Supplementary Figure 1

Similar documents
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Supplementary Table 1. List of primers used in this study

AP VP DLP H&E. p-akt DLP

Supplementary Figure 1

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

SUPPLEMENTARY FIGURES AND TABLE

marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is

Supplementary Figures

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.

Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at

TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement

Supplementary Information Titles Journal: Nature Medicine

SLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Figure 1.

SUPPLEMENTARY INFORMATION

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

Targeted mass spectrometry (LC/MS/MS) for Olaparib pharmacokinetics. For LC/MS/MS of Olaparib pharmacokinetics metabolites were extracted from

SUPPLEMENTARY INFORMATION

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

SUPPLEMENTARY LEGENDS...

Supplementary material. Supplementary Figure legends

Supplementary methods:

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

SUPPLEMENTARY FIGURE LEGENDS

Supplementary Figure 1. Repression of hepcidin expression in the liver of mice treated with

Supplementary Figures

Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure S1 (a) (b)

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplementary Figure 1

Supplementary Figure 1. Lkb1-deficient lung ADC progressively transdifferentiates into SCC. (a) A scheme showing the progression pattern of atypical

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

Supplementary Materials for

Figure S1A. Blood glucose levels in mice after glucose injection

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC

SUPPLEMENTARY INFORMATION

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was

Plasma exposure levels from individual mice 4 hours post IP administration at the

SUPPLEMENTARY INFORMATION

Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration

Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0

SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.

a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus

T H E J O U R N A L O F C E L L B I O L O G Y

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

SUPPLEMENTARY INFORMATION

A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.

a! b! c! Supplementary Fig. 1! Diameter (μm) S1P (LogM) U (LogM) enos! β-actin! Nogo-B! MLEC! nnos! β-actin!

Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Supplementary Figure 1. Successful excision of genes from WBM lysates and

Supplementary Figures

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events

Supplemental Table I

T H E J O U R N A L O F C E L L B I O L O G Y

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Primary Cilia Can Both Mediate and Suppress Hedgehog Pathway- Dependent Tumorigenesis (Supplementary Figures and Materials)

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Nature Medicine: doi: /nm.4324

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

Supplementary Figure 1

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Materials for

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Supplementary Information

SUPPLEMENTARY INFORMATION

Effective Targeting of Quiescent Chronic Myelogenous

Supplementary Figure S1 Supplementary Figure S2

m 6 A mrna methylation regulates AKT activity to promote the proliferation and tumorigenicity of endometrial cancer

Zhu et al, page 1. Supplementary Figures

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

Transcription:

Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor in PTEN-deficient endometrioid endometrial cancer cells. Four PTEN-deficient endometrioid endometrial cancer cell lines were treated with and as single-agents or in combination for 72 hours and then subjected to CCK8 assay. Combination index (CI) values were determined using the established method of Chou and Talalay (CalcuSyn software).

Aberrations/cell Supplementary Figure 2 Ishikawa AN3CA Nou-1 Hec-18 8 6 4 2 Ishikawa AN3CA Nou-1 Hec-18 Supplementary Figure 2. Metaphase spread analysis of chromosome aberrations in four PTEN-deficient endometrioid endometrial cancer cells treated as indicated for 48 hours. Representative metaphase spreads are shown. Arrows indicate chromosomal aberrations. Mean ± S.D. for three independent experiments are shown. P <.1; P <.1 (Student s t test).

Supplementary Figure 3 Ishikawa AN3CA 2 1 BRCA1 BRCA2 1.5 1. *.5-1. -2 -.5-3 -1. 2 1 * Nou-1 * 1 Hec-18-1 -1-2 -2-3 Supplementary Figure 3. Quantitative RT-PCR analysis of BRCA1 and BRCA2 expression in four PTEN-deficient endometrioid endometrial cancer cells treated as indicated for 24 hours. Gene expression was normalized to β-actin. Error bars represent mean ± S.D. These data are representative of three independent experiments. *P <.5; P <.1; P <.1 (Student s t test).

Supplementary Figure 4 a PTEN-KO PTEN-WT #1 #2 #3 PTEN Vinculin b PTEN-KO PTEN-WT #1 #2 #3 PTEN Supplementary Figure 4. PTEN expression analyses in Hec1-A endometrioid endometrial cancer cells. (a) Western blot analysis of PTEN in PTEN-proficient (PTEN-WT) and deficient (PTEN-KO) Hec-1A endometrioid endometrial cancer cells. Vinculin was used as a loading control. (b) Representative images of immunocytochemical staining analysis of PTEN in PTEN-proficient (PTEN-WT) and deficient (PTEN-KO) Hec-1A endometrioid endometrial cancer cells. Scale bar, 5 μm.

Supplementary Figure 5 PTEN-WT PTEN-KO cleaved-parp p-akt p-s6rp p-4ebp1 Vinculin Supplementary Figure 5. Western blot analysis of proteins as indicated in PTENproficient (PTEN-WT) and deficient (PTEN-KO #3) Hec-1A endometrioid endometrial cancer cells treated with and as single-agents or in combination for 24 hours. Vinculin was used as a loading control.

Supplementary Figure 6 PTEN-WT 4 3 BRCA1 BRCA2 2 1 PTEN-KO.5. -.5-1. -1.5-2. Supplementary Figure 6. Quantitative RT-PCR analysis of BRCA1 and BRCA2 mrna expression in PTEN-proficient (PTEN-WT) and deficient (PTEN-KO #3) Hec-1A endometrioid endometrial cancer cells treated as indicated for 24 hours. Gene expression was normalized to β-actin. Error bars represent mean ± S.D. These data are representative of three independent experiments. P <.1; P <.1 (Student s t test).

Supplementary Figure 7 Normal Tumor PTEN LKB1 Supplementary Figure 7. Representative images of immunohistochemical staining of PTEN and LKB1 proteins in Pten/Lkb1-deficient endometrioid endometrial tumors (right panels). Scale bar, 5 μm. Left panels, normal uterus.

Relative body weight (%) Supplementary Figure 8 11 15 1 95 9 2 4 6 8 1 12 14 16 18 2 22 Treatment days Supplementary Figure 8. Changes in body weight of Ade-Cre injected Pten loxp/loxp /Lkb1 loxp/loxp mice during 21 days treatments of (5 mg/kg/day, intraperitoneal injection) and (3 mg/kg/day, oral gavage) as single-agents or in combination. Error bars represent mean ± S.E.M. (n = 6-7 per treatment group).

Supplementary Figure 9 Ishikawa AN3CA Nou-1 Hec-18 (μm) 2 8 2 8 2 8 2 8 p-akt Vinculin Supplementary Figure 9. Western blot analysis of p-akt in four PTEN-deficient endometrioid endometrial cancer cell lines treated with for 24 hours. Vinculin was used as a loading control.

IOD value of p-akt Supplementary Figure 1 p-akt 3 2 1 Supplementary Figure 1. Immunohistochemical staining of p-akt in Pten/Lkb1- deficient endometrioid endometrial tumors. Representative images of immunohistochemical staining from Ade-Cre injected Pten loxp/loxp /Lkb1 loxp/loxp mice treated with (5 mg/kg/day, intraperitoneal injection) for 1 days (right panel). Scale bar, 25μm. Tumor treated with vehicle was used as a control (left panel). Quantification of IOD value is shown (bottom panel). Error bars represent mean ± S.E.M. (n = 6 per group). P <.1 (Student s t test).

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback