Kerdiles et al - Figure S1

Similar documents
CD44

Tbk1-TKO! DN cells (%)! 15! 10!

SUPPLEMENTARY FIGURES

Supplementary Materials for

Supporting Information Table of Contents

Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and

Supplementary table I. Real-time primers used in the study. The fold change was obtained by

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Supplementary Figures

Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.

Supplementary Figure 1 IL-27 IL

SUPPLEMENTARY INFORMATION

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplemental Figure 1

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

Foxo Transcription Factors Control Regulatory T Cell Development and Function

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.

SUPPLEMENTARY INFORMATION

SUPPORTING INFORMATIONS

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1 Cytokine receptors on developing thymocytes that can potentially signal Runx3d expression.

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Table I.

Supplementary Information

Supplementary Information:

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Supplementary information CD4 T cells are required for both development and maintenance of disease in a new model of reversible colitis

B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Table S1. Viral load and CD4 count of HIV-infected patient population

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

Nature Immunology: doi: /ni Supplementary Figure 1. Examples of staining for each antibody used for the mass cytometry analysis.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

SUPPLEMENTARY INFORMATION

Transcription factor Foxp3 and its protein partners form a complex regulatory network

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

Supplementary Figure 1

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Title. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)

SUPPLEMENTARY FIGURE 1

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Spleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.

Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.

Supplementary Figure 1.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Supplementary Figures for TSC1 controls macrophage polarization to prevent inflammatory disorder by Linnan Zhu et al

% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Nature Medicine: doi: /nm.3922

Trim29 gene-targeting strategy. (a) Genotyping of wildtype mice (+/+), Trim29 heterozygous mice (+/ ) and homozygous mice ( / ).

Supplementary Table e-1. Flow cytometry reagents and staining combinations

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

pplementary Figur Supplementary Figure 1. a.

Supplementary Figure 1

Mouse Clec9a ORF sequence

An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action

Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.

Nature Medicine doi: /nm.3957

SUPPLEMENTARY INFORMATION

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Maintaining T lymphocytes in sufficient numbers and at an

Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)

Mst1 regulates integrin-dependent thymocyte trafficking and antigen recognition in the thymus

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Transduction of lentivirus to human primary CD4+ T cells

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human

BCR-ABL - LSK BCR-ABL + LKS - (%)

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

Supplementary Figure 1

Dendritic cells in cancer immunotherapy Aimin Jiang

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell maturation. T-cell Maturation. What allows T cell maturation?

Supplementary Figure 1. Ex vivo IFNγ production by Tregs. Nature Medicine doi: /nm % CD127. Empty SSC 98.79% CD25 CD45RA.

Transcription:

Kerdiles et al - Figure S1 a b Homo sapiens T B ce ce l ls c l M ls ac r PM oph N ag es Mus musculus Foxo1 PLCγ

Supplementary Figure 1 Foxo1 expression pattern is conserved between mouse and human. (a) Expression profile of Foxo1 in mouse and (b) human tissues and cell subsets according to the Gene Atlas from the Genomics Institute of the Novartis Foundation (GNF) (http://symatlas.gnf.org/symatlas/). (c) Immunoblot analysis of Foxo1 expression in purified cells subsets. T and B cells were isolated from LN and spleen respectively. Macrophages and Polymorphonuclear cells (PMNs) were isolated from the peritoneal cavity of mice elicited with thioglycolate. Representative results from two independent experiments. 1

Kerdiles et al - Figure S2 a Foxo1 f/f Cd4Cre T cell-dna Foxo1 f/f Foxo1 f/f Tail-DNA Foxo1 f/+ Foxo1 Foxo1 f Foxo1 + b Foxo1 f/f Foxo1 f/f Cd4Cre Foxo1 f/f Foxo1 f/f Cd4Cre Foxo1 β-tubulin T cells B cells c Foxo1 f/f Foxo3 +/Kca Foxo3 Kca/Kca Foxo1 f/f Foxo3 +/+ Cd4Cre Foxo3 Foxo1 PLCγ T cells

Supplementary Figure 2 Efficient deletion of Foxo1 in peripheral T cells of Foxo1 f/f CD4Cre mice. (a) PCR analysis of Foxo1 genomic deletion in purified LN T cells and tail sample. (b) Immunoblot analysis of Foxo1 expression in purified LN T and B cells. (c) Immunblot analysis of Foxo1 and Foxo3 expression in purified LN T cells. Representative results from two to four experiments (a-c). 2

