIX 12 M-CSF MCP-1 ** 4 MIP-1a α MIP-1b β TNF-a α 8 VEGF 9 9 4 3 4 12 6 6 6 3 2 2 3 2 9 6 4 3 3 1 1 1 3 2 Supplementary Figure 3. Secretion of cytokines from PBMCs following LPS stimulation. Mouse PBMCs treated with vehicle or DHCA were stimulated with LPS for 16 hours and cytokines were measured using Mouse Cytokine/chemokine Magnetic Bead Panel Milliplex MAP kit. One-way ANOVA, *P<., **P<.1, ***P<.1. All graphs represent mean ± s.e.m.. 4
DNMT1/HPRT (% of CTRL) DNMT3a/HPRT (% of CTRL) DNMT3b/HPRT (% of CTRL) Tet1/HPRT (% of CTRL) Tet2/HPRT (% of CTRL) Tet3/HPRT (% (% of of CTRL) DNMT1 12 DNMT3a 12 DNMT3b 2 Tet1 2 Tet2 2 Tet3 Vehicle Mal-Gluc 1 1 12 7 2 7 2 9 6 3 1 1 1 Supplementary Figure 4. Mal-gluc treatment of MSN-enriched primary neurons has no effect on the expression of genes important for DNA methylation. The expression of DNMT1, DNMT31, DNMT3b, Tet1, Tet2 and Tet3 in MSN-enriched primary neurons following 48 hours treatment with Mal-gluc by real-time PCR (two-tailed unpaired t-test, t 6 =1.372, P=.219 for DNMT1; t 6 =1.13, P=.3 for DNMT3a; t 6 =.969, P=.37 for DNMT3b; t 6 =.26, P=.86 for Tet1; t 6 =.139, P=.894 for Tet2; t 6 =.274, P=.793 for Tet3, n=4 per culture). All graphs represent mean ± s.e.m..
% of vehicle control % of vehicle control A 2 DHCA in vivo toxcicity Vehicle ug/kg/day ug/kg/day mg/kg/day mg/kg/day B DHCA in vivo toxcicity Vehicle ng/kg/day ug/kg/day ug/kg/dau ug/kg/day mg/kg/day 1 1 ALP AST ALT BUN ALP AST ALT BUN Supplementary Figure. In vivo toxicology indexes in C7BL/6 mice follwoing two-week treatment with various doses of DHCA or Mal-gluc (A) Blood level of ALP, AST, ALT and BUN following oral administration of DHCA treatment (one-way ANOVA, F 4,19 =.24, P=.932 for ALP; F 4,19 =.981, P=.447 for AST; F 4,17 =1.491, P=.362 for ALT; F 4,19 =2.9, P=.132 for BUN; n=4 animals per dose). (B) Blood level of ALP, AST, ALT and BUN following oral administration of Mal-gluc treatment (one-way ANOVA, F,23 =.63, P=.673 for ALP; F,23 = 1.828, P=.8 for AST; F,23 =.28, P=.93 for ALT; F,23 = 2.398, P=.78 for BUN, n=4 animals per dose). All graphs represent mean ± s.e.m.. 6
IL-6/HPRT (% of CTRL) DNMT1/HPRT (% of CTRL) frequency donor neutrophils A 2 2 2 2 B * * * * 2 2 1 1 No Legend RSDS control () Vehicle+RSDS sus/ctrl (9) Treatment+RSDS (8) sus/treatment 1 1 Supplementary Figure 6. Expression of IL-6 and DNMT1 in PBMCs isolated from non-stressed control mice and stressed mice with or without DHCA/Mal-gluc treatment (A) Measurements of IL-6 mrna level by real time PCR (one-way ANOVA, F 2,21 =.363, P=.142). (A) Measurements of DNMT1 mrna level by real time PCR (one-way ANOVA, F 2,21 =.27, P=.7). *P<.. All graphs represent mean ± s.e.m.. 7
SI ratio sucrose (% of total consumption) frequency donor neutrophils A B Vehicle Legend (1) 2. 1. 1.. 12 9 6 3 2 2 1 1 Mal-Gluc sus/ctrl(13) DHCA (8) sus/treatment. Supplementary Figure 7. Single target compound treatment does not attenuate depression-like phenotypes following RSDS. (A) Social avoidance behavioral test in mice treated with either Mal-gluc or DHCA two weeks prior to RSDS and throughout the RSDS (one-way ANOVA, F 2,3 =1.41, P=.21). (B) Sucrose preference test following SI test (One-way ANOVA, F 2,3 =2.961, P=.68). All graphs represent mean ± s.e.m.. 8
Imipramine Vehicle Mal-gluc/DHCA.. 1. 1. 2. SI ratio Supplementary Figure 8. Imipramine and Mal-gluc/DHCA have similar therapeutic efficacy in treating animals with depression-like social avoidance behavior. Re-testing of social avoidance behavior in susceptible mice following treatment with imipramine, Mal-gluc/DHCA or vehicle (one-way ANOVA, F 2,26 =2.62, P=.911, n=1, 8, 9 mice). Graphs represents mean ± s.e.m.. 9
