Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Similar documents
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

Supplementary Figures

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplementary Figure 1: TSLP receptor skin expression in dcssc. A: Healthy control (HC) skin with TSLP receptor expression in brown (10x

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

Supplementary Figure 1

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Nature Medicine doi: /nm.3957

Supplementary Figures

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

SUPPLEMENTARY MATERIAL

pplementary Figur Supplementary Figure 1. a.

NK cells link obesity-induced adipose stress to inflammation and insulin resistance

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Plasma exposure levels from individual mice 4 hours post IP administration at the

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Supplementary Information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

Pathologic Stage. Lymph node Stage

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Figure 1

Supporting Online Material for

Quantitative PPARγ expression affects the balance between tolerance and immunity

3/25/2010. Age-adjusted incidence rates for coronary heart disease according to body mass index and waist circumference tertiles

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

COPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171

Supplementary Figure 1

UMHS-PUHSC JOINT INSTITUTE

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure 1 a

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

Fasted Insulin Coincidence of Macrophage Infiltration into White Adipose Tissue and Onset of Hyperinsulinemia During Diet- Induced Obesity

Supplementary Materials for

Protein extraction and western blot analysis Protein extraction was performed as

Supplementary Figure 1

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse

Activated mast cells promote differentiation of B cells into effector cells

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan

IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia

NMED-A65251A. Supplementary Figures.

Immune Cells in Regional Adipose Tissue Depots: A Pilot Study. Vi Dam. A Thesis. The Department. Exercise Science

Supplementary Table 1.

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Generation of ST2-GFP reporter mice and characterization of ILC1 cells following infection

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

SUPPLEMENTARY INFORMATION

Expanded View Figures

Client Sex Facility Birth Date Height Weight Measured ####, #### #### (not specified) #### #### #### ####

Obesity, Metabolic Syndrome, and Diabetes: Making the Connections

Supplementary Figure 1.

SUPPLEMENTARY INFORMATION

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

University of California, San Diego La Jolla CA 92093

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

SUPPLEMENTARY INFORMATION

IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Imbalance between Neutrophil Elastase and its Inhibitor a1-antitrypsin in Obesity Alters Insulin Sensitivity, Inflammation, and Energy Expenditure

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Fat Mass. Baseline. (lbs) (lbs) Composition Trend: Total. Aug 17. Apr 17. May 17. Jun 17. Jul 17. Measured Date

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

SUPPLEMENTARY INFORMATION

Transcription:

SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n (%) 13 (87%) 9 (75%) BMI, kg/m² [mean ± SD] 21.7 ± 1.7 36.0 ± 4.8 Supplemental Table 2: Adipose tissue in lean (n=4) and obese (n=4) mice as quantified by micro- CT imaging Adipose Tissue, mm² Lean Mice (ND-fed) Obese Mice (60% HFD-fed) P-Value Thigh IMAT/PMAT 2.14 (1.7 2.5) 47.94 (28.6 65.8) 0.021 Calf IMAT/PMAT 0.18 (0.11 0.31) 8.29 (3.8 14.5) 0.043 Total IMAT/PMAT 2.3 (1.5 3.3) 56.4 (34.9 77.4) 0.021 VAT 45.3 (28.1 68.7) 288.8 (270.2 295.2) 0.021 SAT 13.8 (10.5 18.9) 125.3 (100.3 147.1) 0.021 IMAT/PMAT: intermuscular adipose tissue/perimuscular adipose tissue; VAT: abdominal visceral adipose tissue; SAT: abdominal subcutaneous adipose tissue. Values are reported as median (interquartile range). P-values were computed using the nonparametric Kruskal Wallis test (SAS 9.3). All tests were 2-sided.

Supplemental Figure Legends Supplemental Figure 1: Quantitative RT-PCR analysis of inflammatory gene expression in SM. The entire quadriceps SM (including muscle fibers, IMAT, and PMAT) harvested from mice fed normal diet (ND; n=6 8 mice/group) or high-fat diet (HFD; n=8 10 mice/group) for 12 weeks were analyzed by quantitative RT-PCR. *P<0.05, **P<0.01, P<0.001 compared with ND group. Supplemental Figure 2: Flow cytometric analysis of macrophages and T cells in SM. (A) Gating example of F4/80+ macrophages and F4/80+CD11c+ M1 macrophages. (B) Example of gating total CD3+, CD4+, and CD8+ T cells in SM of ND-fed mice. Supplemental Figure 3: Immunohistochemical staining of sections of quadriceps isolated from ND-fed mice under 10x magnification Supplemental Figure 4: Representative images of extramyocellular adipose tissue in mouse fed lower-fat diet. Cross-sectional micro-ct images of the proximal, mid, and distal thigh and midcalf for a mouse fed lower-fat diet (panels A D) with corresponding adipose tissue superimposed in red (panels E H). Supplemental Figure 5: Representative images of extramyocellular adipose tissue in 60% HFD-fed mouse. Cross-sectional micro-ct images of the proximal, mid, and distal thigh and