Kerdiles et al - Figure S3 a pln 1.2 TCRβ+ CD4+ Foxo1f/f Foxo1f/fCd4Cre 4.7 IL-4 42.7 0.14 0.007 IL-17 0.9 b 12.3 CD44hi T CD4 T CD8 CD69 2.5 12 1.18 2.1 IFNγ IFNγ 18 Foxo1f/fCd4Cre 7.7 56.2 18.1 TNF mln 1.2 Foxo1f/f TCRβ+ CD8+ CD62L Foxo1f/f Foxo1f/fCd4Cre

Supplementary Figure 3 Foxo1 deletion in T cells induces the accumulation of activated and memory phenotype T cells in peripheral lymphoid organs. (a) LN cells from individual mice were stimulated for 4.5 h with PMA and ionomycin, in presence of Brefeldin A for the last 3 h. Stimulated cells were then surface stained, fixed, permeabilzed and intracellularly-stained for the indicated cytokines. (pln: peripheral lymph nodes (inguinal, brachial, axillary), mln: mesenteric lymph nodes). Representative results from n 6 mice per genotype analyzed in three independent experiments. (b) CD69 and CD62L expression on LN CD44 hi TCRβ + CD4 + and TCRβ + CD8 + cells of 8-12 week-old mice. Representative results for n 8 mice per staining and per genotype, analyzed in at least three independent experiments. 3

Kerdiles et al - Figure S4 a Foxo1 +/+ LckCre Foxo1 f/f LckCre 8.1 84 8.1 84 CD4 4.4 2 4.4 2.5 CD8 b TCRb hi CD24 lo (%) 10.0 ns 7.5 5.0 2.5 0.0 Foxo1 +/+ LckCre Foxo1 f/f LckCre TCRb hi CD24 lo (%) 75 50 25 0 *** CD4 + CD8 + Foxo1 +/+ LckCre Foxo1 f/f LckCre

Supplementary Figure 4 Foxo1 is dispensable for T cell development. (a) CD4 and CD8 expression and (b) proportion of mature T cells (TCRβ hi HSA lo ) and percentage of CD4 + and CD8 + single positive cells among TCRβ hi HSA lo cells (mean±s.e.m.) on thymocytes of 8-week-old mice. Each circle indicates one mouse. Data represent n = 5 Foxo1 +/+ and n = 7 Foxo1 f/f mice, analyzed in two independent experiments (a and b) (***,p<0.0001; ns: not significant). 4

Kerdiles et al - Figure S5 TCRβ hi DP CD4 + CD8 + L-selectin CCR7 CD44 CD127 Bcl-2 Isotype Foxo1 f/f Foxo1 f/f ;CD4Cre

Supplementary Figure 5 Impaired expression of L-selectin, Ccr7 and IL-7Rα on thymic mature T cells. Representative results of n 6 mice per staining and per genotype, analyzed in at least two independent experiments. 5

b 10 T cells Tamox. 1 + + Foxo1 0.1 0.01 PLCγ 0.001 xo Fo xo 1 f/f 1 f/f ER C re a Foxo1 mrna (relative) Kerdiles et al - Figure S6 d Fo 17 81 18 CD4 81 Foxo1f/fERCre 40 CD8 58 CD44 56 42 1.5 1.0 0.5 0.0 Bim mrna (relative) Foxo1f/f Foxo3a mrna (relative) c 2.0 1.5 1.0 0.5 0.0 Foxo1f/f Foxo1f/fERCre

Supplementary Figure 6 Short term tamoxifen treatment induces efficient deletion of Foxo1 and does not alter the ratio of naïve to activated-memory phenotype T cells in Foxo1 f/f ERCre mice. (a-d) Foxo1 f/f ERCre mice and littermates were treated for 5 days with tamoxifen and rested for 5 days. (a) QPCR anaysis of Foxo1 mrna expression, normalized to Hprt mrna, in purified LN T cells. (b) Immunoblot analysis of Foxo1 expression in purified LN T cells. Representative results of three independent experiments. (c) CD44 expression by LN TCRβ + CD4 + and TCRβ + CD8 + cells. (d) QPCR analysis of Foxo3 and Bim mrna expression, normalized to Hprt mrna, in purified LN T cells. Each circle indicates one mouse (a and d). Data represent n 6 mice analyzed in at least two independent experiments (a, c and d) (***,p<0.0001; ns: not significant). 6