frequency of monocytes frequency of neutrophils A frequency B of neurtrophils Control donor (9) frequency of monocytes 8 Susceptible donor (9) 6 4 2 1 Supplementary Figure 9. The susceptibility of the donor mice has no significant effect on the regeneration of monocytes or nerutophils prior to sub-threshhold defeat. (A) The frequency of total monocytes and (B) The frequency of total neutorphils in the blood of chimeras either from control donor or from susceptible donor without subthreshhold defeat (two-tailed unpaired t-test, t 16 =.7, P=.76 for monocytes and t 16 =1.41, P=.143 for neutrophils). All graphs represent mean ± s.e.m.. 1
% of donor cells frequency of LY6C hi monocytes frequency of neutrophils SI ratio sucrose (% of total consumption) IL-6 in plasma (pg/ml) A B C Vehicle 2. 1. 1... 8 6 4 2 2 2 1 D E F 1 3 7 9 7 9 6 8 1 8 6 4 2 7 9 4 3 2 1 Treatment 2 1 7 9 7 9 Supplementary Figure 1. DHCA/Mal-gluc treatment has no significant effect on behavioral and blood cell composition in chimeras with BM reconstructed from naïve mice. (A) Social avoidance test (twotailed unpaired t-test, t 14 =4.8, P=.929). (B) Sucrose preference test (two-tailed unpaired t-test, t 14 =.138, P=.989). (C) Plasma level of IL-6 24 hours after the sub-threshold defeat (two-tailed unpaired t-test, t 14 =.736, P=.476). (D) Representative image of flow cytometry gating for donor and recipient viable cells and percentage of cells derived from the donor (two-tailed unpaired t-test, t 14 =1.661, P=.1). (E) Representative image of flow cytometry gating for monocytes and frequency of monocytes of donor origin. Numbers represent percentages of live cells (two-tailed unpaired t-test, t 14 =.462, P=.61). (F) Representative image of flow cytometry gating for neutrophils and frequency of neutrophils of donor origin. Numbers represent percentages of live cells (two-tailed unpaired t-test, t 14 =2.14, P=.64). All graphs represent mean ± s.e.m.. 11
Phenolic Acids Polyphenol Metabolites Biologically Available Phenolic Metabolotes Detection in Plasma Brain Compounds Screened 1 resveratrol + + + 2 resveratrol-glucuronide + + + 3 3'-OME-catechin--glucuronide + + N/A 4 3'-OME-epicatechin--glucuronide + + + catechin--glucuronide + + N/A 6 delphinidin-glucuronide + + N/A 7 epicatechin--glucuronide + + N/A 8 quercetin-glucuroide + + + 9 OMe-quercetin-glucuronide + + N/A 1 OMe-resveratrol-glucuronide + + N/A 11 cyanidin-3-glucoside + + + 12 delphinidin-3-glucoside + + + 13 malvidin-3-glucoside + + + 14 peonidin-3-glucoside + + N/A 3-hydroxybenzoic acid - + + 16 3-(3 -hydroxyphenyl) propionic acid + + + 17 homovanilic acid + - + 18 3',4'-dihydrocaffeic acid + - + 19 -(4 -hydroxyphenyl)valeric acid + - + 2 3-hydroxyphenylacetic acid + - + 21 ferulic acid-4'-o-sulfate + - + Supplementary Table 1. Biologically available BDPP phenolic metabolites. List of 14 polyphenol metabolites and 7 phenolic acids found accumulated in plasma and/or brain following oral administration of BDPP or BDPP components. Fourteen of the compounds were available, either through commercial sources or our own biosynthesis, for our in vitro investigations. + denotes phenolic metabolites screened in Figs. 2A, 2B, 2C and 2D; N/A denotes phenolic metabolites that are not available for our investigation. 12
Gene Forward Reverse Rac1 GGTAGGTGATGGGAGTCAGC CTGAAGTGCGACACCACTGT PSD9 CGGGAGAAAATGGAGAAGGAC GCATTGGCTGAGACATCAAG VGLUT2 GCTCACCTCTACCCTCAATATG CCACTTGCTCCATATCCCATG VGAT ACGACAAACCCAAGATCACG AAGATGATGAGGAACAACCCC HPRT CCCCAAAATGGTTAAGGTTGC AACAAAGTCTGGCCTGTATCC DNMT1 CTCAGGGACCATATCTGCAAG GGTGTACTGTAGCTTATGGGC DNMT3a GGAAAGATCATGTACGTCGGG GCCAGTACCCTCATAAAGTCC DNMT3b GTACCCCATCAGTTGACTTGAG TTGATCTTTCCCCACACGAG TET1 GAGCCTGTTCCTCGATGTGG CAAACCCACCTGAGGCTGTT TET2 TGTTGTTGTCAGGGTGAGAATC TCTTGCTTCTGGCAAACTTACA TET3 CCGGATTGAGAAGGTCATCTAC AAGATAACAATCACGGCGTTC HDAC2 GGGACAGGCTTGGTTGTTTC GAGCATCAGCAATGGCAAGT HDAC3 TGTCTCAATGTGCCCTTACG CCTAATCGATCACAGCCCAG HDAC4 CAATCCCACAGTCTCCGTGT CAGCACCCCACTAAGGTTCA HDAC TTCAACTCCGTAGCCATCAC GGATCGTTGTAGAATGCTTGC HDAC7 GGTGGACCCCCCTTTCAGAAG TGGGTAGCCAGGAGTCTGGA HDAC9 GCGAGACACAGATGCTCAGAC TGGGTTTTCCTTCCATTGCT Supplementary Table 2. Mouse qpcr primer sets used in the study. 13