midcalf for a mouse fed 60% HFD (panels A D) with corresponding adipose tissue superimposed in red (panels E H). Supplemental Figure 6: Representative images of visceral adipose tissue in lean and obese mice. Cross-sectional micro-ct images of the abdomen and adipose tissue for a mouse fed lower-fat diet (panels A and B) and a mouse fed 60% HFD (panels C and D). VAT is shown in red, and SAT is shown in yellow. Supplemental Figure 7: Obesity-induced SM and systemic insulin resistance. (A) Homeostasis model assessment of insulin resistance (HOMA-IR) in lean and 60% HFD fed WT mice (n=4 mice/group). (B) Representative immunoblot and quantification of serinephosphorylated Akt [P-Akt (S473)] protein expression in SM of mice fed ND or 60% HFD and injected with 1.5 U/kg body weight regular human insulin or PBS 10 minutes prior to sacrifice. The levels of P-Akt (S473) were expressed as P-Akt/Akt ratio. Insulin-stimulated P-Akt/Akt ratio was compared between lean and obese groups. *P<0.05, P<0.001 compared with lean controls. Supplemental Figure 8: The effect of T H 1 cells on myotube inflammation and metabolic functions and the involvement of the JAK/STAT pathway. (A) Representative immunoblot and quantification of total STAT1 protein and tyrosine 701 phosphorylated STAT1 (P-STAT1) protein in SM of mice fed ND or HFD for 12 weeks. (B) Quantitative RT-PCR analysis of proinflammatory cytokine and chemokine expression in differentiated C2C12 myotubes treated with T H 1 supernatant with or without antibody neutralization of IFNγ and T H 1 supernatant in the

presence of JAK inhibitor I for 48 hours (n=6 10 samples/group). (C) mrna level (n=4 6 samples/group) and the amount of P-STAT1 protein (n=5 samples/group) in C2C12 cells treated with T H 1-conditioned medium with or without antibody neutralization of IFNγ. (D) P-Akt (S473)/Akt protein levels in differentiated C2C12 cells treated with T H 1 for 48 hours and exposed to 100 nm insulin for 15 minutes (n=4 5 samples/group). Results are shown as mean SEM of 2 separate experiments, each with 2 3 samples/group. *P<0.05, **P<0.01, P<0.001 for comparison between control and each treatment group.

Supplemental Figure 1 T cell and macrophage marker expression in SM of lean and obese mice 40 ND 30 ** ** HFD 20 * ** Relative mrna 10 5 4 ** * ** * ** 3 * 2 * 1 0 F4/80 CD11c MCP1 IL-12b IL-18 T N F α C D 3 C D 8 C D 4 R A N T E S IF N g

Supplemental Figure 2 A B

Supplemental Figure 3 Isotype control Mac3 macrophages CD3 T cells

Supplemental Figure 4

Supplemental Figure 5

Supplemental Figure 6

Supplemental Figure 7 A B HOMA-IR 150 100 50 * Insulin Lean Obese - + + + - + + + 0.8 P-Akt Akt 0 Lean Obese P-Akt (S473)/Akt 0.6 0.4 0.2 0.0 Insulin - + - + Lean Obese

Supplemental Figure 8 A ND HFD P-Stat1 Stat1 Tubulin 2.0 STAT1 ns 2.0 P-STAT1 * STAT1/Tubulin 1.5 1.0 0.5 P-STAT1/STAT1 1.5 1.0 0.5 0.0 N D H F 0.0 N D H F D

Supplemental Figure 8 B Relative mrna 4 3 2 1 IL-6 Relative mrna 2.5 2.0 1.5 1.0 0.5 ** TNFα ns ns 0 Control T H 1 T H 1+Anti-IFNγ T H 1+Jak inh. 0.0 Control T H 1 T H 1+Anti-IFNγ T H 1+Jak inh. Relative mrna 25 20 15 10 5 MCP-1 Relative mrna 20 15 10 5 RANTES 0 Control T H 1 T H 1+Anti-IFNγ T H 1+Jak inh. 0 Control T H 1 T H 1+Anti-IFNγ T H 1+Jak inh.

Supplemental Figure 8 C Control TH1 TH1+Anti-IFNg P-STAT1 (Y701) β-actin Relative mrna 20 15 10 5 STAT1 P-STAT1/β-actin 0.8 0.6 0.4 0.2 P-STAT1 ** ** 0 Control T H 1 T H 1+Anti-IFNγ 0.0 Control T H 1 T H 1+Anti-IFNγ

Supplemental Figure 8 D Control Naive CD4 TH1 TH1+Jak P-Akt Insulin inhibitor + + + + + + + + + 1.5 ** P-STAT1 (Y701) P-Akt (S473) P-Akt/Akt 1.0 0.5 Akt 0.0 Control Naive CD4 T H 1 T H 1+Jak inh.