Kerdiles et al - Figure S7 a ECR 1 2 Il7ra 3 Opposum Human Chimp Dog Rhesus Rat 0 b Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum Mouse Dog Human Macaque Opossum 10Kb 20Kb -------------------------------------------AATTGTATCATGTCTCT AGGTGTCATGAATTGCT--CAGATTGTCACTCCATGGGTGAGTAATTGGGTTGTGTCTCT AAATCTCCTAAACTGCTAACAGATTGTCACTTCATGGGTGAGTAACTGGGTTATGTCTCT AGATCTCCTAAACGGCTAACAGATTGTCACTTCATGGGTGAGTAACTGGGTCATGTCTCT -------------------------------------------AATTGGGTAATGTCTCT ** ** * ******* FoxO TTAAATTCTCTTGTTTATCATTTAAGTGGACCATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCATTTTAGTGGACTATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCATTTAAGTGGACTATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCATTTAAGTGGACTATCATTTTGATTGTATCTCTTTCCTTTA TTAAATTCTCTTGTTTATCACTTAAATGGACTATCATTTTGATTTTATCTCTTTCCTTCA ******************** ** * ***** ************ ************* * GR GTTGTGAAGATGTAAAAGAACAAAGTTAAGACATAATATTTTGGTACAGCATGTGCTAGT GTTGTGAAGATGTAAAAGAACAAAGCCAAGACACAATATTTTGGTACAGCATGTGCTAGT GTTGTGAAGATGTAAAAGAACAAAGCCAAGACACAATATTTTGGTACAGCATGTGCTGGT GTTGTGAAGATGTAAAAGAACAAAGCCAAGACACAATATTTTGGTACAGCATGTGCTGGT GATGTGAAG---CAAAAGAACAAAAA-AGGGCACAATATTTTGGTTCGGCTTGTGATCTT * ******* *********** * * ** *********** * ** **** * * NF-κB SP1 TTGCTCAGGGGATTTCCACTGGTGTGCTTACCCCTTTTGGGTGGGG-CAGGAGATGCTGA TTGCTCAGGGGATTTCCACTGGTGTACTTACTCTTTTTGGGTGGGG-CAGGAGATGCCGA TTGTTCTGGGGATTTCCACAGGGGTGCTTACTCT---TGGGTGGGG-CAGGAGATGCTGA TTGTTCTGGGGATTTCCACAGGGGTGCTTACTTTC--TGGGTGGGG-CAGGAGATGCTGA CAGCTCAGGGGATTTCCACTGGTATGTTCTCTTC----GGGTGGGGACAGGGGATGCTCT * ** ************ ** * * * ******** **** ***** A-AGGACATCAGAGAGAAATCTAAATAGAGTGCGGGAAGCTTAAAG-------------A-GGACC--TAGAGAGAAACCTAGATATAGTGCGGGGAGCTCAAAGAAAA--GAGAAGTC A-AAGACCTCAGAGAGAAGCCTAAA----GTGTGGGGAGCTCAAAGAAAAATGACATGCG A-AAGACCTCAGAGAGAAGCCTAAA----GTGTGGGGAGCTCAAAGAAAAATGACATGCA CTGAGGAACCAGAGAGGAGCCCAAA------GAGAGCTGCCACAAG-------------****** * * * * * * * ** ***

Supplementary Figure 7 Genomic sequence alignment of the Il7ra enhancer. (a) Comparative alignment of the Il7ra loci from NCBI decode.org (http://www.dcode.org/). (b) The aligned sequences from ECR2 showing the conserved Foxo, glucocorticoid receptor (GR), and NFκB binding sites. 7

Kerdiles et al - Figure S8 TCRβ + CD4 + CD44 lo TCRβ + CD8 + CD44 lo L-Selectin C57BL/6 IL-7Rα / CCR7

Supplementary Figure 8 IL-7Rα is not required for L-selectin and Ccr7 expression on naïve T cells. L-selectin and Ccr7 expression on spleen CD44 lo CD4 + and CD8 + T cells from wildtype and Il7ra / mice. Representative results of n = 4 mice per genotype. 8

Kerdiles et al - Figure S9 a b Il7ra TCRβ + CD4 + CD44 lo TCRβ + CD8 + CD44 lo CD8 + CD44 lo CD4 + CD44 lo CD127 *** *** 0 20 40 60 80 100 CD127 MFI (%) Pten +/+ ERCre Pten f/f ERCre L-selectin * *** 0 20 40 60 80 100 L-selectin MFI (%) c Il7ra mrna ( fold change ) Il7ra mrna (relative) 1.5 1.0 0.5 0.0 *** Pten +/+ ;ERCre Pten f/f ;ERCre 12 * Pten +/+ ERCre 10 Pten f/f ERCre 8 6 4 2 ** 0 IL-7

Supplementary Figure 9 PTEN-mediated control of IL-7Rα and L-selectin on naïve T cells. (a-c) Mice were treated with tamoxifen for 5 days and rested for 5 days. (a) Quantification of CD127 and L-selectin expression on LN CD44 lo TCRβ + CD4 + and TCRβ + CD8 + cells (mean ± s.e.m.). Data represent n=7 Pten +/+ and n=9 Pten f/f mice (CD127); and n=3 PTEN +/+ and n=6 PTEN f/f mice (L-selectin), analyzed in two independent experiments. (b) QPCR analysis of Il7ra mrna expression, normalized to Hprt mrna, in purified LN T cells. Each circle indicates one mouse. (c) Purified LN T cells were cultured overnight in media supplemented or not with IL-7 (10 ng/ml) and Il7ra mrna was quantified by QPCR. Results are presented as fold change (mean ± s.d. of triplicate culture) relative to the value obtained for freshly isolated T cells set to 1. Representative results of two independent experiments (*,p<0.05; **, p<0.01; ***,p<0.0001). 9

Supplementary Table I Antibodies Antibody specificity Clone Identifier Source TCRbeta H57-597 ebioscience CD44 IM7 ebioscience CD4 GK1.5 ebioscience CD8 53-6.7 BioLegend CD24 30-F1 BD Biosciences L-selectin (CD62L) MEL-14 ebioscience CCR7 4B12 ebioscience CD45.1 A20 ebioscience CD45.2 104 ebioscience Bcl-2 10C4 Santa Cruz Biotechnology IL-7R (CD127) A7R34 ebioscience gc (CD132) 4G3 BD Biosciences b-tubulin AA2 Upstate-Millipore PLCg B-6-4 Santa Cruz Biotechnology IL-4 11B11 ebioscience IL-17 TC11-18H10 BD Biosciences IFNg XMG1.2 ebioscience TNF MP6-XT22 ebioscience CD69 H1.2F3 ebioscience Foxo1 76E10 Cell Signaling Foxo3 Rabbit anti-mouse Foxo3 Gift, A. Brunet, Stanford U

Supplementary Table II Primers used to quantitate gene expression Primer sequence Gene tcattatgccgaggatttgga Hprt S cagagggccacaatgtgatg Hprt AS tgtcaggctaagagttagtgagca Foxo1 S gggtgaagggcatctttg Foxo1 AS aagtggaaatgcccaggat Il7ra S ttgacttccatccacttcca Il7ra AS ggttactgaataccaagggaacttt IL2rg S tggcagaaccgttcactgta IL2rg AS ctaaaggcgcatctgcgta Klf2 S tagtggcgggtaagctcgt Klf2 AS tgatttctacagcccccaga Ccr7 S gcacacctggaaaatgacaa Ccr7 AS ccaagtgtgctttcaactgttc Sell S aaaggctcacactggaccac Sell AS ggagacgagttcaacgaaactt Bim S aacagttgtaagataaccatttgagg Bim AS aagcaggcctcatctcaaag Foxo3 S cgtcagtttgagggtctgc Foxo3 AS Supplementary Table III Primers used for Chromatin Immunoprecipitation (ChIP) Primer sequence Il7ra gene region acctcatcagcctttcatgg Il7ra-ECR2 S atcccctgagcaaactagca Il7ra-ECR2 AS agcaaaaggattgctgctgt Il7ra-ECR1 S aagtgtggattttggcttg Il7ra-ECR1 AS tcttgggtgttgatgtggaa Il7ra-ECR3 S gtgccaggcttctttcata Il7ra-ECR3 AS 1

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback